First Report of Tomato chlorosis virus Infecting Tomato in Georgia

Tomato yellow leaf curl virus (TYLCV) and Tomato spotted wilt virus (TSWV) are prevalent in field-grown tomato (Solanum lycopersicum) production in Georgia. Typical TYLCV symptoms were observed during varietal trials in fall 2009 and 2010 to screen genotypes against TYLCV at the Coastal Plain Experiment Station, Tifton, GA. However, foliar symptoms atypical of TYLCV including interveinal chlorosis, purpling, brittleness, and mottling on upper and middle leaves and bronzing and intense interveinal chlorosis on lower leaves were also observed. Heavy whitefly (Bemisia tabaci (Gennadius), B biotype) infestation was also observed on all tomato genotypes. Preliminary tests (PCR and nucleic acid hybridization) in fall 2009 indicated the presence of TYLCV, TSWV, Cucumber mosaic virus, and Tomato chlorosis virus (ToCV); all with the exception of ToCV have been reported in Georgia. Sixteen additional symptomatic leaf samples were randomly collected in fall 2010 and the preliminary results from 2009 were used to guide testing. DNA and RNA were individually extracted using commercially available kits and used for PCR testing for ToCV, TYLCV, and TSWV. Reverse transcription (RT)-PCR with ToCV CP gene specific primers (4) produced approximately 750-bp amplicons from nine of the 16 leaf samples. Four of the nine CP gene amplicons were purified and directly sequenced in both directions. The sequences were 99.4 to 100.0% identical with each other (GenBank Accession Nos. HQ879840 to HQ879843). They were 99.3 to 99.5%, 97.2 to 97.5%, and 98.6 to 98.9% identical to ToCV CP sequences from Florida (Accession No. AY903448), Spain (Accession No. DQ136146), and Greece (Accession No. EU284744), respectively. The presence of ToCV was confirmed by amplifying a portion of the HSP70h gene using the primers HSP-1F and HSP-1R (1). RT-PCR produced approximately 900-bp amplicons in the same nine samples. Four HSP70h gene amplicons were purified and directly sequenced in both directions. The sequences were 99.4 to 99.7% identical to each other (Accession Nos. HQ879844 to HQ879847). They were 99.2 to 99.5%, 98.0 to 98.4%, and 98.9 to 99.3% identical to HSP70h sequences from Florida (Accession No. AY903448), Spain (Accession No. DQ136146), and Greece (Accession No. EU284744), respectively. TYLCV was also detected in all 16 samples by PCR using degenerate begomovirus primers PAL1v 1978 and PARIc 496 (3) followed by sequencing. TSWV was also detected in two of the ToCVinfected samples by RT-PCR with TSWV N gene specific primers (2) followed by sequencing. To our knowledge, this is the first report of the natural occurrence of ToCV in Georgia. Further studies are required to quantify the yield losses from ToCV alone and synergistic interactions between ToCV in combination with TSWV and/or TYLCV in tomato production in Georgia. References: (1) T. Hirota et al. J. Gen. Plant Pathol. 76:168, 2010. (2) R. K. Jain et al. Plant Dis. 82:900, 1998. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) L. Segev et al. Plant Dis. 88:1160, 2004.

Download Full-text

First Report of Tomato chlorosis virus in Potato in Brazil

Plant Disease ◽

10.1094/pdis-12-11-1068-pdn ◽

2012 ◽

Vol 96 (4) ◽

pp. 593-593 ◽

Cited By ~ 18

Author(s):

D. M. S. Freitas ◽

I. Nardin ◽

N. Shimoyama ◽

J. A. C. Souza-Dias ◽

J. A. M. Rezende

Keyword(s):

Leaf Roll ◽

Rt Pcr ◽

Specific Primers ◽

Total Rna ◽

First Report ◽

Interveinal Chlorosis ◽

Potato Plants ◽

The World ◽

Tomato Chlorosis Virus ◽

Biotype B

Potato plants (Solanum tuberosum cv. Ágata) exhibiting symptoms of leaf roll and interveinal chlorosis, especially on older leaves, were found in a commercial crop in the County of Cristalina, State of Goiás, Brazil in June 2011. The crop was severely infested by whitefly Bemisia tabaci biotype B. Four potato tubers from symptomatic plants were indexed for the presence of the following viruses: Tomato chlorosis virus (ToCV), Potato leaf roll virus (PLRV), Tomato severe rugose virus (ToSRV), and Potato virus Y (PVY). Total RNA was extracted separately from each tuber and used for reverse transcription (RT)-PCR using the HS-11/HS-12 primer pair, which amplifies a fragment of 587 bp from the highly conserved region of the heat shock protein (HSP-70) homolog gene reported for ToCV. The RT-PCR product was subsequently tested by nested-PCR for detection of ToCV with specific primers ToC-5/ToC-6 (2). Amplicons of 463 bp, amplified from total RNA separately extracted from three tubers, were purified and directly sequenced. Comparisons among the three consensus sequences of 448 bp (GenBank Accession Nos. JQ288896, JQ288897, and JQ288898) revealed respectively, 98, 100, and 100% identity with the reported sequence of a tomato isolate of ToCV from Brazil (GenBank Accession No. EU868927) (1). For ToSRV detection, total DNA was extracted from two tubers and a fragment of approximately 820 bp was amplified by PCR with specific primers (3). PLRV and PVY were indexed in two and three tubers, respectively, by double-antibody sandwich-ELISA (SASA, Edinburg, Scotland). Virus-free B. tabaci biotype B were separately transferred to potato and tomato leaves infected with ToCV for an acquisition access period of 24 h. Groups of 30 viruliferous whitefly were transferred to four, young, sprout-grown potato plants cv. Ágata (two plants per virus isolate) for 24-h inoculation access period. After 37 days of inoculation, one plant inoculated with the potato and tomato isolates of ToCV, respectively exhibited symptoms of leaf roll and interveinal chlorosis on order leaves, which were similar to that induced by PLRV. Experimental infection of potato plants with ToCV, which induced leaf roll symptoms resembling PLRV infection, was reported in the United States by Wisler et al. (4). The potato isolate of ToCV was also transmitted by B. tabaci to one of two inoculated tomato plants. The presence of ToCV in all inoculated plants was detected by nested-RT-PCR as described above. To our knowledge, this is the first report on detection of ToCV in field potato plants in the world. Considering that ToCV occurs in innumerous countries around the world, it is transmitted by a cosmopolitan insect, and it induces symptoms similar to PLRV, this finding triggers an alert to field dependent seed-potato multiplication, virus inspector, and certification system. References: (1) J. C. Barbosa et al. Plant Dis. 92:1709, 2008. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002. (3) F. R. Fernandes et al. Trop. Plant Pathol. 35:43, 2010. (4) G. C. Wisler et al. Plant Dis. 82:270, 1998.

Download Full-text

First Report of Tomato chlorotic dwarf viroid in Greenhouse Tomatoes in Arizona

Plant Disease ◽

10.1094/pdis-93-10-1075b ◽

2009 ◽

Vol 93 (10) ◽

pp. 1075-1075 ◽

Cited By ~ 18

Author(s):

K.-S. Ling ◽

J. Th. J. Verhoeven ◽

R. P. Singh ◽

J. K. Brown

Keyword(s):

Direct Sequencing ◽

Leaf Tissue ◽

Natural Occurrence ◽

Rt Pcr ◽

Nucleotide Substitutions ◽

Tomato Production ◽

First Report ◽

Sequence Identity ◽

Tomato Chlorotic Dwarf Viroid ◽

Plant Pathol

Tomato chlorotic dwarf viroid (TCDVd), a member of the genus Pospivroid, family Pospiviroidae, was first identified on greenhouse tomato (Solanum lycopersicum) in Canada (2). Since then, it has also been reported elsewhere, e.g., on tomato in Colorado (4). During 2006 in Arizona, tomato plants in a large greenhouse facility with continuous tomato production exhibited viroid-like symptoms of plant stunting and chlorosis of the young leaves. Symptomatic plants were often located along the edge of the row, indicating the presence of a mechanical transmissible agent. Approximately 4% of the plants in this greenhouse were symptomatic in 2008. Symptoms were distinctly different from those caused by Pepino mosaic virus (PepMV), a virus that was generally present in this greenhouse and also in our test samples. Other commonly occurring tomato viruses were ruled out by serological, PCR, or reverse transcription (RT)-PCR tests in multiple laboratories. RT-PCR with two sets of universal pospiviroid primers, PospiI-FW/RE and Vid-FW/RE (4), yielded amplicons of the expected sizes of 196 and 360 bp in three samples collected from symptomatic plants. Direct sequencing of the amplicons revealed that the genome was 360 nt and 100% identical to the type TCDVd from Canada (GenBank Accession No. AF162131) (2). Mechanical inoculation with leaf tissue extract from four samples to plants of the tomato ‘Money-Maker’ resulted in the same viroid-like symptoms and TCDVd was confirmed in these plants by RT-PCR and sequencing. In both 2007 and 2008, 18 samples were tested using primers PSTVd-F and PSTVd-R (1), which are capable of amplifying the full TCDVd genome. Analysis of the sequences from the amplicons revealed two genotypes of TCDVd. The first genotype (GenBank Accession No. FJ822877) was identical to the type TCDVd and found in 11 samples from 2007 and one from 2008. The second genotype (GenBank Accession No. FJ822878) was 361 nt, differing from the first by nine nucleotide substitutions, 2 insertions, and 1 deletion. This second genotype was found in 7 and 17 samples from 2007 and 2008, respectively, and showed the highest sequence identity (97%) to a Japanese tomato isolate (AB329668) and a much lower sequence identity (92%) to a U.S. isolate previously identified in Colorado (AY372399) (4). The origin of TCDVd in this outbreak is not clear. The genotype identified first could have been introduced from a neighboring greenhouse where the disease was observed before 2006 and where this genotype also was identified in 2007. The second genotype may have been introduced from infected seed since TCDVd has recently been shown to be seed transmitted in tomato (3). To our knowledge, this is the first report of natural occurrence of TCDVd in Arizona. References: (1) A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997. (2) R. P. Singh et al. J. Gen. Virol. 80:2823, 1999. (3) R. P. Singh and A. D. Dilworth. Eur. J. Plant Pathol. 123:111, 2009. (4) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004.

Download Full-text

First Report of Tomato chlorosis virus in Tomato in Costa Rica

Plant Disease ◽

10.1094/pdis-93-9-0970a ◽

2009 ◽

Vol 93 (9) ◽

pp. 970-970 ◽

Cited By ~ 4

Author(s):

R. M. Castro ◽

E. Hernandez ◽

F. Mora ◽

P. Ramirez ◽

R. W. Hammond

Keyword(s):

Costa Rica ◽

Sequence Analysis ◽

Nucleotide Sequence Analysis ◽

Rt Pcr ◽

Greenhouse Whitefly ◽

Specific Primers ◽

First Report ◽

Sequence Identity ◽

Pcr Products ◽

Tomato Chlorosis Virus

In early 2007, severe yellowing and chlorosis symptoms were observed in field-grown and greenhouse tomato (Solanum lycopersicum L.) plants in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies, including the greenhouse whitefly Trialeurodes vaporariorum (Westwood), were observed in the fields and on symptomatic plants. Total RNA was extracted from silica gel-dried tomato leaf tissue of 47 representative samples (all were from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription (RT)-PCR reactions were performed separately with each of the four primer sets with the Titan One-Tube RT-PCR Kit (Roche Diagnostics Corp., Chicago IL). Specific primers used for the detection of the criniviruses, Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV), were primer pair ToCV-p22-F (5′-ATGGATCTCACTGGTTGCTTGC-3′) and ToCV-p22-R (5′-TTATATATCACTCCCAAAGAAA-3′) specific for the p22 gene of ToCV RNA1 (1), primer pair ToCVCPmF (5′-TCTGGCAGTACCCGTTCGTGA-3′) and ToCVCPmR (5′-TACCGGCAGTCGTCCCATACC-3′) designed to be specific for the ToCV CPm gene of ToCV RNA2 (GenBank Accession No. AY903448) (2), primer pair ToCVHSP70F (5′-GGCGGTACTTTCGACACTTCTT-3′) and ToCVHSP70R (5′-ATTAACGCGCAAAACCATCTG-3′) designed to be specific for the Hsp70 gene of RNA2 of ToCV (GenBank Accession No. EU284744) (1), and primer pair TICV-CP-F and TICV-CP-R specific for the coat protein gene of TICV (1). Amplified DNA fragments (582 bp) were obtained from nine samples, four from the greenhouse and five from the open field, with the ToCV-p22 specific primers and were cloned into the pCRII TOPO cloning vector (Invitrogen, Carlsbad, CA). Nucleotide sequence analysis of all purified RT-PCR products verified their identity as ToCV, sharing 99.5 to 100% sequence identity among themselves and 96% to 98% sequence identity with previously reported ToCV p22 sequences from Florida (Accession No. AY903447), Spain (Accession No. DQ983480), and Greece (Accession No. EU284745). The presence of ToCV in the samples was confirmed by additional amplification and sequence analysis of the CPm (449-bp fragment) and Hsp70 (420-bp fragment) genes of ToCV RNA2 and sharing 98 to 99% sequence homology to Accession Nos. AY903448 and EU284774, respectively. One representative sequence of the p22 gene of the Costa Rican isolate was deposited at GenBank (Accession No. FJ809714). No PCR products were obtained using either the TICV-specific primers nor from healthy tomato tissue. The ToCV-positive samples were collected from a region in the Central Valley around Cartago, Costa Rica. To our knowledge, this is the first report of ToCV in Costa Rica. The economic impact on tomato has not yet been determined. Studies are underway to determine the incidence of ToCV in Costa Rica field-grown and greenhouse tomatoes. References: (1) A. R. A. Kataya et al. Plant Pathol. 57:819, 2008. (2) W. M. Wintermantel et al. Arch. Virol. 150:2287, 2005.

Download Full-text

First Report of Natural Infection of Zucchini by Tomato Chlorosis Virus and Cucurbit Chlorotic Yellows Virus in China

Plant Disease ◽

10.1094/pdis-05-20-0932-pdn ◽

2021 ◽

Author(s):

Xiaohui Sun ◽

Ning Qiao ◽

Xianping Zhang ◽

Lianyi Zang ◽

Dan Zhao ◽

...

Keyword(s):

Natural Infection ◽

Pcr Analysis ◽

Control Group ◽

Rt Pcr ◽

Degenerate Primers ◽

Specific Primers ◽

First Report ◽

Sequence Identity ◽

Tomato Chlorosis Virus ◽

Cucurbit Chlorotic Yellows Virus

Zucchini (Cucurbita pepo) is an extensively cultivated and important economic cucurbit crop in China. In September 2018 and 2019, interveinal chlorosis and yellowing symptoms, suspected to be caused by either tomato chlorosis virus (ToCV; genus Crinivirus) or cucurbit chlorotic yellows virus (CCYV; genus Crinivirus) or by their co-infection, were observed on zucchini plants in a greenhouse in Shandong Province, China. The incidence of the disease in the greenhouse was 20–30%. To identify the causal agent(s) of the disease, leaf samples from 66 zucchini plants were collected in 14 greenhouses in the cities of Shouguang (n = 12), Dezhou (n = 36), Qingzhou (n = 12), and Zibo (n = 6) in Shandong. Four whitefly (Bemisia tabaci) samples and four symptomatic tomato samples were also collected from these sampling sites (one each for each site) because numerous whiteflies were observed in the sampling greenhouses and ToCV was previously reported in greenhouse tomato plants from these regions (Zhao et al. 2014). To determine whether the symptoms were associated with Crinivirus infection, reverse transcription polymerase chain reaction (RT-PCR) using Crinivirus-specific degenerate primers (CriniRdRp251F/CriniRdRp995R) (Wintermantel and Hladky 2010) was performed first on total RNA extracted using the TRIzol protocol (Jordon-Thaden et al. 2015). Thereafter, the RNA samples were subjected to RT-PCR with ToCV- or CCYV-specific primers (Sun et al. 2016; Gan et al. 2019). Of the 66 zucchini samples, 54 tested positive by the degenerate crinivirus primer pair; and among them, 10 tested positive for ToCV only, 40 positive for CCYV only, and 4 positive for both viruses. Interestingly, while both viruses were detected in all B. tabaci samples, only ToCV was detected in the tomato samples (n = 4). To confirm the identity of the viruses, the amplicons of ToCV (four samples each of tomato, B. tabaci and zucchini) and CCYV (four samples each of B. tabaci and zucchini) were Sanger sequenced (Tsingke Biotechnology Co., Ltd., Beijing, China) after cloning into pMD18-T vectors (Takara, Shiga, Japan). BLASTn analysis demonstrated that all sequences were identical to their respective amplicons. The ToCV sequences (GenBank accession numbers: tomato, MN944406; B. tabaci, MN944404; zucchini, MN944405) shared 100% sequence identity with isolates from Beijing (KT751008, KC887999, KR184675, and KP335046), Hebei (KP217196), and Shandong (KX900412). The CCYV sequence (GenBank accession number MT396249) shared 99.9% sequence identity with isolates China (JN126046, JQ904629, KP896506, KX118632, KY400633, and MK568545), Greece (LT716000, LT716001, LT716002, LT716005, and LT716006), and Cyprus (LT992909, LT992910, and LT992911). To assess the transmissibility of ToCV and CCYV, virus-free B. tabaci (n = 30) were placed in ToCV or CCYV-infected zucchini plants for one day for virus acquisition. Thereafter, the whiteflies were transferred into virus-free zucchini seedlings (cv. ‘Zaoqingyidai’, 4-leaf-stage, n = 6 for each of the control, ToCV and CCYV treatment) for one day. Three weeks after inoculation, all plants that were inoculated with either ToCV or CCYV displayed same symptoms as those observed in the greenhouses, whereas plants in the control group remained symptom free. RT-PCR analysis using ToCV- and CCYV-specific primers confirmed the infection of the plants with the respective virus, whereas control plants were free from the viruses. CCYV has been previously reported on zucchini in Algeria (Kheireddine et al. 2020), Iran (LR585225), and Cyprus (LT992910). To our knowledge, this is the first report of CCYV infection in zucchini in China, and moreover the first report of ToCV infection in zucchini in the world. Clearly, stringent management is needed to minimize the losses caused by these viruses in greenhouse operations in the region.

Download Full-text

First Report of Impatiens necrotic spot virus in Gentiana macrophylla in China

Plant Disease ◽

10.1094/pdis-09-10-0685 ◽

2011 ◽

Vol 95 (3) ◽

pp. 357-357 ◽

Cited By ~ 1

Author(s):

M. Ding ◽

Y. Yin ◽

Q. Fang ◽

S. Li ◽

Z. Zhang

Keyword(s):

Sandwich Elisa ◽

N Gene ◽

Impatiens Necrotic Spot Virus ◽

Natural Occurrence ◽

Necrotic Spot ◽

Rt Pcr ◽

Spot Virus ◽

First Report ◽

Severe Stunting ◽

Gentiana Macrophylla

Large leaf gentian, Gentiana macrophylla Pall., known as Qin Jiao in Chinese, is a medicinal herb. Its root is most commonly used in Chinese traditional medicine to relieve rheumatic conditions and to remove damp-heat. During a survey in July 2009, large leaf gentian plants exhibiting foliar chlorotic and necrotic spots as well as severe stunting were collected in Lijiang County, Yunnan Province of China. Incidence of symptomatic plants ranged from 10 to 30% in the field. Symptomatic leaves from five different G. macrophylla plants were collected and tested for Impatiens necrotic spot virus (INSV), Tomato spotted wilt virus, Watermelon silver mottle virus, Groundnut bud necrosis virus, Tomato chlorotic spot virus, and Groundnut ringspot virus by double-antibody sandwich-ELISA kits (Agdia Inc., Elkhart, IN). All tested samples were positive only for INSV. To further confirm the presence of INSV, reverse transcription (RT)-PCR was conducted. Total RNA was extracted from the symptomatic large leaf gentian plants leaves with a RNeasy Plant Kit (Qiagen Inc., Valencia, CA) and used as a template in RT-PCR using forward (5′-CTT TGC TTT TTA GAA CTG TGC A-3′) and reverse (5′-AGA GCA ATT GTG TCA CGA ATA T-3′) primers specific to the partial INSV nucleoprotein (N) gene (GenBank No. DQ425096). Amplicons of the expected size (approximately 760 bp) were obtained from all ELISA-positive samples. Three clones were sequenced and the partial nucleocapsid protein genes consensus sequences of these isolates were determined (GenBank No. HQ317133). Nucleotide sequences of large leaf gentian isolates shared 98 to 99% nucleotide identity with INSV sequences of isolates from China, Italy, Japan, United States, and the Netherlands (GenBank Nos. FN400772, GQ336989, DQ425096, AB109100, D00914, AB109100, and X66972). INSV is one of the most serious viral pathogens of ornamental plants in North America, Europe, and Asia (1–3). To our knowledge, this is the first report of natural occurrence of INSV in G. macrophylla in China. References: (1) S. T. Koike. Plant Dis. 92:1248, 2008. (2) E. K. Tóth et al. Plant Dis. 91:331, 2007. (3) Q. Zhang et al. Plant Dis. 94:915, 2010.

Download Full-text

First report of cucurbit chlorotic yellows virus (CCYV) infecting pumpkin in India

Plant Disease ◽

10.1094/pdis-07-21-1473-pdn ◽

2021 ◽

Author(s):

Ashwini Kumar ◽

Bichhinna Maitri Rout ◽

Shakshi Choudhary ◽

Amish K. Sureja ◽

V. K. Baranwal ◽

...

Keyword(s):

Amino Acid ◽

Amino Acid Sequence ◽

Amino Acid Sequence Identity ◽

Rt Pcr ◽

Specific Primers ◽

First Report ◽

Virus Particles ◽

Sequence Identity ◽

Cp Gene ◽

Cucurbit Chlorotic Yellows Virus

Pumpkin (Cucurbita moschata), a member of the family Cucurbitaceae, is widely cultivated throughout the world including India. During August 2020 to January 2021, stunted pumpkin plants (cv. Pusa Vishwas), showing chlorotic patches, mosaic, and vein banding on leaves (e-Xtra Fig.1), were observed in the experimental fields of the Indian Agricultural Research Institute (IARI), New Delhi, India. Leaf-dip electron microscopy (EM) of the symptomatic plants (12 out of 37 samples) revealed the association of long flexuous virus particles measuring 650-950nm×10-12nm, suggestive of the presence of either crinivirus or potyvirus or both. Subsequently, a reverse transcription-polymerase chain reaction (RT-PCR) was performed on RNA extracted from the samples that had long flexuous virus particles using generic primers for criniviruses i.e. CriniPol-F: GCY CCS AGR GTK AAT GA and CriniPol-R: ACC TTG RGA YTT RTC AAA targeting partial RNA-dependent RNA polymerase coding region (Martin et al. 2003) and specific primers for papaya ringspot virus (PRSV) targeting a part of 3’ NIb and full coat protein (CP) gene (Basavaraj et al., 2019) separately. All tested samples were positive for both crinivirus and PRSV as expected size amplicons were obtained, accounting for about 32% prevalence. As PRSV is a well-studied virus infecting cucurbits, further work was not carried on this virus and only the RT-PCR amplicon indicative of crinivirus (~515 bp) was cloned into the pGEM-T easy cloning vector (Promega, Madison, WI) and sequenced for further confirmation of the virus presence. The obtained sequence (GenBank accession No MZ318672) shared up to 90% nucleotide and 100% amino acid sequence identity with the corresponding genomic region of a cucurbit chlorotic yellows virus (CCYV) isolate from Greece (LT841297). To confirm the identity of the crinivirus species present in the same pumpkin sample, the CP gene (753bp) was amplified and sequenced using CCYV CP gene-specific primers CP-F (5’-ATG GAG AAG ACY GAC AAT AAA CAA AAT GAT GA-3’) and CP-R (5’-TTA TTT ACT ACA ACC TCC CGG TGC CAA C-3’) (modified from Kheireddine et al. 2020). Sequence analysis using the BioEdit tool (version 2.0) revealed that the crinivirus present in pumpkin (KC577202) shared 95 to 100% nucleotide (and 98 to 100% amino acid) sequence identity with the corresponding gene sequences of CCYV isolates originating from cucurbitaceous hosts from diverse locations. The presence of CCYV was further validated by a whitefly transmission-based bioassay followed by RT-PCR confirmation. The bioassay was performed by the whitefly species Bemisia tabaci (biotype Asia II7) using the acquisition access period and inoculation access period of 24 hours each. Six whitefly individuals per plant were used for inoculating ten pumpkin plants (cv. Pusa Vishwas) at the first true leaf stage grown in pots containing soilrite as the medium in insect-proof cages. All ten plants inoculated using whiteflies exhibited chlorosis and stunting symptoms 12-15 days post-inoculation (e-Xtra Fig.2) and were found positive for CCYV in RT-PCR assay performed using CCYV CP gene-specific primers. Though CCYV had been reported worldwide (Tzanetakis et al. 2013), its occurrence had not been reported from India. Results of the present study confirm the infection of pumpkin plants by CCYV and constitute the first report of its presence in India. Further, there is a need to investigate the extent of its spread and impact of this virus on the production of cucurbitaceous crops in the country.

Download Full-text

First Report of Tomato chlorosis virus Infecting Tomato in Single and Mixed Infections with Tomato yellow leaf curl virus in Cuba

Plant Disease ◽

10.1094/pdis-92-5-0836c ◽

2008 ◽

Vol 92 (5) ◽

pp. 836-836 ◽

Cited By ~ 9

Author(s):

Y. Martínez-Zubiaur ◽

E. Fiallo-Olivé ◽

J. Carrillo-Tripp ◽

R. Rivera-Bustamante

Keyword(s):

Tomato Yellow Leaf ◽

Pcr Analysis ◽

Mixed Infections ◽

Yellow Leaf ◽

Rt Pcr ◽

Specific Primers ◽

First Report ◽

Tomato Chlorosis Virus ◽

Leaf Curl Virus ◽

Leaf Curl

Whitefly-transmitted viruses have caused severe losses in tomato crops (Solanum lycopersicum) in Cuba. In 2006 and 2007, tomato greenhouses across eastern Cuba exhibited high levels of Bemisia tabaci (B biotype) infestation. Some plants showed interveinal chlorosis and a severe yellow mosaic, combined with leaf brittleness. These symptoms were different from those induced by Tomato yellow leaf curl virus (TYLCV-IL(CU)). Only 12 of 31 symptomatic samples resulted in positive PCR assays with TYLCV-specific primers (CTGAATGTTTGGATGGAAATGTGC and GCTCGTAAGTTTCCTCAACGGAC). A reverse transcription (RT)-PCR analysis for Tomato chlorosis virus (ToCV) with generic (HS-11/HS-12) and specific primers (ToC-5/ToC-6) was also carried out (2). Sequence analysis of the cloned RT-PCR products (463 bp) confirmed the presence of ToCV in Cuba. The fragment had 97 to 98% identity with GenBank isolates from Spain (DQ136146), Florida (AY903448), and Reunion Island, France (AJ968396). Cloned TYLCV and ToCV amplicons were used as probes to reanalyze the selected 31 samples by a dot-blot hybridization assay in search of mixed infections (1). The assay showed 16 samples to be positive for ToCV, 4 for TYLCV, 8 for both, and 3 samples were negative. To our knowledge, this is the first report of ToCV and TYLCV/ToCV mixed infections in Cuba. References: (1) Y. Abou-Jawdha et al. Plant Dis. 90:378, 2006. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002.

Download Full-text

First Report of Tomato chlorosis virus in Lebanon

Plant Disease ◽

10.1094/pd-90-0378c ◽

2006 ◽

Vol 90 (3) ◽

pp. 378-378 ◽

Cited By ~ 15

Author(s):

Y. Abou-Jawdah ◽

C. El Mohtar ◽

H. Atamian ◽

H. Sobh

Keyword(s):

The United States ◽

Limiting Factor ◽

Rt Pcr ◽

Tomato Seedling ◽

Tomato Production ◽

First Report ◽

Tomato Seedlings ◽

Plant Pathol ◽

Tomato Chlorosis Virus ◽

Leaf Curl

Tomato seedlings showing leaf curl and yellowing symptoms characteristic of Tomato yellow leaf curl virus (TYLCV) were brought to the university laboratory from a commercial tomato greenhouse located in the Damour coastal area, south of Beirut, Lebanon. They were first tested using polymerase chain reaction (PCR) to ascertain their infection by TYLCV and then they were used in a trial to evaluate resistance of three local accessions of tomato to TYLCV, the major limiting factor to tomato production in Lebanon. Whiteflies (Bemisia tabaci), reared on broccoli for several generations, were allowed an acquisition access period of 48 h on tomato seedlings putatively infected with TYLCV and then were transferred to test plants at an average of 40 to 60 whiteflies per tomato seedling at the first-true leaf stage for an inoculation feeding period of 3 days. All treatments were conducted in insect-proof cages. Clear TYLCV symptoms were observed on the three local tomato accessions approximately 3 weeks after inoculation. However, 7 to 8 weeks after inoculation, many plants showed yellowing symptoms on the lower leaves that were not observed in previous experiments. Infections by Tomato chlorosis virus (ToCV) and/or Tomato infectious chlorosis virus (TICV), two criniviruses belonging to the family Closteroviridae, were suspected. Diagnostic tests using PCR for TYLCV detection (1) and reverse transcription (RT)-PCR for detection of ToCV (2) or TICV (3) showed that some tomato plants had a mixed infection with TYLCV and ToCV. None of the tested samples was positive for TICV. The RT-PCR amplicons (434 nt) obtained with the ToCV specific primers were cloned into pGEM-T easy vector. Sequence analysis of one clone revealed more than 99% nucleotide identity with the heat shock protein homologue (HSP70h) of ToCV isolates from the United States (GenBank Accession Nos. AY903448, AF024630, and AY444872) and 100% amino acid identity to ToCV isolates from Italy and Portugal (GenBank Accession Nos. AY048854.1 and AF234029.1). The sequence was submitted to GenBank (Accession No. DQ234079). Twenty-two tomato samples were then collected from plants showing yellowing symptoms on their lower leaves. The samples were taken from two greenhouses at the same farm in the Damour area. Six samples tested positive for ToCV using RT-PCR. To our knowledge, this is the first report of ToCV in Lebanon, but its incidence and distribution was not monitored. However, on the basis of symptoms and preliminary RT-PCR results, the disease does not appear to be widely spread in the country. References: (1) G. H. Anfoka et al. J. Plant Pathol. 87:65, 2005. (2) D. Louro et al. Eur. J. Plant Pathol. 106:589, 2000. (3) A. M. Vaira et al. Phytoparasitica 30:290, 2002.

Download Full-text

First Report of Tomato chlorosis virus in Israel

Plant Disease ◽

10.1094/pdis.2004.88.10.1160a ◽

2004 ◽

Vol 88 (10) ◽

pp. 1160-1160 ◽

Cited By ~ 27

Author(s):

L. Segev ◽

W. M. Wintermantel ◽

J. E. Polston ◽

M. Lapidot

Keyword(s):

Middle Aged ◽

Tomato Plants ◽

First Report ◽

Interveinal Chlorosis ◽

Mature Leaves ◽

Cp Gene ◽

Reverse Primer ◽

Efficient Vector ◽

Tomato Chlorosis Virus ◽

Tomato Infectious Chlorosis Virus

During December 2003, symptoms were observed in greenhouse tomato plants in Bet Dagan, Israel that resembled those of Tomato chlorosis virus (ToCV), a crinivirus common in the southeastern United States and southern Europe (2,3). Middle-aged leaves showed interveinal chlorosis, while more mature leaves showed more intense interveinal chlorosis with some interveinal bronzing. Symptoms were associated with the presence of Bemisia tabaci, an efficient vector of ToCV. Total nucleic acids were extracted (1) from middle-aged and mature leaves from two symptomatic plants, as well as from healthy tomato, Physalis wrightii infected with ToCV, and Nicotiana benthamiana infected with Tomato infectious chlorosis virus (TICV), another crinivirus that produces identical symptoms on tomato. Extracts were tested using hybridization with probes specific to the coat protein (CP) gene of ToCV and the HSP70h gene of TICV. Hybridization results identified the presence of ToCV in all samples from symptomatic tomato plants and ToCV-infected P. wrightii, but not in those from healthy tomato or TICV-infected N. benthamiana. TICV was only detected in TICV-infected N. benthamiana. Extracts were also subjected to reverse transcription-polymerase chain reaction using primers specific to the CP gene of ToCV (GenBank Accession No. AY444872; Forward primer: 5′ ATGGAGAACAGT GCCGTTGC 3′; Reverse Primer: 5′ TTAGCAACCAGTTATCGATGC 3′). All samples from symptomatic tomato and ToCV-infected P. wrightii produced amplicons of the expected size, but no amplicons were produced from extracts of healthy tomato. Laboratory results and observed symptoms confirm the presence of ToCV in symptomatic tomatoes. To our knowledge, this is the first report of ToCV in Israel. References: (1) S. Dellaporta et al. Plant Mol. Biol. Rep. 1:19, 1983. (2) J. Navas-Castillo et al. Plant Dis. 84:835, 2000. (3) G. C. Wisler et al. Phytopathology 88:402, 1998.

Download Full-text

First Report of Garlic virus X in Garlic Plants in Brazil

Plant Disease ◽

10.1094/pdis-08-13-0845-pdn ◽

2014 ◽

Vol 98 (7) ◽

pp. 1013-1013 ◽

Cited By ~ 4

Author(s):

M. L. Oliveira ◽

M. I. M. Hoffmann ◽

T. Mituti ◽

M. A. Pavan ◽

R. Krause-Sakate

Keyword(s):

Nucleotide Sequence ◽

Minas Gerais ◽

Sao Paulo ◽

São Paulo ◽

Rt Pcr ◽

Specific Primers ◽

Capsid Protein Gene ◽

First Report ◽

Cp Gene ◽

Garlic Virus

Garlic is the fifth most economically important vegetable in Brazil and is frequently infected by a complex of different viruses that cause significant degeneration of the crop under field conditions. The species of the genus Allexivirus that infect garlic are: Garlic virus A (GarV-A), Garlic virus B (GarV-B), Garlic virus C (GarV-C), Garlic virus D (GarV-D), Garlic virus E (GarV-E), Garlic virus X (GarV-X), Garlic mite-borne filamentous viru s (GarMbFV), and Shallot virus X (ShVX). So far, only GarV-A, GarV-B, GarV-C, GarV-D, and GarMbFV have been reported in Brazil (3). During the 2010 through 2013 seasons, between April and October, 302 garlic plants with yellow mosaic strips and distorted leaves from the cultivars Caçador, Quitéria, Tropical Bergamota, and Tropical Shangai were collected in the states of Paraná, Minas Gerais, São Paulo, and Goiás and analyzed for the presence of allexiviruses. Total plant RNA was extracted with the Total RNA Purification kit (Norgen Biotek Corp., Canada) according to manufacturer's instructions. RT-PCR reactions were performed initially with the primer pair named Cpallexi-senso2 (5′ CTACCACAAYGGNTCVTC 3′) and Cpallexi-anti1 (5′ CACNGCGTTRAAGAARTC 3′) specifically designed to amplify a ~230-bp fragment from all currently known allexiviruses. Positive samples were then analyzed with specific primers for GarV-A, GarV-C, and GarV-D (2), GarMbFV (1) and GarV-B named CPBS2 (5′ GCAGAATAARCCCCCYTC 3′) and CPBA1 (5′ RAAGGGTTTATTCTGTTG 3′) obtained in this work. Among the plants analyzed, 50 were positive for the Cpallexi-senso2/Cpallexi-anti1 primers but negative for all the specific primers tested, indicating the presence of a different allexivirus. These samples were then analyzed by RT-PCR for the presence of GarV-X, GarV-E, and ShVX and an amplicon of ~550 bp was obtained only with primers CPXS2 (5′ GCCTTCTGAAAATGACTTAG 3′) and CPXA1 (5′ CTAGGATTTGCTGTTGGG 3′) designed in this work to amplify a fragment of the capsid protein gene for GarV-X. Since species demarcation in the genus Allexivirus is based on the coat protein (CP) gene (2), another set of primers, namely PIXS1 (GACGACGGYGCACTACTC) / PIXA1 (YGTGAATCGTGATGATCC) and PFXS2 (CRCTGAGACAATTYYGTGG) / PFXA2 (CAAAGCATCGGCCRTAGCG) derived from conserved regions of ORF4, ORF5 (CP), and ORF 6 sequences of allexiviruses available in the NCBI database, were used in RT-PCR to obtain the complete CP gene nucleotide sequence. A 1,071-nt sequence comprising 108 bp of ORF4 (partial), 732 bp of the CP, and 177 bp of ORF 6 was successfully amplified (GenBank Accession No. KF530328). The complete CP gene showed 98% nucleotide sequence identity with GarV-X from Australia (JQ807994.1). In summary, GarV-X was detected in the 50 samples collected from Minas Gerais, São Paulo, and Paraná, indicating widespread distribution in Brazil. To our knowledge, this is the first report of GarV-X in garlic in Brazil. References: (1) M. S. Fayad-Andre et al. Trop. Plant Pathol. 36:341, 2011. (2) P. A. Melo Filho et al. Pesq. Agropec. Bras. 39:735, 2004. (3) R. J. Nascimento et al. Summa Phytopathol. 34:267, 2008.

Download Full-text