scholarly journals First Report of Meloidogyne incognita on Mulberry in Saudi Arabia

Plant Disease ◽  
2021 ◽  
Author(s):  
Hamzeh Lafi ◽  
Fahad Al-Yahya ◽  
Ahmad Al Hazmi
Keyword(s):  
Saudi Arabia ◽  
Body Length ◽  
Meloidogyne Incognita ◽  
Tail Length ◽  
Total Body Length ◽  
Morus Alba ◽  
Body Width ◽  
First Report ◽  
Stylet Length ◽  
Total Body

The genus Morus comprises many species (Suttie 2012). The species Morus alba is one of the most popular mulberry species worldwide. In October 2020, numerous mulberry trees presented chlorotic leaves and stunted growth with severe root galling in a private compound in Riyadh region, Saudi Arabia. The infected roots showed galls, which are typical symptoms of infection by root-knot nematodes (RKNs). Infected roots were dissected, and males and females were extracted from roots while second stage juveniles (J2s) were from both soil and eggmasses. Morphological and morphometrical features were documented. Perineal patterns of females, males, and J2s were studied using a compound microscope. The endoparasitic females had pearly shaped bodies with projecting neck. Stylet knobs were rounded and set off and the shape of the cone distinctly curved. The posterior perineal had a dorsally high square arch. Striae patterns were zig-zag or forked along the lateral lines. Males were vermiform and the head cap flat to concave. Mostly conus of stylet was longer than shaft. Stylet knobs were prominent, set off, flat and usually greater width than the length. Males had a bluntly rounded tail, spicules were slightly curved and gubernaculum was crescentic. The J2s were vermiform, and stylet knobs were prominent and rounded shape. The J2s tail had a transparent area with an obtuse tip. The morphological measurements (means and range) of the perineal patterns of females (n = 4) were: length of vulval slit (LVS) = 22.5 (21.5 to 23.4) μm, anus to vulval slit (AVS) = 22 (21.8 to 22.1) μm, and anus length (AL) = 7.7 (7.5 to 7.8) μm. The males (n = 16) measurements were: length (L) = 1136 (1116 to 1159) μm; a (total body length / greatest body width) = 34.8 (33 to 37.1); body width = 32.7 (31.2 to 33.8) μm; stylet length = 25.6 (24.7 to 27.3) μm; dorsal oesophageal gland orifice (DGO) = 2.9 (2.6 to 3) μm, tail length = 7.1 (6.5 to 7.8) μm, c (total body length / tail length) = 161 (143.1 to 175), spicules length = 30.8 (26 to 33.8) μm; gubernaculum = 9.7 (9.1 to 10.4) μm. The J2s (n = 11) measurements were: L = 395 (378 to 405) μm; a = 26.2 (24.3 to 28.4); c = 8.6 (8.2 to 9.2); head end to metacorpus valve = 53 (49.4 to 54.6) μm; excretory pore to head end = 78 (72.8 to 80) μm, stylet length = 10.7 (10.4 to 11.7) μm; body width = 15.1 (14.3 to 15.6) μm; tail length = 45.8 (44.2 to 49.4) μm; hyaline tail terminus length = 12.5 (10.4 to 13) μm. Both the morphological and morphometrical features of the perineal pattern of the females, males, and J2s match the original description of Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 (Eisenback and Hirschmann 1981; Taylor and Netscher 1974). To perform Koch’s postulates, mulberry plants maintained in pots were inoculated with 2,500 J2s and eggs of the original population of M. incognita using five replicates. After two months, all inoculated plants had galled roots typical of RKNs. Reproduction factor value was 6.4. The noninoculated plants did not present galls in the roots. These results confirmed the nematode’s pathogenicity on mulberry. To the best of our knowledge, this is the first report that M. incognita was identified as a parasite of mulberry (Morus alba) in Saudi Arabia and the world, while Meloidogyne hispanica was reported on mulberry trees in Iran (Shokoohi et al. 2016). The importance of this report shed some lights on this new problem to direct the attention of farmers and home gardeners to take actions for the management of this newly identified problem. The authors declare no conflict of interest. Acknowledgments Authors wish to thanks College of Food and Agricultural Sciences, Research Center and Deanship of Scientific Research, King Saud University, Saudi Arabia for supporting this work. References: Eisenback, J. D. and Hirschmann, H. 1981. J. Nematol. 13:513. Shokoohi, E. et al. 2016. Australasian Plant Dis. Notes 11:16. Suttie, J. M. 2012. Food and Agricultural Organization of the United Nations. Taylor D. P., Netscher, C. 1974. Nematologica 20:268.

scholarly journals First Report of Subanguina moxae Infecting Mugwort in Yunnan, China

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1232-1232 ◽  
Author(s):  
R. Y. Yao ◽  
X. Q. Hu ◽  
J. P. Xue
Keyword(s):  
Body Length ◽  
Tail Length ◽  
Total Body Length ◽  
Guizhou Province ◽  
Universal Primers ◽  
Parasitic Nematodes ◽  
Its Sequence ◽  
First Report ◽  
Stylet Length ◽  
Total Body

Mugwort is a perennial in the Compositae family distributed throughout Asia and Europe. The leaves are reported to have various pharmaceutical properties, e.g., antibacterial, antiviral, antitussive, and hemostatic properties, and have been used in traditional Chinese medicine for more than 2,000 years. In August 2011, a field of mugwort in Kunming, Yunnan Province, China, exhibited more than 90% incidence of whitish and rounded galls on the leaves. There were approximately 10 galls on each leaf, impacting the quality of the leaves for medicinal use. Parasitic nematodes were found upon dissection of the galls, then eggs, second-stage juveniles (J2), and mature males and females were observed. Through the morphologic observation of juveniles and female and male adults, the parasitic nematode was identified as Subanguina moxae (Yokoo and Choi, 1968) Brzeski, 1981 (3). Key morphological features are as follows: eggs (n = 20) measured 54.0 to 71.4 × 24.1 to 30.0 μm; J2 (n = 20) had the following characteristics: body length 689.3 to 873.2 μm (x = 775.5 μm); stylet length 8.2 to 9.8 μm (x = 8.8 μm); tail length 49.5 to 74.5 μm (x = 60.1 μm); a (total body length/maximum body width) ranged from 28.6 to 38.6 μm (x = 34.1 μm); and c (total body length/the length of the tail) ranged from 11.2 to 16.0 μm (x = 13.0 μm). Females (n = 20) had the following characteristics: body length 1,252.8 to 1,665.2 μm (x = 1,475.7 μm); stylet length 7.2 to 9.2 μm (x = 8.2 μm); V of 88.0 to 92.3 μm (x = 89.6 μm); a ranged from 17.6 to 24.5 μm (x = 21.3 μm); and c ranged from 20.2 to 28.9 μm (x = 22.8 μm). Males (n = 20) had the following characteristics: body length 994.2 to 1,453.6 μm (x = 1,253.2 μm); stylet length 7.5 to 9.9 μm (x= 9.1 μm); tail length 69.2 to 88.1 μm (x = 78.0 μm); spicule length 22.2 to 33.4 μm (x = 29.4 μm); gubernaculum length 10.4 to 14.2 μm (x = 12.2 μm); a ranged from 23.1 to 37.2 μm (x = 29.9 μm); and c ranged from 13.9 to 18.7 μm (x = 16.1 μm). Amplification of the rDNA-internal transcribed spacer (ITS) region and the D2/D3 (1) fragments of the 28S RNA with universal primers rDNA1/rDNA2 and D2A/D3B yielded PCR fragments of 934 bp and 754 bp, respectively. The ITS sequence (JN865234) and D2D3 sequence (JN885540) were submitted to GenBank. The ITS sequence (JN865234) exhibited 99.4% similarity with Mesoanguina moxae (AF396314) (synonym of S. moxae) (4). S. moxae has been identified from the common mugwort in Japan (2) and in China, was reported to infect wheat in Guizhou Province, but to our knowledge, this is the first report of this nematode affecting mugwort in Yunnan, China. References: (1) S. Amiri et al. Eur. J. Plant Pathol. 108:497, 2002. (2) K. Daigo et al. Bull. School Agric. Meiji University. 56:237, 2007. (3) M. R. Siddiqi. Tylenchida: Parasites of Plants and Insects. CABI Publishing, New York, 2000. (4) S. A. Subbotin et al. Mol. Phylogenet. Evol. 30:226, 2004.

Steinernema loci sp. n. and Steinernema thanhi sp. n. (Rhabditida: Steinernematidae) from Vietnam

Nematology ◽  
2001 ◽  
Vol 3 (6) ◽  
pp. 503-514 ◽  
Author(s):  
Maurice Moens ◽  
Ngoc Chau Nguyen ◽  
Ke Long Phan
Keyword(s):  
Body Length ◽  
First Generation ◽  
Tail Length ◽  
Total Body Length ◽  
Body Width ◽  
Lateral Field ◽  
Diagnostic Characters ◽  
Spicule Length ◽  
Third Stage ◽  
Total Body

AbstractTwo new species of Steinernema (Rhabditida), Steinernema loci sp. n. and S. thanhi sp. n., were isolated from beach soil in Thanhhoa and Hatinh provinces in the northern part of Vietnam. A combination of morphological, morphometric and rDNA-RFLP features indicated the distinctness of both species from other Steinernema spp. Diagnostic characters of Steinernema loci sp. n. include: total body length (896-1072 μm), distance from anterior end to excretory pore (EP = 71-86 μm), tail length (66-83 μm), lateral field in mid-body with eight ridges (nine distinct lines) and rounded, broad and smooth anterior end of the third stage infective juvenile; first generation males were characterised by body width, spicule length and the ratio spicule length : anal body width (SW). Diagnostic characters of Steinernema thanhi sp. n. third stage infective juveniles include: total body length (720-960 μm), EP (68-84 μm), tail length (52-72 μm), lateral field in mid-body with eight ridges (nine distinct lines) and rounded, broad and smooth anterior end. Spicule length, ratio SW and arrangement of genital papillae characterised the first generation males.

scholarly journals First Report of Meloidogyne incognita on Cardamine Violifohia in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Rui Liu ◽  
Hongqing Yin ◽  
Lin Li ◽  
Kaiwei Huang ◽  
Huixia Li ◽  
...  
Keyword(s):  
Body Length ◽  
Meloidogyne Incognita ◽  
Uv Light ◽  
Morphological Characteristics ◽  
Tail Length ◽  
Nematode Species ◽  
Economic Losses ◽  
Egg Masses ◽  
First Report ◽  
Stylet Length

Cardamine violifohia is an economically-important medicinal plant, and also a valuable plant for strong ability to accumulate selenium (Se) (Ebba et al. 2020). It is not only be used to extract selenium protein and selenium polysaccharide, but also widely used to develop selenium-supplement reagent. In September 2020, root-knot nematodes (RKN; Meloidogyne spp.) infection experiments showed that galls and egg masses were observed on the roots of numerous C. violifolia plants in Enshi (30°32′25.67″ N; 109°48′48.46″ E), Hubei Province, China. Meanwhile, the overground plants of C. violifohia were stunted and leaves were yellow. Almost 5% C. violifohia plants were affected by the disease. The roots with galls were collected, and nematodes were dissected and extracted (Fig. S1). Based on phytopathological clinic, the number of galls on each plant was 91.87 ± 19.01, and egg masses was 15.27 ± 5.36 (n = 15). Nematodes and galls were collected from soil and infected roots (Barker 1985). The morphological diagnostic of the nematode species was measured as follows. Measurements of adult females (n=20), body length = 628.15 ± 73.69 μm, width = 356.77 ± 36.72 μm, stylet length = 15.58 ±0.93 μm. Meanwhile, a high and trapezoidal dorsal arch with thick striations was observed in the perineal region of females. Second-stage juveniles (J2s) (n=20): body length = 377.09 ± 18.19 μm, body width = 15.64 ± 1.24 μm, stylet length = 13.31 ± 1.04 μm, tail length = 42.49 ± 4.64 μm, hyaline tail terminus = 12.35 ± 2.02 μm and presented well developed esophageal glands. Eggs (n=20): length = 80.81 ± 3.47 μm, and width = 37.09 ± 2.98 μm. All the morphological characteristics of the identified species were consistent with the descriptions of Meloidogyne incognita (Kofoid & White, 1919) Chitwood, 1949 (Whitehead, 1968). Molecular identification was carried out by PCR with the M. incognita-specific primers Mi-F/Mi-R (Meng et al. 2004) and 28S rDNA D2/D3 region primers MF/MR (Hu et al. 2011). The target fragments of 955 bp and 478 bp amplified by of the primer pairs Mi-F/Mi-R and MF/MR were observed under a UV light, which confirmed that these nematodes collected from C. violifohia were M. incognita (Fig. S2). Fragments were, sequenced (MZ596342 and MZ566843, respectively) and aligned with available sequences on NCBI, which were 100% identical to the MK410954, MN728679, and MK410953, MF177882 M. incognita sequences, respectively. Pathogenicity testing was conducted to perform Koch’s postulates in a greenhouse by inoculation of 500 J2s from the original population into C. violifohia seedlings (n = 30, 5-6 leaves stage). After 7 weeks, all inoculated plants exhibited the same symptoms that observed in the field initially. Different life stages of M. incognita were observed in dissected galled tissues. The average reproductive factor was 37.30 ± 6.13, which is considered as the pathogenicity of M. incognita to C. violifohia. Therefore, C. violifohia is a suitable host for M. incognita in China. The growers should be informed of the current findings to avoid serious economic losses that might be caused by this pathogenic nematode, and prepare for proper management action. To our knowledge, this is the first report of M. incognita infecting C. violifohia in China.

Reflecting materials in the eyes of three teleosts, Orthopristes chrysopterus, Dorosoma cepedianum and Anchoa mitchilli

1973 ◽  
Vol 184 (1074) ◽  
pp. 15-27 ◽  
Keyword(s):  
Body Length ◽  
Pigment Epithelium ◽  
Total Body Length ◽  
Gizzard Shad ◽  
Dorosoma Cepedianum ◽  
Anchoa Mitchilli ◽  
First Report ◽  
Total Body ◽  
Bay Anchovy

The tapeta lucida of three species of teleosts were examined to determine the composition of the reflecting material. The fishes were bay anchovy Anchoa mitchilli (Engraulidae), gizzard shad Dorosoma cepedianum (Clupeidae) and pigfish Orthopristes chrysopterus (Haemulidae). The tapetum of each species was situated in the pigment epithelium of the eye. That of the pigfish contained triglycerides identified as chiefly glyceryl tridocosahexaenoate. A reduced pteridine, 7, 8-dihydroxanthopterin, occurred in the tapetum of the gizzard shad. Guanine occurred in the tapetum of the bay anchovy. The tapetum of the shad contained brightly reflecting particles about 0.5 μm in diameter There were 10.8 mg of dihydroxanthopterin in the tapetum of a shad (total body length 23 cm) and 0.46 mg of guanine in the tapetum of an anchovy (total body length 9 cm). This is the first report of a pteridine acting as a retinal reflector in vertebrates. Various aspects of retinal reflectors of teleosts are discussed and their variety and common characteristics commented upon.

scholarly journals PERKEMBANGAN DAN GAMBARAN ANATOMIS LARVA INFEKTIF (L3) Haemonchus contortus YANG DIBIAKKAN DENGAN VERMICULLITE (Development and Anatomical Description of Infektive Larvae (L3) Haemonchus contortus Cultured with Vermicullite)

2016 ◽  
Vol 10 (1) ◽  
pp. 62
Author(s):  
Rahmi Sulastri Mukhtar ◽  
Muhammad Hambal ◽  
Muhammad Hanafiah ◽  
Yudha Fahrimal ◽  
Winaruddin Winaruddin ◽  
...  
Keyword(s):  
Larval Development ◽  
Body Length ◽  
Haemonchus Contortus ◽  
Tail Length ◽  
Total Body Length ◽  
Basic Information ◽  
Infective Larvae ◽  
Body Diameter ◽  
Total Body ◽  
Banda Aceh

This study was aimed at obtaining basic information about bioecology of Haemonchus contortus, related to larval development and anatomical description of infective larvae (L3). In this study, the ova of Haemonchus contortus were harvested out of the intestines of goats, those were slaughtered in municipal slaughterhouse in Kampung Jawa Banda Aceh. The ova of Haemonchus contortus were then cultured using vermiculite as media, and observed daily until the larvae reached 3rd stage larvae. The result revealed that the larvae need 7 days to reach from eggs into infective larvae. Larvae obtained has uniform morphology, with a body diameter of 22 μm, tail length up to 55 μm hyaline, esophagus posterior to the tail of 592 μm, length of esophagus anterior to posterior esophagus 145 μm, and a total body length of larvae 737 μm.

A new entomopathogenic nematode, Steinernema hebeiense sp. n. (Rhabditida: Steinernematidae), from North China

Nematology ◽  
2006 ◽  
Vol 8 (4) ◽  
pp. 563-574 ◽  
Author(s):  
Maurice Moens ◽  
Sergei Spiridonov ◽  
Aihua Yan ◽  
Shulong Chen ◽  
Xiuhua Li
Keyword(s):  
New Species ◽  
Body Length ◽  
Entomopathogenic Nematode ◽  
Tail Length ◽  
Total Body Length ◽  
Molecular Data ◽  
Body Region ◽  
Lsu Rdna ◽  
Lateral Field ◽  
Total Body

AbstractA new species of Steinernema (Rhabditida), S. hebeiense sp. n. was isolated from sandy soil, Hebei Province, China. Diagnostic characters of infective juveniles of S. hebeiense sp. n. include total body length of 658 (610-710) μm, distance from anterior end to excretory pore of 48 (43-51) μm, tail length of 66 (63-71) μm, and E% ratio of 72 (65-80). The lateral field has eight ridges at the mid-body region (two very thin submarginal ridges, poorly discernible under light microscope, but visible in SEM); and the anterior end is slightly offset and flattened. First generation males have a body length of 1177 (1036-1450) μm, spicule length = 57 (51-63) μm, and gubernaculum length = 46 (38-50) μm. The spicules are light brown in colour and slightly curved; the manubrium is longer than wide. A tail mucron is present in second generation males. These morphometrical and morphometric features classify S. hebeiense sp. n. within the ' feltiae-kraussei-oregonense ' group. Molecular data also classify the new species within this group. Within this group, the smallest differences between the sequences of S. hebeiense sp. n. is with S. weiseri – 73 bp in the ITS rDNA and 13 bp in the studied partial sequence of the D2D3 expansion segment of LSU rDNA.

scholarly journals First Report of the Dagger Nematode Xiphinema diversicaudatum in Citrus Orchards in Morocco

Plant Disease ◽  
2014 ◽  
Vol 98 (4) ◽  
pp. 575-575 ◽  
Author(s):  
F. Mokrini ◽  
F. Abbad Andaloussi ◽  
L. Waeyenberge ◽  
N. Viaene ◽  
M. Moens
Keyword(s):  
Body Length ◽  
Tail Length ◽  
Morphological Identification ◽  
Rrna Gene ◽  
Body Width ◽  
Arabis Mosaic Virus ◽  
First Report ◽  
Citrus Orchards ◽  
Plant Pathol ◽  
Xiphinema Diversicaudatum

Xiphinema species are migratory ectoparasitic nematodes that feed on an extensive range of hosts, and several species are vectors of nepoviruses. In May 2012, during a survey of the citrus-growing areas in the Gharb region of Morocco, several Xiphinema nematodes were detected in three locations: Kénitra (INRA, plot P1), Sidi Kacem, and Sidi Slimane. Samples were taken 30 cm deep at 50 cm distance from the tree trunks, in 40-year-old orange groves planted with the variety Maroc Late, grafted on rootstocks of Sour Orange and Citrange Carrizo. The trees showed yellowing of leaves, reduced tree vigor, and swellings at the tips of the roots. There were no weeds or grasses in the sampled area. Nematodes were extracted from soil using an automated centrifuge for extracting free-living nematode stages (2) and identified morphologically and by sequencing. All specimens were identified as Xiphinema diversicaudatum based on key morphological features from females and males. The average measurements of six females were: body length 4.1 mm, body width 60.4 μm, odontostylet 133.5 μm, odontophore 64.0 μm, spear 197.5 μm, tail length 45 μm, body width at anus 31 μm, and vulval position 48%. The females had two genital branches of similar length and structure, which contained a pseudo-Z differentiation. The average measurements of four males were: body length 4.3 mm, body width 51 μm, odontostylet 139 μm, odontophore 70 μm, spear 209 μm, tail length 45 μm, body width at anus 35 μm. To confirm the morphological identification, molecular observations were made. DNA was extracted from one nematode of each location. The D3 expansion region of the 26S rRNA gene was amplified using the primers D3A (5′-GACCCGTCTTGAAACACGGA-3′) and D3B (5′-TCGGAAGGAACCAGCTACTA-3′) (1). The PCR products were purified and sequenced (Macrogen, Inc., Seoul, Korea). All sequences obtained (GenBank Accession Nos. KF057879, KF057880, and KF057881) were compared with sequences available from the GenBank database including several species of Xiphinema. This comparison revealed a sequence similarity of 99 to 100% with X. diversicaudatum. Morphological and molecular identification demonstrated that the isolates of dagger nematodes from three citrus growing areas in Gharb belonged to X. diversicaudatum. An average of six X. diversicaudatum per 100 cm3 soil were found. This is the first report of this species in Morocco. X. diversicaudatum can transmit Arabis mosaic and Strawberry latent ringspot viruses (3). Arabis mosaic virus is of great economic importance in viticulture as it is associated with grapevine fanleaf degeneration disease, together with Grapevine fan leaf virus transmitted by X. index (4). As vineyards are planted amid citrus orchards in the Gharb region, particular attention should be given to this nematode, especially to the risk of its spread by soil. Our finding of X. diversicaudatum in a citrus orchard does not necessarily imply that X. diversicaudatum causes damage in citrus. However, its presence indicates that this nematode species can survive in this environment from where it could spread to other, more susceptible, crops. References: (1) L. Al-Banna et al. Mol. Phylogenet. Evol. 7:94, 1997. (2) G. Hendrickx. Nematologica 41:30, 1998. (3) J. Hübschen et al. Eur. J. Plant Pathol. 110:779, 2004. (4) A. Marmonier et al. J. Plant Pathol. 92:275, 2010.

scholarly journals First Report of Leipotylenchus abulbosus in Iran

Plant Disease ◽  
2011 ◽  
Vol 95 (7) ◽  
pp. 882-882
Author(s):  
M. Mirzaee-Qomi ◽  
F. Khozeini ◽  
S. Barooti ◽  
S. Rezaee
Keyword(s):  
Body Length ◽  
Sandy Loam ◽  
Morphological Characteristics ◽  
Tail Length ◽  
Crop Plants ◽  
The Body ◽  
Posterior Portion ◽  
First Report ◽  
Pure Cultures ◽  
Stylet Length

Leipotylenchus abulbosus (Thorne, 1949) Sher, 1974 belongs to the family Tylenchidae, subfamily Leipotylenchinae, and order Tylenchida. During the spring and autumn months of 2008 to 2010, 80 samples were collected from rhizosphere soil of symptomatic plants including wheat (Tritichum aestivum L.), beet (Beta vulgaris L.), and maize (Zea mays L.) from Meighan and Gavar regions of Markazi Province in central Iran. Plants were dwarfed and leaves were chlorotic. Diseased plants comprised ~7% of all plants in the field. Sandy loam soil was collected from roots up to 15 cm from the base of the plants. Nematodes were extracted from the soil by sieving and centrifugation (3). For species identification, nematodes were transferred to anhydrous glycerin (2) and mounted on slides by the paraffin ring method. Identification was based on morphometric and morphological characteristics of females and males. No other forms of the nematode were isolated from collected samples. L. abulbosus was found in 10% of the collected samples. The nematodes showed typical characteristics of the genus Leipotylenchus: striated and anteriorly flattened lip region, stylet without basal knobs, didelphic gonads, four incisures in lateral fields that were areolated in the posterior portion, presence of deirids and adanal caudal alae, amphid inconspicuous in males. Males contained bursa in tail. Females contained an almost straight body, tapering anteriorly from median bulb and posteriorly beyond the anus; cuticle thick, annules fine. Labial framework was moderately sclerotized. Median bulb with prominent valvular apparatus in the center, oval, occupied two-thirds of the body. Deirids were prominent and at the level of the excretory pore. Vagina a transverse slit at right angles to body axis, extending less than half width into body. Tai1 finely annulated, short, tapering to a narrow tip but becoming broader just before the terminus. Phasmids small in anterior half of the tail. Measurements of 12 females: body length = 1,377 ± 90 (1,276 to 1,469) μm; a = 39.2 ± 1.62 (36.8 to 41.1); b = 7.2 ± 0.34 (6.6 to 8.30); c = 11.1 ± 0.16 (10.7 to 11.3); V% = 52.6 ± 1.42 (50.4 to 53.8); stylet length = 17 ± 0.22 (16.6 to 18) μm; tail length = 124 ± 6.83 (116 to 137) μm); and 7 males: (body length = 1,150 ± 56.84 (1,090 to 1,246) μm; a = 39.5 ± 1.48 (37.5 to 41.5); b = 6.4 ± 0.21 (6.1 to 6.8); c = 9.5 ± 0.06 (9.4 to 9.6); T% = 55.1 ± 0.91 (54.4 to 56.20); stylet length = 17.6 ± 0.36 (17 to 18) μm; tail length = 120 ± 3.77 (115 to 129) μm) conformed to the description of L. abulbosus. L. abulbosus, originally isolated from crop plants in surveyed regions, was cultured on beet (B. vulgaris L.) in the greenhouse. Pure cultures of the nematode were inoculated on beet seedlings at the 4- to 6-leaf stage as described previously (1). Sterilized soils were inoculated with 1,000 infective mature nematodes with three replications. Infection of beet roots by the nematode resulted in leaf chlorosis and reduction in plant height. Previously, L. amiri was collected from soils associated with the roots of onion (Allium cepa L.) plants in Pakistan (4). However there have not been any reports of L. abulbosus in crop plants before. To our knowledge, this is also the first report of L. abulbosus infecting wheat, beet, and maize plants in Iran. References: (1) K. R. Barker. Methodology 2:19, 1985. (2) A. De Grisse. Meded. Rijksfac. Landbouwwet. Gent. 34:351, 1969. (3) W. R. Jenkins. Plant Dis. Rep. 48:692, 1964. (4) M. A. Maqbool and F. Shahina. Rev. Nèmatol. 7:363, 1984.

scholarly journals First Report of Lesion Nematode (Pratylenchus vulnus) on Boxwood in Ohio

Plant Disease ◽  
2012 ◽  
Vol 96 (9) ◽  
pp. 1385-1385
Author(s):  
H. D. Lopez-Nicora ◽  
T. Mekete ◽  
N. J. Taylor ◽  
T. L. Niblack
Keyword(s):  
Body Length ◽  
Tail Length ◽  
The Body ◽  
28S Rrna ◽  
Lateral Field ◽  
First Report ◽  
Pratylenchus Vulnus ◽  
Buxus Sempervirens ◽  
Stylet Length ◽  
De Man

Boxwood (Buxus sempervirens L. and other species) is a popular evergreen shrub used in landscaping. In January 2012, three nursery-grown plants of cv. Green Gem boxwood were submitted from Warren County, Ohio to the C. Wayne Ellet Plant and Pest Diagnostic Clinic at The Ohio State University, an Ohio Plant Diagnostic Network laboratory. The plants, established for 4 years, exhibited orange to bronze discoloration of the foliage; foliage was not desiccated and dieback was not evident although stunting was present. Plant root symptoms ranged from nearly complete necrosis to distinct black lesions on living roots. A root scraping showed nematodes present in the lesions. Nematodes were extracted from root and soil subsamples with a Baermann funnel apparatus for 48 h (3). A high number of lesion nematodes (Pratylenchus sp.) were observed from both soil and root samples. Individual nematodes were handpicked and identified under a compound light microscope as Pratylenchus vulnus Allen & Jensen, 1951 according to morphologic and morphometric characteristics (2). Males and females were observed with stylets having rounded knobs, labial regions continuous with the body contour, and three to four lip annuli. The lateral field contained four incisures, with the two inner incisures closer to each other than to the outer ones. The esophagus overlapped the intestine ventrally. Female (n = 12) body length ranged from 410.3 to 654.5 μm (mean 583.0 μm), stylet length from 15.0 to 17.8 μm (mean 16.8 μm), tail length from 23.2 to 37.5 μm (mean 29.2 μm), vulva position from 78.9 to 85.6% (mean 81.7%), dorsal esophageal outlet (DGO) from 2.6 to 3.5 μm (mean 3.1 μm), and with functional oblong spermathecae. De Man ratios were as follows: a = 25.3 to 33.3 (mean 28.4), b = 4.1 to 7.6 (mean 6.0), c = 16.1 to 23.5 (mean 20.1), and c′ = 1.8 to 2.6 (mean 2.1). Male (n = 16) body length ranged from 478.0 to 589.0 μm (mean 537.9 μm), stylet length from 15.0 to 17.2 μm (mean 16.2 μm), tail length from 22.7 to 28.1 μm (mean 25.5 μm), spicule from 15.0 to 17.5 μm (mean 16.4 μm), gubernaculum from 3.5 to 4.7 μm (mean 4.0 μm), and DGO from 2.6 to 3.7 μm (mean 3.1 μm). De Man ratios were as follows: a = 26.4 to 36.3 (mean 30.5), b = 5.0 to 7.9 (mean 5.8), c = 19.1 to 23.0 (mean 21.1), and c′ = 1.6 to 2.4 (mean 2.0). DNA was extracted from single adult females and the D2-D3 expansion region of the 28S rRNA gene was amplified using forward primer ACAAGTACCGTGAGGGAAAGTTG and reverse primer TCGGAAGGAACCAGCTACTA (4). The PCR product was purified and sequenced. The sequence was deposited in GenBank (Accession No. JQ692308) and was compared with sequences previously deposited in GenBank by means of BLAST search. The comparison revealed a sequence similarity of 98 to 99% with P. vulnus (e.g., GenBank Accession Nos. HM469437.1, EU130886.1, and JQ003994.1). P. vulnus is a known pathogen of boxwood (1). To our knowledge, this is the first report of P. vulnus in Ohio. References: (1) K. R. Barker. Plant Dis. Rep. 58:991, 1974. (2) P. Castillo and N. Vovlas. Pratylenchus (Nematoda: Pratylenchidae): Diagnosis, Biology, Pathogenicity and Management. Koninklijke Brill NV, Leiden, the Netherlands, 2007. (3) D. J. Hooper. In: Laboratory Methods for Work with Plant and Soil Nematodes. J. F. Southey, ed. Reference book 402. Ministry of Agriculture, Fisheries and Food, London, 1986. (4) G. C. Tenente et al. Nematropica 34:1, 2004.

Morphological Variation Among Populations of the Mountain Brushtail Possum, Trichosurus-Caninus Ogilby (Phalangeridae, Marsupialia)

1995 ◽  
Vol 43 (5) ◽  
pp. 449 ◽  
Author(s):  
DB Lindenmayer ◽  
KL Viggers ◽  
RB Cunningham ◽  
CF Donnelly
Keyword(s):  
Body Length ◽  
New South ◽  
Morphological Characteristics ◽  
Tail Length ◽  
Total Body Length ◽  
Canonical Variate ◽  
Brushtail Possum ◽  
Morphometric Variation ◽  
South Wales ◽  
Total Body

The results are described of a study of morphometric variation among populations of the mountain brushtail possum, Trichosurus caninus Ogilby. Trapping surveys were completed at seven sites from southern Victoria to central Queensland. The variables measured from each of the 102 animals captured included head length, skull width, total body length, tail length, pes length, length of the ear conch, body girth, belly girth and the pelage colour. Canonical variate analysis highlighted the existence of a marked separation between populations in Victoria and those in New South Wales and Queensland. The first canonical variate accounted for 89% of the variation between the populations and was dominated by the length of the ear conch, tail length and pes length. There also were differences between the populations for several other morphometric measures including the head and body length. We recorded considerable variation in the fur colour of T. caninus both within and between the populations surveyed. However, no consistent pattern in the geographic variation of fur coloration was evident. We do not know the ecological or evolutionary causes underlying the observed differences in morphological characteristics amongst the populations of T. caninus. Further work is planned to examine the genetic variability of the populations and to assess the taxonomic significance of our findings.

Sign in / Sign up

Export Citation Format

Share Document