First report of Phytophthora nicotianae causing stem canker of Catalpa bungei (Chinese catalpa) in China

Chinese catalpa, Catalpa bungei C.A. Mey is native to China and has been widely cultivated as an important tree species for timber and ornamental purposes (Tao et al. 2019). The properties and high durability of the wood can resist the damage caused by microorganisms and insects (Xiao Y et al. 2019). In September 2020, stem cankers were observed in 5-year-old and 3-year-old C. bungei in a pilot experiment field covering 16-hectare area in Shuyang city (Jiangsu province, China) and in a nursery in Binhai city (Jiangsu Province, China), respectively. The disease incidence in both locations was about 1% to 3%. The typical disease symptoms include small to large, dark-brown and irregular-sunken canker around and along the stem under 2 meters from the stem base. The phloem and xylem of the symptomatic stem were dark brown and the xylem had larger necrosis than the phloem. The cross section of the diseased stem was partially died. The symptomatic stem were collected in both locations for pathogen isolation. In total, seven purified isolates from the diseased samples were obtained using potato dextrose agar (PDA) following standard isolation protocol (Huang et al. 2019). In order to determine the pathogenicity, 3-year-old Chinese catalpa seedlings were artificially inoculated with each of the seven isolates in April 2021. After removing the bark of the stem by a sterilized punch (diameter 6mm), an agar plug (diameter 6mm) pre-colonized by the isolate was inoculated to the stem and the inoculation point was sealed with parafilm. The agar plug without pre-colonization was used as control. Six tree seedlings were inoculated for each isolate. Ten days after inoculation, only the treatment with isolate QS.1 showed obvious discoloration around the inoculation point. One month after inoculation, the canker around the inoculation point was formed (3.4 cm ± 1.0 cm) and spread to the xylem, similar to the symptoms observed in the field. Isolate QS.1 was re-isolated successfully from the inoculated stem based on morphological characters, confirming the Koch's postulates and QS.1 as the causal pathogen. The isolate QS.1 formed white colonies with abundant aerial mycelia on V8 juice agar and produced a large amount of persistent and papillary ovoid sporangia with size of 22 ~ 45μm (average 31μm) × 18 ~ 39μm (average 23μm) in 10% aqueous solution of V8. The spore was spherical with thick-wall and diameter of 24 ± 3.9μm. The morphology of QS.1 is similar to that of Phytophthora nicotianae. The genomic DNA of representative isolate QS.1 was extracted from mycelium by a modified CTAB method (Murray et al. 1980). The rDNA internal transcribed spacer (ITS) region, β-tubulin and EF1-α genes were amplified and sequenced with primers ITS1/ITS4 (White et al. 1990), BTub_F1/TUBUR1 (L. et al. 2004) and EF1A_for/EF1A_rev (Blair et al. 2008), respectively. The BLAST results of these sequences (Accession No. MZ646302, MZ672116, and MZ675589, respectively) showed 99%, 100% and 100% identity with sequences of P. nicotianae (Accession No. KJ494902, KY205750, and MH359041), respectively. Based on the morphological characteristics and DNA analysis, isolate QS.1 was identified as P. nicotianae. To our best knowledge, this is the first report of P. nicotianae causing stem canker on Chinese Catalpa. This disease may pose potential threat on Catalpa due to the increase in Catalpa planting for economic and ecological purposes in China.

Download Full-text

First Report of Stem Canker Caused by Alternaria alternata on Cotton

Plant Disease ◽

10.1094/pdis.2000.84.1.103a ◽

2000 ◽

Vol 84 (1) ◽

pp. 103-103 ◽

Cited By ~ 8

Author(s):

I. A. Laidou ◽

E. K. Koulakiotu ◽

C. C. Thanassoulopoulos

Keyword(s):

Alternaria Alternata ◽

Disease Incidence ◽

Three Dimensional ◽

Morphological Characteristics ◽

Stem Canker ◽

Northern Greece ◽

First Report ◽

Stem Blight ◽

Leaf Spots ◽

Boll Rot

A stem blight of cotton (Gossypium hirsutum L.) was observed on plants of cv. 132 in the district of Ammoudia near Serres in northern Greece. Symptoms of the disease include cankers on the stem, leaf spots, and boll rots. Affected plants show early defoliation and maturing, as well as total or partial necrosis. Symptoms on stems include dark brown, circular spots that enlarge rapidly. The center of the lesions sink to form a canker. Gradually the spots become elliptical, and the tissues split the stem longitudinally, resulting in the total or partial death of the plant. The fungus isolated from infected stem tissues was identified as typical Alternaria alternata (Nees:Fr.) Keissler, based on morphological characteristics of conidia, which are produced in a loose three-dimensional tuft of branching chains (2). Pathogenicity tests were conducted by inoculating 50 cotton stems with 5-mm disks from 9-day-old cultures on potato dextrose agar at 25°C. Each stem was inoculated with three disks, and plants were placed at room temperature for 10 days for disease development. Inoculated plants exhibited more than 95% disease incidence, and frequency of reisolation was more than 70%. A. alternata is commonly known as a leaf spot, boll rot, and seedling blight pathogen of cotton. The only reported stem blight pathogen of cotton is A. macrospora (1). This is the first report of typical A. alternata as the cause of stem blight on cotton. References: (1) L. Ling and F. Y. Yang. Phytopathology 31:664, 1941. (2) E. G. Simmons. Mycotaxon 48:109, 1993.

Download Full-text

First Report of Forsythia Shoot Blight Caused by Phytophthora nicotianae in Connecticut

Plant Disease ◽

10.1094/pdis-03-14-0297-pdn ◽

2014 ◽

Vol 98 (9) ◽

pp. 1278-1278

Author(s):

J. A. LaMondia ◽

D. W. Li ◽

A. M. Madeiras ◽

R. L. Wick

Keyword(s):

Disease Incidence ◽

Morphological Characteristics ◽

Aerial Mycelium ◽

Phytophthora Nicotianae ◽

First Report ◽

Sterile Needle ◽

Shoot Blight ◽

Pathogenicity Tests ◽

Half Strength ◽

Internal Necrosis

Blighting of Forsythia × intermedia ‘Showoff’ was first observed affecting several hundred plants in a commercial nursery in Connecticut in September 2012. Symptoms included wilting, leaf and stem blight, and dieback progressing to plant death. A Phytophthora sp. was isolated from symptomatic tissues on half-strength potato dextrose agar (½PDA). Colonies were white and cottony on ½PDA, reaching 9 mm in 15 days at 25°C, but colorless and inconspicuous on pimaricin, ampicillin, rifampicin, pentachloronitrobenzene agar (PARP) with sparse and limited aerial mycelium, reaching 60 mm in 15 days at 25°C. The characteristics of the pathogen were observed and measured from a 3-month-old colony on ½PDA. Sporangia were abundant, various in shape, ovoid, ellipsoid to pyriform or limoniform, occasionally gourd shaped or irregular; (17.9) 27.2 to 41.4 (47.3) × (12.6) 19.1 to 30.5 (36.7) μm (n = 30), length/breadth ratio 1.4 ± 0.2, papillate and noncaducous. Papillae measured 2.9 ± 0.8 × 3.4 ± 0.8 μm (n = 10). Chlamydospores were present, 23.4 ± 3.1 × 22 ± 3.3 μm (n = 10). Oogonia and oospores were not observed. Arachnoid mycelia were present. These morphological characteristics are consistent with Phytophthora nicotianae Breda de Haan (1). The identity of the pathogen was confirmed as P. nicotianae by BLAST analysis of ITS, Cox II, and beta tubulin gene sequences (99% match for the three sequences, E value = 0). Pathogenicity tests were conducted four times on healthy liners of Forsythia × intermedia ‘Showoff’ grown in 10-cm-diameter pots. Leaves and stems were wounded by pricking with a sterile needle and six plants were inoculated with 0.25 cm2 plugs of the pathogen growing on ½PDA placed on three leaves and in three stem nodes and covered with Parafilm. Controls consisted of an equal number of plants wounded and inoculated with ½PDA alone. All plants were placed inside high humidity chambers for 24 h and then transferred to a greenhouse for up to 1 month. Typical symptoms developed within 1 week of inoculation and the pathogen was re-isolated from diseased tissue. Disease incidence was nearly 100% of inoculated leaves and stems and not observed in control plants without the pathogen. Three replicate 6-week-old broadleaf tobacco ‘C9’ plants were each inoculated with tobacco or forsythia isolates of P. nicotianae or sterile media alone, by wounding stems and placing colonized 0.25 cm2 ½PDA plugs into wounds and covering with Parafilm. After 1 week, stems were split and the length of internal necrosis in the stem measured. Disease resulted from inoculation with both the tobacco and forsythia isolates and stem necrosis averaged 43 and 23 mm for tobacco or forsythia isolates, respectively. No necrosis was observed in the pathogen-free controls. P. nicotianae has been reported from the basal stem and roots of F. viridissima in Italy (2) and from shoots of Forsythia × intermedia in Virginia (3). To our knowledge, this is the first report of P. nicotianae causing shoot blight on Forsythia in the northeastern United States. References: (1) J. van. Breda de Haan. Mededeelingenuit's Lands Plantentuin Batavia. 15:57, 1896. (2) S. O. Cacciola et al. Plant Dis. 78:525, 1994. (3) C. X. Hong et al. Plant Dis. 89:430, 2005.

Download Full-text

First Report of Flyspeck Caused by Zygophiala wisconsinensis on Sweet Persimmon Fruit in Korea

Plant Disease ◽

10.1094/pdis-12-10-0917 ◽

2011 ◽

Vol 95 (5) ◽

pp. 616-616 ◽

Cited By ~ 1

Author(s):

J. Kim ◽

O. Choi ◽

J.-H. Kwon

Keyword(s):

Disease Incidence ◽

Morphological Characteristics ◽

Its Rdna ◽

Control Treatment ◽

Diospyros Kaki ◽

Distilled Water ◽

First Report ◽

Persimmon Fruit ◽

Fungal Isolates ◽

Agar Disc

Sweet persimmon (Diospyros kaki L.), a fruit tree in the Ebenaceae, is cultivated widely in Korea and Japan, the leading producers worldwide (2). Sweet persimmon fruit with flyspeck symptoms were collected from orchards in the Jinju area of Korea in November 2010. The fruit had fungal clusters of black, round to ovoid, sclerotium-like fungal bodies with no visible evidence of a mycelial mat. Orchard inspections revealed that disease incidence ranged from 10 to 20% in the surveyed area (approximately 10 ha) in 2010. Flyspeck symptoms were observed on immature and mature fruit. Sweet persimmon fruit peels with flyspeck symptoms were removed, dried, and individual speck lesions transferred to potato dextrose agar (PDA) and cultured at 22°C in the dark. Fungal isolates were obtained from flyspeck colonies on 10 sweet persimmon fruit harvested from each of three orchards. Fungal isolates that grew from the lesions were identified based on a previous description (1). To confirm identity of the causal fungus, the complete internal transcribed spacer (ITS) rDNA sequence of a representative isolate was amplified and sequenced using primers ITS1 and ITS4 (4). The resulting 552-bp sequence was deposited in GenBank (Accession No. HQ698923). Comparison with ITS rDNA sequences showed 100% similarity with a sequence of Zygophiala wisconsinensis Batzer & Crous (GenBank Accession No. AY598855), which infects apple. To fulfill Koch's postulates, mature, intact sweet persimmon fruit were surface sterilized with 70% ethanol and dried. Three fungal isolates from this study were grown on PDA for 1 month. A colonized agar disc (5 mm in diameter) of each isolate was cut from the advancing margin of a colony with a sterilized cork borer, transferred to a 1.5-ml Eppendorf tube, and ground into a suspension of mycelial fragments and conidia in a blender with 1 ml of sterile, distilled water. The inoculum of each isolate was applied by swabbing a sweet persimmon fruit with the suspension. Three sweet persimmon fruit were inoculated per isolate. Three fruit were inoculated similarly with sterile, distilled water as the control treatment. After 1 month of incubation in a moist chamber at 22°C, the same fungal fruiting symptoms were reproduced as observed in the orchards, and the fungus was reisolated from these symptoms, but not from the control fruit, which were asymptomatic. On the basis of morphological characteristics of the fungal colonies, ITS sequence, and pathogenicity to persimmon fruit, the fungus was identified as Z. wisconsinensis (1). Flyspeck is readily isolated from sweet persimmon fruit in Korea and other sweet persimmon growing regions (3). The exposure of fruit to unusual weather conditions in Korea in recent years, including drought, and low-temperature and low-light situations in late spring, which are favorable for flyspeck, might be associated with an increase in occurrence of flyspeck on sweet persimmon fruit in Korea. To our knowledge, this is the first report of Z. wisconsinensis causing flyspeck on sweet persimmon in Korea. References: (1) J. C. Batzer et al. Mycologia 100:246, 2008. (2) FAOSTAT Database. Retrieved from http://faostat.fao.org/ , 2008. (3) H. Nasu and H. Kunoh. Plant Dis. 71:361, 1987. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, Inc., New York, 1990.

Download Full-text

First Report of Damping-Off Caused by Rhizoctonia solani AG-4 on Mediterranean Fan Palm in Italy

Plant Disease ◽

10.1094/pdis-94-1-0125a ◽

2010 ◽

Vol 94 (1) ◽

pp. 125-125 ◽

Cited By ~ 3

Author(s):

G. Polizzi ◽

D. Aiello ◽

I. Castello ◽

V. Guarnaccia ◽

A. Vitale

Keyword(s):

Rhizoctonia Solani ◽

Disease Incidence ◽

Morphological Characteristics ◽

Mediterranean Area ◽

Western Mediterranean ◽

Fluorescent Light ◽

Damping Off ◽

Centraalbureau Voor ◽

First Report ◽

Stem Lesions

Mediterranean fan palm (Chamaerops humilis L.), one of just two autochthonous European palms, is native to the western Mediterranean Region in southwestern Europe and northwestern Africa. It can be found growing wild in the Mediterranean area. In Europe, this species is very popular as an ornamental plant. In March 2009, a widespread damping-off was observed in a stock of approximately 30,000 potted 1-month-old plants of C. humilis cv. Vulcano in a nursery in eastern Sicily. Disease incidence was approximately 20%. Disease symptoms consisted of lesions at the seedling shoot (plumule). Stem lesions were initially orange, turned brown, and followed by death of the entire plumule or eophyll. A fungus with mycelial and morphological characteristics of Rhizoctonia solani Kühn was consistently isolated from lesions when plated on potato dextrose agar (PDA) amended with streptomycin sulfate at 100 μg/ml. Fungal colonies were initially white, turned brown with age, and produced irregularly shaped, brown sclerotia. Mycelium was branched at right angles with a septum near the branch and a slight constriction at the branch base. Hyphal cells removed from cultures grown at 25°C on 2% water agar were determined to be multinucleate when stained with 1% safranin O and 3% KOH solution (1) and examined at ×400. Anastomosis groups were determined by pairing isolates with tester strains AG-1 IA, AG-2-2-1, AG-2-2IIIB, AG-2-2IV, AG-3, AG-4, AG-5, AG-6, and AG-11 on 2% water agar in petri plates (3). Anastomosis was observed only with tester isolates of AG-4, giving both C2 and C3 reactions (2). One representative isolate obtained from symptomatic tissues was deposited at the Fungal Biodiversity Centre, Centraalbureau voor Schimmelcultures (CBS No. 125095). Pathogenicity tests were performed on container-grown, healthy, 1-month-old seedlings. Twenty plants of C. humilis cv. Vulcano were inoculated near the base of the stem with two 1-cm2 PDA plugs from 5-day-old mycelial cultures. The same number of plants served as uninoculated controls. Plants were incubated in a growth chamber and maintained at 25°C and 95% relative humidity on a 12-h fluorescent light/dark regimen. Symptoms identical to those observed in the nursery appeared 5 days after inoculation and all plants died within 20 days. No disease was observed on control plants. A fungus identical in culture morphology to R. solani AG-4 was consistently reisolated from symptomatic tissues, confirming its pathogenicity. To our knowledge, this is the first report in the world of R. solani causing damping-off on Mediterranean fan palm. References: (1) R. J. Bandoni. Mycologia 71:873, 1979. (2) D. E. Carling. Page 37 in: Grouping in Rhizoctonia solani by Hyphal Anastomosis Reactions. Kluwer Academic Publishers, the Netherlands, 1996. (3) C. C. Tu and J. W. Kimbrough. Mycologia 65:941, 1973.

Download Full-text

First Report of Alternaria carotiincultae on Carrot Seed Produced in New Zealand

Plant Disease ◽

10.1094/pdis-94-9-1168c ◽

2010 ◽

Vol 94 (9) ◽

pp. 1168-1168

Author(s):

R. S. Trivedi ◽

J. G. Hampton ◽

J. M. Townshend ◽

M. V. Jaspers ◽

H. J. Ridgway

Keyword(s):

New Zealand ◽

Morphological Characteristics ◽

New Taxon ◽

First Report ◽

Agar Plug ◽

Carrot Seed ◽

Agar Media ◽

Leaves And Roots ◽

Seed Crops ◽

Β Tubulin

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 μm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the β-tubulin gene from three isolates, using primers Bt1a (5′ TTCCCCCGTCTCCACTTCTTCATG 3′) and Bt1b (5′ GACGAGATCGTTCATGTTGAACTC 3′) (1), produced a 420-bp product for each isolate that was sequenced and compared with β-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.

Download Full-text

First report of banana (Musa acuminate L. AAA Cavendish, cv. Formosana) leaf spot disease caused by Curvularia geniculata in China

Plant Disease ◽

10.1094/pdis-09-21-2001-pdn ◽

2021 ◽

Author(s):

Yanxiang Qi ◽

Yanping Fu ◽

Jun Peng ◽

Fanyun Zeng ◽

Yanwei Wang ◽

...

Keyword(s):

Leaf Spot ◽

Disease Incidence ◽

Morphological Characteristics ◽

Universal Primers ◽

Leaf Spot Disease ◽

Leaf Margin ◽

Conidial Suspension ◽

Tropical Fruit ◽

First Report ◽

Spot Disease

Banana (Musa acuminate L.) is an important tropical fruit in China. During 2019-2020, a new leaf spot disease was observed on banana (M. acuminate L. AAA Cavendish, cv. Formosana) at two orchards of Chengmai county (19°48ʹ41.79″ N, 109°58ʹ44.95″ E), Hainan province, China. In total, the disease incidence was about 5% of banana trees (6 000 trees). The leaf spots occurred sporadically and were mostly confined to the leaf margin, and the percentage of the leaf area covered by lesions was less than 1%. Symptoms on the leaves were initially reddish brown spots that gradually expanded to ovoid-shaped lesions and eventually become necrotic, dry, and gray with a yellow halo. The conidia obtained from leaf lesions were brown, erect or curved, fusiform or elliptical, 3 to 4 septa with dimensions of 13.75 to 31.39 µm × 5.91 to 13.35 µm (avg. 22.39 × 8.83 µm). The cells of both ends were small and hyaline while the middle cells were larger and darker (Zhang et al. 2010). Morphological characteristics of the conidia matched the description of Curvularia geniculata (Tracy & Earle) Boedijn. To acquire the pathogen, tissue pieces (15 mm2) of symptomatic leaves were surface disinfected in 70% ethanol (10 s) and 0.8% NaClO (2 min), rinsed in sterile water three times, and transferred to potato dextrose agar (PDA) for three days at 28°C. Grayish green fungal colonies appeared, and then turned fluffy with grey and white aerial mycelium with age. Two representative isolates (CATAS-CG01 and CATAS-CG92) of single-spore cultures were selected for molecular identification. Genomic DNA was extracted from the two isolates, the internal transcribed spacer (ITS), large subunit ribosomal DNA (LSU rDNA), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), translation elongation factor 1-alpha (TEF1-α) and RNA polymerase II second largest subunit (RPB2) were amplified and sequenced with universal primers ITS1/ITS4, LROR/LR5, GPD1/GPD2, EF1-983F/EF1-2218R and 5F2/7cR, respectively (Huang et al. 2017; Raza et al. 2019). The sequences were deposited in GenBank (MW186196, MW186197, OK091651, OK721009 and OK491081 for CATAS-CG01; MZ734453, MZ734465, OK091652, OK721100 and OK642748 for CATAS-CG92, respectively). For phylogenetic analysis, MEGA7.0 (Kumar et al. 2016) was used to construct a Maximum Likelihood (ML) tree with 1 000 bootstrap replicates, based on a concatenation alignment of five gene sequences of the two isolates in this study as well as sequences of other Curvularia species obtained from GenBank. The cluster analysis revealed that isolates CATAS-CG01 and CATAS-CG92 were C. geniculata. Pathogenicity assays were conducted on 7-leaf-old banana seedlings. Two leaves from potted plants were stab inoculated by puncturing into 1-mm using a sterilized needle and placing 10 μl conidial suspension (2×106 conidia/ml) on the surface of wounded leaves and equal number of leaves were inoculated with sterile distilled water serving as control (three replicates). Inoculated plants were grown in the greenhouse (12 h/12 h light/dark, 28°C, 90% relative humidity). Necrotic lesions on inoculated leaves appeared seven days after inoculation, whereas control leaves remained healthy. The fungus was recovered from inoculated leaves, and its taxonomy was confirmed morphologically and molecularly, fulfilling Koch’s postulates. C. geniculata has been reported to cause leaf spot on banana in Jamaica (Meredith, 1963). To our knowledge, this is the first report of C. geniculata on banana in China.

Download Full-text

First Report of Phytophthora drechsleri Associated with Stem and Foliar Blight of Gynura bicolor in Taiwan

Plant Disease ◽

10.1094/pdis-12-10-0931 ◽

2011 ◽

Vol 95 (7) ◽

pp. 874-874 ◽

Cited By ~ 1

Author(s):

Y. M. Shen ◽

C. H. Chao ◽

H. L. Liu

Keyword(s):

Disease Incidence ◽

Morphological Characteristics ◽

Hyphal Growth ◽

Pathogenicity Test ◽

Distilled Water ◽

First Report ◽

Foliar Blight ◽

Dual Cultures ◽

Phytophthora Drechsleri ◽

Gynura Bicolor

Gynura bicolor (Roxb. ex Willd.) DC., known as Okinawa spinach or hong-feng-cai, is a commonly consumed vegetable in Asian countries. In May 2010, plants with blight and wilt symptoms were observed in commercial vegetable farms in Changhua, Taiwan. Light brown-to-black blight lesions developed from the top of the stems to the petioles and extended to the base of the leaves. Severely infected plants declined and eventually died. Disease incidence was approximately 20%. Samples of symptomatic tissues were surface sterilized in 0.6% NaOCl and plated on water agar. A Phytophthora sp. was consistently isolated and further plated on 10% unclarified V8 juice agar, with daily radial growths of 7.6, 8.6, 5.7, and 2.4 mm at 25, 30, 35, and 37°C, respectively. Four replicates were measured for each temperature. No hyphal growth was observed at 39°C. Intercalary hyphal swellings and proliferating sporangia were produced in culture plates flooded with sterile distilled water. Sporangia were nonpapillate, obpyriform to ellipsoid, base tapered or rounded, and 43.3 (27.5 to 59.3) × 27.6 (18.5 to 36.3) μm. Clamydospores and oospores were not observed. Oospores were present in dual cultures with an isolate of P. nicotianae (p731) (1) A2 mating type, indicating that the isolate was heterothallic. A portion of the internal transcribed spacer sequence was deposited in GenBank (Accession No. HQ717146). The sequence was 99% identical to that of P. drechsleri SCRP232 (ATCC46724) (3), a type isolate of the species. The pathogen was identified as P. drechsleri Tucker based on temperature growth, morphological characteristics, and ITS sequence homology (3). To evaluate pathogenicity, the isolated P. drechsleri was inoculated on greenhouse-potted G. bicolor plants. Inoculum was obtained by grinding two dishes of the pathogen cultured on potato dextrose agar (PDA) with sterile distilled water in a blender. After filtering through a gauze layer, the filtrate was aliquoted to 240 ml. The inoculum (approximately 180 sporangia/ml) was sprayed on 24 plants of G. bicolor. An equal number of plants treated with sterile PDA processed in the same way served as controls. After 1 week, incubation at an average temperature of 29°C, blight and wilt symptoms similar to those observed in the fields appeared on 12 inoculated plants. The pathogen was reisolated from the lesions of diseased stems and leaves, fulfilling Koch's postulates. The controls remained symptomless. The pathogenicity test was repeated once with similar results. G. bicolor in Taiwan has been recorded to be infected by P. cryptogea (1,2), a species that resembles P. drechsleri. The recorded isolates of P. cryptogea did not have a maximal growth temperature at or above 35°C (1,2), a distinctive characteristic to discriminate between the two species (3). To our knowledge, this is the first report of P. drechsleri being associated with stem and foliar blight of G. bicolor. References: (1) P. J. Ann. Plant Pathol. Bull. 5:146, 1996. (2) H. H. Ho et al. The Genus Phytophthora in Taiwan. Institute of Botany, Academia Sinica, Taipei, 1995. (3) R. Mostowfizadeh-Ghalamfarsa et al. Fungal Biol. 114:325, 2010.

Download Full-text

First report of Leptosphaeria biglobosa ‘canadensis’ causing blackleg on oilseed rape (Brassica napus) in China

Plant Disease ◽

10.1094/pdis-12-20-2735-pdn ◽

2021 ◽

Author(s):

Tao Luo ◽

Guoqing Li ◽

Long Yang

Keyword(s):

Brassica Napus ◽

Oilseed Rape ◽

Southern China ◽

Disease Incidence ◽

Morphological Characteristics ◽

Gansu Province ◽

Bootstrap Support ◽

First Report ◽

Fungal Isolates ◽

Leptosphaeria Biglobosa

Oilseed rape (Brassica napus L.) is one of the most important oilseed crops in China. It is widely cultivated in China, with winter oilseed rape in Yangtze River basin and in southern China, and spring oilseed rape in northern China. In August 2017, a survey for Leptosphaeria spp. on spring oilseed rape was conducted in Minle county, Zhangye city, Gansu Province, China. The symptoms typical of blackleg on basal stems of oilseed rape were observed in the field. A large number of black fruiting bodies (pycnidia) were present on the lesions (Fig. 1A). The disease incidence of basal stem infection in the surveyed field was 19%. A total of 19 diseased stems were collected to isolate the pathogen. After surface sterilizing (75% ethanol for 30 s, 5% NaOCl for 60 s, followed by rinsing in sterilized water three times), diseased tissues were cultured on acidified potato dextrose agar (PDA) plates at 20°C for 7 days. Twelve fungal isolates were obtained. All fungal isolates produced typical tan pigment on PDA medium, and produced pycnidia after two weeks (Fig. 1B). Colony morphological characteristics indicated that these isolates might belong to Leptosphaeria biglobosa. To confirm identification, multiple PCR was conducted using the species-specific primers LmacF, LbigF, LmacR (Liu et al. 2006). Genomic DNA of each isolate was extracted using the cetyltrimethylammonium bromide (CTAB) method. DNA samples of L. maculans isolate UK-1 and L. biglobosa isolate W10 (Cai et al. 2015) were used as references. Only a 444-bp DNA band was detected in all 12 isolates and W10, whereas a 333-bp DNA band was detected only in the UK-1 isolate (Fig. 1C). PCR results suggested that these 12 isolates all belong to L. biglobosa. In addition, the internal transcribed spacer (ITS) region of these 12 isolates was analyzed for subspecies identification (Vincenot et al. 2008). Phylogenetic analysis based on ITS sequence showed that five isolates (Lb1134, Lb1136, Lb1138, Lb1139 and Lb1143) belonged to L. biglobosa ‘brassicae’ (Lbb) with 78% bootstrap support, and the other seven isolates (Lb1135, Lb1137, Lb1140, Lb1141, Lb1142, Lb1144 and Lb1145) belonged to L. biglobosa ‘canadensis’ (Lbc) with 95% bootstrap support (Fig. 1D). Two Lbb isolates (Lb1134 and Lb1136) and two Lbc isolates (Lb1142 and Lb1144) were randomly selected for pathogenicity testing on B. napus cultivar Zhongshuang No. 9 (Wang et al. 2002). Conidial suspensions (10 μL, 1 × 107 conidia mL-1) of these four isolates were inoculated on needle-wounded cotyledons (14-day-old seedling), with 10 cotyledons (20 wounded sites) per isolate. A further 10 wounded cotyledons were inoculated with water and served as controls. Seedlings were maintained in a growth chamber at 20°C with 100% relative humidity and a 12-h photoperiod. After 7 days, cotyledons inoculated with the four isolates showed necrotic lesions in the inoculated wounds. Control cotyledons had no symptoms (Fig. 2). Fungi re-isolated from the infected cotyledons showed similar colony morphology as the original isolates. Therefore, L. biglobosa ‘brassicae’ and L. biglobosa ‘canadensis’ appear to be the pathogens causing the observed blackleg symptoms on spring oilseed rape in Gansu, China. In previous studies, L. biglobosa ‘brassicae’ has been found in many crops in China, including oilseed rape (Liu et al. 2014; Cai et al. 2015), Chinese radish (Raphanus sativus) (Cai et al. 2014a), B. campestris ssp. chinensis var. purpurea (Cai et al. 2014b), broccoli (B. oleracea var. italica) (Luo et al. 2018), ornamental kale (B. oleracea var. acephala) (Zhou et al. 2019a), B. juncea var. multiceps (Zhou et al. 2019b), B. juncea var. tumida (Deng et al. 2020) and Chinese cabbage (B. rapa subsp. pekinensis) (Yu et al. 2021 accepted). To the best of our knowledge, this is the first report of L. biglobosa ‘canadensis’ causing blackleg on B. napus in China.

Download Full-text

First report of Diaporthe ueckerae causing stem canker on soybean (Glycine max L.) in Colombia

Plant Disease ◽

10.1094/pdis-04-21-0718-pdn ◽

2021 ◽

Author(s):

Nathali López-Cardona ◽

YUDY ALEJANDRA GUEVARA ◽

Lederson Gañán-Betancur ◽

Carol Viviana Amaya Gomez

Keyword(s):

Management Strategies ◽

Elongation Factor ◽

Morphological Characteristics ◽

Aerial Mycelium ◽

Stem Canker ◽

Growth Stages ◽

Internal Transcribed Spacer Region ◽

First Report ◽

Glycine Max L ◽

Soybean Plants

In October 2018, soybean plants displaying elongated black to reddish-brown lesions on stems were observed in a field planted to the cv. BRS Serena in the locality of Puerto López (Meta, Colombia), with 20% incidence of diseased plants. Symptomatic stems were collected from five plants, and small pieces (∼5 mm2) were surface sterilized, plated on potato dextrose agar (PDA) and incubated for 2 weeks at 25°C in darkness. Three fungal isolates with similar morphology were obtained, i.e., by subculturing single hyphal tips, and their colonies on PDA were grayish-white, fluffy, with aerial mycelium, dark colored substrate mycelium, and produced circular black stroma. Pycnidia were globose, black, occurred as clusters, embedded in tissue, erumpent at maturity, with an elongated neck, and often had yellowish conidial cirrus extruding from the ostiole. Alpha conidia were observed for all isolates after 30 days growth on sterile soybean stem pieces (5 cm) on water agar, under 25ºC and 12 h light/12h darkness photoperiod. Alpha conidia (n = 50) measured 6.0 – 7.0 µm (6.4 ± 0.4 µm) × 2.0 – 3.0 µm (2.5± 0.4 µm), were aseptate, hyaline, smooth, ellipsoidal, often biguttulate, with subtruncate base. Beta conidia were not observed. Observed morphological characteristics of these isolates were similar to those reported in Diaporthe spp. by Udayanga et al. (2015). DNA from each fungal isolate was used to sequence the internal transcribed spacer region (ITS), and the translation elongation factor 1-α (TEF1) gene, using the primer pairs ITS5/ITS4 (White et al. 1990) and EF1-728F/EF1- 986R (Carbone & Kohn, 1999), respectively. Results from an NCBI-BLASTn, revealed that the ITS sequences of the three isolates (GenBank accessions MW566593 to MW566595) had 98% (581/584 bp) identity with D. miriciae strain BRIP 54736j (NR_147535.1), whereas the TEF1 sequences (GenBank accessions MW597410 to MW597412) had 97 to 100% (330-339/339 bp) identity with D. ueckerae strain FAU656 (KJ590747). The species Diaporthe miriciae R.G. Shivas, S.M. Thomps. & Y.P. Tan, and Diaporthe ueckerae Udayanga & Castl. are synonymous, with the latter taking the nomenclature priority (Gao et al. 2016). According to a multilocus phylogenetic analysis, by maximum likelihood, the three isolates clustered together in a clade with reference type strains of D. ueckerae (Udayanga et al. 2015). Soybean plants cv. BRS Serena (growth stages V3 to V4) were used to verify the pathogenicity of each isolate using a toothpick inoculation method (Mena et al. 2020). A single toothpick colonized by D. ueckerae was inserted directly into the stem of each plant (10 plants per isolate) approximately 1 cm below the first trifoliate node. Noncolonized sterile toothpicks, inserted in 10 soybean plants served as the non-inoculated control. Plants were arbitrarily distributed inside a glasshouse, and incubated at high relative humidity (>90% HR). After 15 days, inoculated plants showed elongated reddish-brown necrosis at the inoculated sites, that were similar to symptoms observed in the field. Non-inoculated control plants were asymptomatic. Fungal cultures recovered from symptomatic stems were morphologically identical to the original isolates. This is the first report of soybean stem canker caused by D. ueckerae in Colombia. Due to the economic importance of this disease elsewhere (Backman et al. 1985; Mena et al. 2020), further research on disease management strategies to mitigate potential crop losses is warranted.

Download Full-text

First Report of Leaf Spot Disease Caused by Colletotrichum gloeosporioides on Chinese Bean Tree in China

Plant Disease ◽

10.1094/pdis-03-12-0261-pdn ◽

2013 ◽

Vol 97 (1) ◽

pp. 138-138 ◽

Cited By ~ 1

Author(s):

B. Z. Fu ◽

M. Yang ◽

G. Y. Li ◽

J. R. Wu ◽

J. Z. Zhang ◽

...

Keyword(s):

Leaf Spot ◽

Colletotrichum Gloeosporioides ◽

Disease Incidence ◽

Phylogenetic Analyses ◽

Morphological Characteristics ◽

Leaf Spot Disease ◽

First Report ◽

Spot Disease ◽

Rdna Its ◽

Its Sequence Analysis

Chinese bean tree, Catalpa fargesii f. duciouxii (Dode) Gilmour, is an ornamental arbor plant. Its roots, leaves, and flowers have long been used for medicinal purposes in China. During July 2010, severe outbreaks of leaf spot disease on this plant occurred in Kunming, Yunnan Province. The disease incidence was greater than 90%. The symptoms on leaves began as dark brown lesions surrounded by chlorotic halos, and later became larger, round or irregular spots with gray to off-white centers surrounded by dark brown margins. Leaf tissues (3 × 3 mm), cut from the margins of lesions, were surface disinfected in 0.1% HgCl2 solution for 3 min, rinsed three times in sterile water, plated on potato dextrose agar (PDA), and incubated at 28°C. The same fungus was consistently isolated from the diseased leaves. Colonies of white-to-dark gray mycelia formed on PDA, and were slightly brown on the underside of the colony. The hyphae were achromatic, branching, septate, and 4.59 (±1.38) μm in diameter on average. Perithecia were brown to black, globose in shape, and 275.9 to 379.3 × 245.3 to 344.8 μm. Asci that formed after 3 to 4 weeks in culture were eight-spored, clavate to cylindrical. The ascospores were fusiform, slightly curved, unicellular and hyaline, and 13.05 to 24.03 × 10.68 to 16.02 μm. PCR amplification was carried out by utilizing universal rDNA-ITS primer pair ITS4/ITS5 (2). Sequencing of the PCR products of DQ1 (GenBank Accession No. JN165746) revealed 99% similarity (100% coverage) with Colletotrichum gloeosporioides isolates (GenBank Accession No. FJ456938.1, No. EU326190.1, No. DQ682572.1, and No. AY423474.1). Phylogenetic analyses (MEGA 4.1) using the neighbor-joining (NJ) algorithm placed the isolate in a well-supported cluster (>90% bootstrap value based on 1,000 replicates) with other C. gloeosporioides isolates. The pathogen was identified as C. gloeosporioides (Penz.) Penz. & Sacc. (teleomorph Glomerella cingulata (Stoneman) Spauld & H. Schrenk) based on the morphological characteristics and rDNA-ITS sequence analysis (1). To confirm pathogenicity, Koch's postulates were performed on detached leaves of C. fargesii f. duciouxii, inoculated with a solution of 1.0 × 106 conidia per ml. Symptoms similar to the original ones started to appear after 10 days, while untreated leaves remained healthy. The inoculation assay used three leaves for untreated and six leaves for treated. The experiments were repeated once. C. gloeosporioides was consistently reisolated from the diseased tissue. C. gloeosporioides is distributed worldwide causing anthracnose on a wide variety of plants (3). To the best of our knowledge, this is the first report of C. gloeosporioides causing leaf spots on C. fargesii f. duciouxii in China. References: (1) B. C. Sutton. Page 1 in: Colletotrichum: Biology, Pathology and Control. CAB International. Wallingford, UK, 1992. (2) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990. (3) J. Yan et al. Plant Dis. 95:880, 2011.

Download Full-text