First Report of Colletotrichum truncatum Causing Anthracnose on Oxalis corniculata in China

Oxalis corniculata L., which belongs to the family Oxalidaceae R. Br., is a very common perennial herb. It is usually planted on bare land or under the forest as landscaping plants, and the whole plant can be used for its medicinal values of clearing heat, detoxification and detumescence. In August 2019, typical symptoms of anthracnose on O. corniculata leaves were observed in the green belt on the campus of Shandong University of Technology (36.81°N, 117.99°E), Shandong Province, China. The disease incidence was above 40% by investigating more than 300 m2 of planting area. Most of O. corniculata are planted under the forest where the disease is found, mainly in the environment with high relative humidity and less ventilation. The infected leaves appeared initially as tawny oval or irregular spots, and then the lesions enlarged gradually until the leaves became dieback or wholly withered, which greatly reduced the landscape effect of O. corniculata. Diseased leaves were collected by cutting into small pieces and sterilized with 75% ethanol for 30 s and 2% sodium hypochlorite (NaClO) for 60 s, rinsed with sterile deionized water for three times. Each air-dried tissue segment was cultured on potato dextrose agar (PDA) and incubated at 25℃ for 5 to 7 days in the dark (Zhu et al. 2013). Fifteen isolates were obtained from 20 symptomatic leaves and the cultures were initially gray white, subsequently became grayish to dark green after 7 days, with copious gray aerial mycelium and black microsclerotia. Three isolates were verified by the amplification of DNA sequences of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), actin (ACT), histone H3 (H3) and chitin synthase (CHS1) genes, using the primer pairs GDF1/GDR1, ACT-512F/ACT-783R, CYLH3F/CYLH3R, and CHS-79F/CHS-234R (Damn et al. 2019, Fu et al. 2019, Liu et al. 2013), respectively. The sequenced genes (GenBank accession no. OK017473, OK159078, OK159076, OK159077) shared 99.62 to 100.00% nucleotide identity with the corresponding genes of Colletotrichum truncatum strain UASB-Cc-10 (GenBank accession no. KF322064.1, KF322055.1, KF322073.1, KF319059.1), respectively, which was consistent with the morphological identification (Sawant et al. 2012). Pathogenicity test was performed with six healthy O. corniculata plants infected with mycelial plugs (about 3 mm in diameter) of three C. truncatum isolates from a 5-day-old culture, while the negative controls on the same leaves were inoculated with sterile PDA plugs. All plants were placed in a greenhouse at 25 to 30℃ with 90% relative humidity. The experiment was conducted three times. Five days later, all inoculated leaves appeared brown sunken spots, whereas no symptoms appeared on negative controls. The same pathogens, C. truncatum, were identified from the inoculated leaves on the basis of morphological and molecular characteristics as described above, confirming Koch’s postulates. To our knowledge, anthracnose caused by C. truncatum on O. corniculata is the first report in China. The discovery of this new disease is beneficial to the application and protection of O. corniculata, a popular landscape and medicinal plant. References: Damn, U., et al. 2019. Stud. Mycol. 92:1. https://doi.org/10.1016/j.simyco.2018.04.001 Fu, M., et al. 2019. Persoonia 42:1. https://doi.org/10.3767/persoonia.2019.42.01 Liu, F., et al. 2013. Mycologia 105:844. https://doi.org/10.3852/12-315 Sawant, I. S., et al. 2012. New Dis. Rep. 25:2. https://doi.org/10.5197/j.2044-0588.2012.025.002 Zhu, L., et al. 2013. J. Phytopathol. 161:59. https://doi.org/10.1111/jph.12019 The author(s) declare no conflict of interest. Acknowledgments: This research was financially supported by the Top Talents Program for One Case One Discussion of Shandong Province and Academy of Ecological Unmanned Farm (2019ZBXC200).

Download Full-text

First report of Pythium aristosporum causing corn stalk rot in China

Plant Disease ◽

10.1094/pdis-01-21-0164-pdn ◽

2021 ◽

Author(s):

Junjie Ding ◽

Xin Gu ◽

Wei Liu ◽

Liang Chen ◽

Xiaohe Yang ◽

...

Keyword(s):

Disease Incidence ◽

Pathogenic Fungi ◽

Selective Medium ◽

Cell Counting ◽

Molecular Characteristics ◽

Pathogenicity Test ◽

Corn Stalk ◽

First Report ◽

Stalk Rot ◽

Agar Media

Corn (Zea mays L.) stalk rot, caused by various pathogens, is one of the most prevalent corn diseases worldwide. In October 2019, a survey was carried out to determine pathogenic fungi causing corn stalk rot in 3 fields (~120 ha) in Harbin city (44.04°N 125.42°E), Heilongjiang Province, China. In each field, 100 plants at 5 sampling points were assessed at the milk stage (R3) of development. Disease incidence was 12%. Symptomatic plants showed rapid death of the upper leaves, drooping ears and stalks were soft, hollow, watersoaked with white hyphae present on teh outside of the stalk. Pieces of tissue (0.25 cm2) from 15 individual diseased stalks (5 plants/field) were surface disinfested in 0.5% NaOCl for 5 min, rinsed three times in sterile distilled water and cultured on potato dextrose agar (PDA) containing streptomycin (50 μg/mL). After three days of incubation, a total of twelve fungal cultures with uniform characteristics were isolated and subcultured by transferring hyphal tips onto V8. Colonies on V8 selective medium were creamy white and floccus, with a growth rate of 20 mm/day at 26°C in darkness. Oospores were mostly plerotic, and oogonia walls were 1.3 to 2.7 μm thick (n = 50); globose oogonia, 23.9 to 30.5 μm in diameter (n = 50), and had 1 to 8 antheridia. Based on these characteristics, the isolates were identified as Pythium sp. (van der Plaats-Niterink 1981). Genomic DNA was extracted from single conidial cultures of representative isolates (MZYJF1, MZYJF3 and MZYJF7), and the internal transcribed spacer (ITS) region and cytochrome coxidase subunit II (CoxII) gene were amplified and sequenced using the primers ITS1/ITS4 (Yin et al. 2012) and COX2f/COX2r (Hudspeth et al. 2000), respectively. Partial nucleotide sequences of 796 bp and 573 bp for the ITS and COX11 amplicons, respectively, were obtained and deposited in GenBank (accession no. MW447501 for ITS, and MW471006 for COXII). MegaBLAST analysis of the ITS and CoxII sequences of MZYJF1 isolate showed 100% similarity with sequences from P. aristosporum strain ATCC 11101. The isolates were identified as P. aristosporum based on the fact that P. aristosporum has aplerotic oospores and less antheridia per oogonium than P. arrhenomanes (van der Plaats-Niterink 1981). A pathogenicity test was performed on corn cv. Xianyu 335 at tasseling stage (VT) in the field. An oospore suspension, obtained from isolate MZYJF1 grown on V8 agar media for 4 weeks (Green and Jensen, 2000) and diluted to 1×104 oospores/mL using blood cell counting method, was injected into the base of the maize stems of 6 healthy plants (1.5 ml/plant ) using a syringe. Control plants were injected with distilled sterile water. All inoculated plants showed symptoms 25 days after inoculation that were similar to those observed in the field. The oomycete of P. aristosporum was reisolated from symptomatic plants on V8 agar media and identified according to morphological and molecular characteristics. No symptoms were observed on the control plants. P. aristosporum has previously been reported on causing damping-off of pea in the Columbia basin of Central Washington (Alcala et al. 2016) and on soybean in North Dakota (Zitnick-Anderson and Nelson 2015). To our knowledge, this is the first report of P. aristosporum causing corn stalk rot in China. Corn stalk rot caused by P. aristosporum poses a threat to significantly reduce the quality of corn. Thus, its distribution needs to be investigated and effective disease management strategies developed.

Download Full-text

First Report of Root-Knot Nematode Meloidogyne enterolobii on Sweet Potato in China

Plant Disease ◽

10.1094/pdis-09-13-0953-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 702-702 ◽

Cited By ~ 1

Author(s):

B. Gao ◽

R. Y. Wang ◽

S. L. Chen ◽

X. H. Li ◽

J. Ma

Keyword(s):

Sweet Potato ◽

Dna Sequences ◽

Molecular Characteristics ◽

28S Rrna ◽

Storage Roots ◽

Specific Primers ◽

First Report ◽

Meloidogyne Enterolobii ◽

Meloidogyne Spp ◽

Meloidogyne Sp

Sweet potato (Ipomoea batatas Lam.) is the fifth largest staple crop after rice, wheat, maize, and soybean in China. Sweet potato tubers were received from Zhanjiang, Guangdong Province, China, in June 2013 for research purposes. Upon inspection, the storage roots showed typical symptoms of being infected by root-knot nematodes, Meloidogyne spp.; the incidence of infection was 95%. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 32 females on average (n = 20). The perineal patterns of most female specimens (n = 10) were oval shaped, with moderately high to high dorsal arch and mostly lacking obvious lateral lines. The second-stage juvenile had large and triangular lateral lips and broad, bluntly rounded tail tip. These morphological characteristics are similar to those reported in the original description of Meloidogyne enterolobii Yang & Eisenback (2). The 28S rRNA D2D3 expansion domain was amplified with primers MF/MR (GGGGATGTTTGAGGCAGATTTG/AACCGCTTCGGACTTCCACCAG) (1). The sequence obtained for this population (n = 5) of Meloidogyne sp. (GenBank Accession No. KF646797) was 100% identical to the sequence of M. enterolobii (JN005864). For further confirmation, M. incognita specific primers Mi-F/Mi-R (GTGAGGATTCAGCTCCCCAG/ACGAGGAACA TACTTCTCCGTCC), M. javanica specific primers Fjav/Rjav (GGTGCGCGATTGAACTGAGC/CAGGCCCTTCAGTGGAACTATAC), and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the respective DNA sequences (1). The electrophoresis results showed a bright band (~200 bp) only in the lane with the M. enterolobii specific primers. Therefore, this population of Meloidogyne sp. on sweet potato was identified as M. enterolobii based on its morphological and molecular characteristics. M. enterolobii has been reported to infect more than 20 plant species from six plant families: Fabaceae, Cucurbitaceae, Solanaceae, Myrtaceae, Annonaceae, and Marantaceae (1). To our knowledge, this is the first report of M. enterolobii on a member of the Convolvulaceae in China. Refrences: (1) M. X. Hu et al. Phytopathol. 101:1270, 2011. (2) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Download Full-text

First Report of Phytophthora drechsleri Associated with Stem and Foliar Blight of Gynura bicolor in Taiwan

Plant Disease ◽

10.1094/pdis-12-10-0931 ◽

2011 ◽

Vol 95 (7) ◽

pp. 874-874 ◽

Cited By ~ 1

Author(s):

Y. M. Shen ◽

C. H. Chao ◽

H. L. Liu

Keyword(s):

Disease Incidence ◽

Morphological Characteristics ◽

Hyphal Growth ◽

Pathogenicity Test ◽

Distilled Water ◽

First Report ◽

Foliar Blight ◽

Dual Cultures ◽

Phytophthora Drechsleri ◽

Gynura Bicolor

Gynura bicolor (Roxb. ex Willd.) DC., known as Okinawa spinach or hong-feng-cai, is a commonly consumed vegetable in Asian countries. In May 2010, plants with blight and wilt symptoms were observed in commercial vegetable farms in Changhua, Taiwan. Light brown-to-black blight lesions developed from the top of the stems to the petioles and extended to the base of the leaves. Severely infected plants declined and eventually died. Disease incidence was approximately 20%. Samples of symptomatic tissues were surface sterilized in 0.6% NaOCl and plated on water agar. A Phytophthora sp. was consistently isolated and further plated on 10% unclarified V8 juice agar, with daily radial growths of 7.6, 8.6, 5.7, and 2.4 mm at 25, 30, 35, and 37°C, respectively. Four replicates were measured for each temperature. No hyphal growth was observed at 39°C. Intercalary hyphal swellings and proliferating sporangia were produced in culture plates flooded with sterile distilled water. Sporangia were nonpapillate, obpyriform to ellipsoid, base tapered or rounded, and 43.3 (27.5 to 59.3) × 27.6 (18.5 to 36.3) μm. Clamydospores and oospores were not observed. Oospores were present in dual cultures with an isolate of P. nicotianae (p731) (1) A2 mating type, indicating that the isolate was heterothallic. A portion of the internal transcribed spacer sequence was deposited in GenBank (Accession No. HQ717146). The sequence was 99% identical to that of P. drechsleri SCRP232 (ATCC46724) (3), a type isolate of the species. The pathogen was identified as P. drechsleri Tucker based on temperature growth, morphological characteristics, and ITS sequence homology (3). To evaluate pathogenicity, the isolated P. drechsleri was inoculated on greenhouse-potted G. bicolor plants. Inoculum was obtained by grinding two dishes of the pathogen cultured on potato dextrose agar (PDA) with sterile distilled water in a blender. After filtering through a gauze layer, the filtrate was aliquoted to 240 ml. The inoculum (approximately 180 sporangia/ml) was sprayed on 24 plants of G. bicolor. An equal number of plants treated with sterile PDA processed in the same way served as controls. After 1 week, incubation at an average temperature of 29°C, blight and wilt symptoms similar to those observed in the fields appeared on 12 inoculated plants. The pathogen was reisolated from the lesions of diseased stems and leaves, fulfilling Koch's postulates. The controls remained symptomless. The pathogenicity test was repeated once with similar results. G. bicolor in Taiwan has been recorded to be infected by P. cryptogea (1,2), a species that resembles P. drechsleri. The recorded isolates of P. cryptogea did not have a maximal growth temperature at or above 35°C (1,2), a distinctive characteristic to discriminate between the two species (3). To our knowledge, this is the first report of P. drechsleri being associated with stem and foliar blight of G. bicolor. References: (1) P. J. Ann. Plant Pathol. Bull. 5:146, 1996. (2) H. H. Ho et al. The Genus Phytophthora in Taiwan. Institute of Botany, Academia Sinica, Taipei, 1995. (3) R. Mostowfizadeh-Ghalamfarsa et al. Fungal Biol. 114:325, 2010.

Download Full-text

First Report of Curvularia aeria on Etlingera linguiformis from Nagaland, India

Plant Disease ◽

10.1094/pdis-01-14-0060-pdn ◽

2014 ◽

Vol 98 (11) ◽

pp. 1580-1580 ◽

Cited By ~ 2

Author(s):

C. Kithan ◽

L. Daiho

Keyword(s):

Leaf Surface ◽

Agricultural Research ◽

Disease Incidence ◽

Indian Agricultural Research Institute ◽

Mountain Range ◽

Pathogenicity Test ◽

Distilled Water ◽

Conidial Suspension ◽

First Report ◽

Initial Symptoms

Etlingera linguiformis (Roxb.) R.M.Sm. of Zingiberaceae family is an important indigenous medicinal and aromatic plant of Nagaland, India, that grows well in warm climates with loamy soil rich in humus (1). The plant rhizome has medicinal benefits in treating sore throats, stomachache, rheumatism, and respiratory complaints, while its essential oil is used in perfumery. A severe disease incidence of leaf blight was observed on the foliar portion of E. linguiformis at the Patkai mountain range of northeast India in September 2012. Initial symptoms of the disease are small brown water soaked flecks appearing on the upper leaf surface with diameter ranging from 0.5 to 3 cm, which later coalesced to form dark brown lesions with a well-defined border. Lesions often merged to form large necrotic areas, covering more than 90% of the leaf surface, which contributed to plant death. The disease significantly reduces the number of functional leaves. As disease progresses, stems and rhizomes were also affected, reducing quality and yield. The diseased leaf tissues were surface sterilized with 0.2% sodium hypochlorite for 2 min followed by rinsing in sterile distilled water and transferred into potato dextrose agar (PDA) medium. After 3 days, the growing tips of the mycelium were transferred to PDA slants and incubated at 25 ± 2°C until conidia formation. Fungal colonies on PDA were dark gray to dark brown, usually zonate; stromata regularly and abundantly formed in culture. Conidia were straight to curved, ellipsoidal, 3-septate, rarely 4-septate, middle cells broad and darker than other two end cells, middle septum not median, smooth, 18 to 32 × 8 to 16 μm (mean 25.15 × 12.10 μm). Conidiophores were terminal and lateral on hyphae and stromata, simple or branched, straight or flexuous, often geniculate, septate, pale brown to brown, smooth, and up to 800 μm thick (2,3). Pathogen identification was performed by the Indian Type Culture Collection, Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi (ITCC Accession No. 7895.10). Further molecular identity of the pathogen was confirmed as Curvularia aeria by PCR amplification and sequencing of the internal transcribed spacer (ITS) regions of the ribosomal DNA by using primers ITS4 and ITS5 (4). The sequence was submitted to GenBank (Accession No. MTCC11875). BLAST analysis of the fungal sequence showed 100% nucleotide similarity with Cochliobolus lunatus and Curvularia aeria. Pathogenicity tests were performed by spraying with an aqueous conidial suspension (1 × 106 conidia /ml) on leaves of three healthy Etlingera plants. Three plants sprayed with sterile distilled water served as controls. The first foliar lesions developed on leaves 7 days after inoculation and after 10 to 12 days, 80% of the leaves were severely infected. Control plants remained healthy. The inoculated leaves developed similar blight symptoms to those observed on naturally infected leaves. C. aeria was re-isolated from the inoculated leaves, thus fulfilling Koch's postulates. The pathogenicity test was repeated twice. To our knowledge, this is the first report of the presence of C. aeria on E. linguiformis. References: (1) M. H. Arafat et al. Pharm. J. 16:33, 2013. (2) M. B. Ellis. Dematiaceous Hyphomycetes. CMI, Kew, Surrey, UK, 1971. (3) K. J. Martin and P. T. Rygiewicz. BMC Microbiol. 5:28, 2005. (4) C. V. Suberamanian. Proc. Indian Acad. Sci. 38:27, 1955.

Download Full-text

First report of Alternaria alternata causing leaf blight on little millet (Panicum sumatrense) in India.

Plant Disease ◽

10.1094/pdis-06-20-1373-pdn ◽

2020 ◽

Author(s):

Boda Praveen ◽

A. Nagaraja ◽

M. K. Prasanna Kumar ◽

Devanna Pramesh ◽

K. B. Palanna ◽

...

Keyword(s):

Crop Yields ◽

Disease Incidence ◽

Leaf Blight ◽

Post Inoculation ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Pcr Assay ◽

Causal Organism ◽

First Report ◽

Little Millet

Little millet (LM) is a minor cereal crop grown in the Indian sub-continent. During October 2018, dark brown, circular to oval necrotic spots surrounded by concentric rings were observed on the upper leaf surface of the LM (cv. VS-13) grown in the fields of the University of Agricultural Sciences, Bengaluru, India (13.0784oN, 77.5793oE). As the disease progressed, infected leaves became blighted. Disease incidence up to 53% was recorded in 3 fields of 0.4-hectare area each. Thirty symptomatic leaves were collected to isolate the associated causal organism. The margins of diseased tissue were cut into 5 × 5-mm pieces, surface-sterilized in 75% ethanol for 45 seconds followed by 1% sodium hypochlorite for 1 min, finally rinsed in sterile distilled water five times and placed on PDA. After 7 days of incubation at 25°C, greyish fungal colonies appeared on PDA. Single-spore isolations were performed to obtain ten isolates. Pure cultures of the fungus initially produced light gray aerial mycelia that later turned to dark grey. All isolates formed obclavate to pyriform conidia measured 22.66-48.97μm long and 6.55-13.79µm wide with 1-3 longitudinal and 2-7 transverse septa with a short beak (2.55-13.26µm) (n=50). Based on the conidial morphology, the fungus was identified as Alternaria sp. Further, the taxonomic identity of all ten isolates was confirmed as A. alternata using species-specific primers (AAF2/AAR3, Konstantinova et al. 2002) in a PCR assay. Later, one of the isolate UASB1 was selected, and its internal transcribed spacer (ITS) region, glyceraldehyde-3-phosphate dehydrogenase (gapdh), major allergen Alt a 1 (Alt a 1), major endo-polygalacturonase (endoPG), OPA10-2, and KOG1058 genes were amplified in PCR (White et al. 1990; Berbee et al. 1999; Woudenberg et al. 2015), and the resultant products were sequenced and deposited in the NCBI GenBank (ITS, MN919390; gapdh, MT637185; Alt a 1, MT882339; endoPG, MT882340; OPA10-2, MT882341; KOG1058, MT882342). Blastn analysis of ITS, gapdh, Alt a 1, endoPG, OPA10-2, KOG1058 gene sequences showed 99.62% (with AF347031), 97.36% (with AY278808), 99.58% (with AY563301), 99.10% (with JQ811978), 99.05% (with KP124632) and 99.23% (with KP125233) respectively, identity with reference strain CBS916.96 of A. alternata, confirming UASB1 isolate to be A. alternata. For pathogenicity assay, conidial suspension of UASB1 isolate was spray inoculated to ten healthy LM (cv. VS-13) plants (45 days old) maintained under protected conditions. The spore suspension was sprayed until runoff on healthy leaves, and ten healthy plants sprayed with sterile water served as controls. Later, all inoculated and control plants were covered with transparent polyethylene bags and were maintained in a greenhouse at 28±2 ◦C and 90% RH. The pathogenicity test was repeated three times. After 8 days post-inoculation, inoculated plants showed leaf blight symptoms as observed in the field, whereas no disease symptoms were observed on non-inoculated plants. Re-isolations were performed from inoculated plants, and the re-isolated pathogen was confirmed as A. alternata based on morphological and PCR assay (Konstantinova et al. 2002). No pathogens were isolated from control plants. There is an increasing acreage of LM crop in India, and this first report indicates the need for further studies on leaf blight management and the disease impacts on crop yields.

Download Full-text

First Report of Nigrospora osmanthi Causing Leaf Spot on Tartary Buckwheat in China

Plant Disease ◽

10.1094/pdis-08-20-1773-pdn ◽

2020 ◽

Author(s):

Quan Shen ◽

Xixu Peng ◽

Feng He ◽

Shaoqing Li ◽

Zuyin Xiao ◽

...

Keyword(s):

Relative Humidity ◽

Leaf Spot ◽

Plant Pathogens ◽

Hunan Province ◽

Tartary Buckwheat ◽

Tween 20 ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Sterile Water ◽

First Report

Buckwheat (Fagopyrum tataricum) is a traditional short-season pseudocereal crop originating in southwest China and is cultivated around the world. Antioxidative substances in buckwheat have been shown to provide many potential cardiovascular health benefits. Between August and November in 2019, a leaf spot was found in several Tartary buckwheat cv. Pinku1 fields in Xiangxiang County, Hunan Province, China. The disease occurred throughout the growth cycle of buckwheat after leaves emerged, and disease incidence was approximately 50 to 60%. Initially infected leaves developed a few round lesions, light yellow to light brown spots. Several days later, lesions began to enlarge with reddish brown borders, and eventually withered and fell off. Thirty lesions (2×2 mm) collected from three locations with ten leaves in each location were sterilized in 70% ethanol for 10 sec, in 2% sodium hypochlorite for 30 sec, rinsed in sterile water for three times, dried on sterilized filter paper, and placed on a potato dextrose PDA with lactic acid (3 ml/L), and incubated at 28°C in the dark for 3 to 5 days. Fungal colonies were initially white and later turned black with the onset ofsporulation. Conidia were single-celled, black, smooth, spherical to subspherical, and measured 9.2 to 15.6 µm long, and 7.1 to 11.6 µm wide (n=30). Each conidium was terminal and borne on a hyaline vesicle at the tip of conidiophores. Morphologically, the fungus was identified as Nigrospora osmanthi (Wang et al. 2017). Identification was confirmed by amplifying and sequencing the ITS region, and translation elongation factor 1-alpha (TEF1-α) and partial beta-tublin (TUB2) genes using primers ITS1/ITS4 (Mills et al. 1992), EF1-728F/EF-2 (Carbone and Kohn 1999; O’Donnell et al. 1998) and Bt-2a/Bt-2b (Glass et al. 1995), respectively. BLAST searches in GenBank indicated the ITS (MT860338), TUB2 (MT882054) and TEF1-α (MT882055) sequences had 99.80%, 99% and 100% similarity to sequences KX986010.1, KY019461.1 and KY019421.1 of Nigrospora osmanthi ex-type strain CGMCC 3.18126, respectively. A neighbor-joining phylogenetic tree constructed using MEGA7.0 with 1,000 bootstraps based on the concatenated nucleotide sequences of the three genes indicated that our isolate was closely related to N. osmanthi. Pathogenicity test was performed using leaves of healthy F. tataricum plants. The conidial suspension (1 × 106 conidia/ml) collected from PDA cultures with 0.05% Tween 20 buffer was used for inoculation by spraying leaves of potted 20-day-old Tartary buckwheat cv. Pinku1. Five leaves of each plant were inoculated with spore suspensions (1 ml per leaf). An equal number of control leaves were sprayed with sterile water to serve as a control. The treated plants were kept in a greenhouse at 28°C and 80% relative humidity for 24 h, and then transferred to natural conditions with temperature ranging from 22 to 30°C and relative humidity ranging from 50 to 60%. Five days later, all N. osmanthi-inoculated leaves developed leaf spot symptoms similar to those observed in the field, whereas control leaves remained healthy. N. osmanthi was re-isolated from twelve infected leaves with frequency of 100%, fulfilling Koch’s postulates. The genus Nigrospora has been regarded by many scholars as plant pathogens (Fukushima et al. 1998) and N. osmanthi is a known leaf blight pathogen for Stenotaphrum secundatum (Mei et al. 2019) and Ficus pandurata (Liu et al. 2019) but has not been reported on F. tataricum. Nigrospora sphaerica was also detected in vegetative buds of healthy Fagopyrum esculentum Moench (Jain et al. 2012). To our knowledge, this is the first report of N. osmanthi causing leaf spot on F. tataricum in China and worldwide. Appropriate strategies should be developed to manage this disease.

Download Full-text

First Report of Colletotrichum siamense Causing Anthracnose of Monstera deliciosa in Zhanjiang, China

Plant Disease ◽

10.1094/pdis-08-20-1839-pdn ◽

2020 ◽

Author(s):

Yue Lian Liu ◽

Jian Rong Tang ◽

Yu Han Zhou

Keyword(s):

Disease Incidence ◽

Morphological Characteristics ◽

Pathogenicity Test ◽

Sterile Water ◽

Single Spore ◽

First Report ◽

Rdna Its ◽

Colletotrichum Siamense ◽

Monstera Deliciosa ◽

Pure Cultures

Monstera deliciosa Liebm is an ornamental foliage plant (Zhen et al. 2020De Lojo and De Benedetto 2014). In July of 2019, anthracnose lesions were observed on leaves of M. deliciosa cv. Duokong with 20% disease incidence of 100 plants at Guangdong Ocean University campus (21.17N,110.18E), Guangdong Province, China. Initially affected leaves showed chlorotic spots, which coalesced into larger irregular or circular lesions. The centers of spots were gray with a brown border surrounded by a yellow halo (Supplementary figure 1). Twenty diseased leaves were collected for pathogen isolation. Margins of diseased tissue was cut into 2 × 2 mm pieces, surface-disinfected with 75% ethanol for 30 s and 2% sodium hypochlorite (NaOCl) for 60 s, rinsed three times with sterile water before isolation. Potato dextrose agar (PDA) was used to culture pathogens at 28℃ in dark. Successively, pure cultures were obtained by transferring hyphal tips to new PDA plates. Fourteen isolates were obtained from 20 leaves. Three single-spore isolates (PSC-1, PSC-2, and PSC-3) were obtained ,obtained, which were identical in morphology and molecular analysis (ITS). Therefore, the representative isolate PSC-1 was used for further study. The culture of isolate PSC-1 on PDA was initially white and later became cottony, light gray in 4 days, at 28 °C. Conidia were single celled, hyaline, cylindrical, clavate, and measured 13.2 to 18.3 µm × 3.3 to 6.5 µm (n = 30). Appressoria were elliptical or subglobose, dark brown, and ranged from 6.3 to 9.5 µm × 5.7 to 6.5 µm (n = 30). Morphological characteristics of isolate PSC-1 were consistent with the description of Colletotrichum siamense (Prihastuti et al. 2009; Sharma et al. 2013). DNA of the isolate PSC-1 was extracted for PCR sequencing using primers for the rDNA ITS (ITS1/ITS4), GAPDH (GDF1/GDR1), ACT (ACT-512F/ACT-783R), CAL (CL1C/CL2C), and TUB2 (βT2a/βT2b) (Weir et al. 2012). Analysis of the ITS (accession no. MN243535), GAPDH (MN243538), ACT (MN512640), CAL (MT163731), and TUB2 (MN512643) sequences revealed a 97-100% identity with the corresponding ITS (JX010161), GAPDH (JX010002), ACT (FJ907423), CAL (JX009714) and TUB2 (KP703502) sequences of C. siamense in GenBank. A phylogenetic tree was generated based on the concatenated sequences of ITS, GAPDH, ACT, CAL, and TUB2 which clustered the isolate PSC-1 with C. siamense the type strain ICMP 18578 (Supplementary figure 2). Based on morphological characteristics and phylogenetic analysis, the isolate PSC-1 associated with anthracnose of M. deliciosa was identified as C. siamense. Pathogenicity test was performed in a greenhouse at 24 to 30oC with 80% relative humidity. Ten healthy plants of cv. Duokong (3-month-old) were grown in pots with one plant in each pot. Five plants were inoculated by spraying a spore suspension (105 spores ml-1) of the isolate PSC-1 onto leaves until runoff, and five plants were sprayed with sterile water as controls. The test was conducted three times. Anthracnose lesions as earlier were observed on the leaves after two weeks, whereas control plants remained symptomless. The pathogen re-isolated from all inoculated leaves was identical to the isolate PSC-1 by morphology and ITS analysis, but not from control plants. C. gloeosporioides has been reported to cause anthracnose of M. deliciosa (Katakam, et al. 2017). To the best of our knowledge, this is the first report of C. siamense causing anthracnose on M. deliciosa in ChinaC. siamense causes anthracnose on a variety of plant hosts, but not including M. deliciosa (Yanan, et al. 2019). To the best of our knowledge, this is the first report of C. siamense causing anthracnose on M. deliciosa, which provides a basis for focusing on the management of the disease in future.

Download Full-text

First Report of Tomato spotted wilt virus on Chrysanthemum in Serbia

Plant Disease ◽

10.1094/pdis-08-12-0778-pdn ◽

2013 ◽

Vol 97 (1) ◽

pp. 150-150 ◽

Cited By ~ 7

Author(s):

I. Stanković ◽

A. Bulajić ◽

A. Vučurović ◽

D. Ristić ◽

K. Milojević ◽

...

Keyword(s):

Tomato Spotted Wilt Virus ◽

Disease Incidence ◽

N Gene ◽

Impatiens Necrotic Spot Virus ◽

Maximum Parsimony Tree ◽

Rt Pcr ◽

First Report ◽

Tomato Spotted Wilt ◽

Negative Controls ◽

Wilt Virus

In July 2011, greenhouse-grown chrysanthemum hybrid plants (Chrysanthemum × morifolium) with symptoms resembling those associated with tospoviruses were observed in the Kupusina locality (West Bačka District, Serbia). Disease incidence was estimated at 40%. Symptomatic plants with chlorotic ring spots and line patterns were sampled and tested by double antibody sandwich (DAS)-ELISA using polyclonal antisera (Bioreba AG, Reinach, Switzerland) against the two of the most devastating tospoviruses in the greenhouse floriculture industry: Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) (2). Commercial positive and negative controls and extracts from healthy chrysanthemum tissue were included in each ELISA. TSWV was detected serologically in 16 of 20 chrysanthemum samples and all tested samples were negative for INSV. The virus was mechanically transmitted from ELISA-positive chrysanthemum samples to five plants each of both Petunia × hybrida and Nicotiana tabacum ‘Samsun’ using chilled 0.01 M phosphate buffer (pH 7) containing 0.1% sodium sulfite. Inoculated plants produced local necrotic spots and systemic chlorotic/necrotic concentric rings, consistent with symptoms caused by TSWV (1). The presence of TSWV in ELISA-positive chrysanthemum plants and N. tabacum‘Samsun’ was further confirmed by conventional reverse transcription (RT)-PCR. Total RNAs were extracted with an RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). RT-PCR was performed with the One-Step RT-PCR Kit (Qiagen) using primers TSWVCP-f/TSWVCP-r specific to the nucleocapsid protein (N) gene (4). A Serbian isolate of TSWV from tobacco (GenBank Accession No. GQ373173) and RNA extracted from a healthy chrysanthemum plant were used as positive and negative controls, respectively. An amplicon of the correct predicted size (738-bp) was obtained from each of the plants assayed, and that derived from chrysanthemum isolate 529-11 was purified (QIAqick PCR Purification Kit, Qiagen) and sequenced (JQ692106). Sequence analysis of the partial N gene, conducted with MEGA5 software, revealed the highest nucleotide identity of 99.6% (99% amino acid identity) with 12 TSWV isolates deposited in GenBank originating from different hosts from Italy (HQ830186-87, DQ431237-38, DQ398945), Montenegro (GU355939-40, GU339506, GU339508), France (FR693055-56), and the Czech Republic (AJ296599). The consensus maximum parsimony tree obtained on a 705-bp partial N gene sequence of TSWV isolates available in GenBank revealed that Serbian TSWV isolate 529-11 from chrysanthemum was clustered in the European subpopulation 2, while the Serbian isolates from tomato (GU369723) and tobacco (GQ373172-73 and GQ355467) were clustered in the European subpopulation 1 denoted previously (3). The distribution of TSWV in commercial chrysanthemum crops is wide (2). To our knowledge, this is the first report of TSWV infecting chrysanthemum in Serbia. Since chrysanthemum popularity and returns have been rising rapidly, the presence of TSWV may significantly reduce quality of crops in Serbia. References: (1) Anonymous. OEPP/EPPO Bull. 34:271, 2004. (2) Daughtrey et al. Plant Dis. 81:1220, 1997. (3) I. Stanković et al. Acta Virol. 55:337, 2011. (4) A. Vučurović et al. Eur. J. Plant Pathol. 133:935, 2012.

Download Full-text

First Report of Bacterial Wilt Caused by Ralstonia solanacearum on Plectranthus amboinicus in Martinique

Plant Disease ◽

10.1094/pdis-12-20-2622-pdn ◽

2021 ◽

Author(s):

Peninna Deberdt ◽

Gilles Cellier ◽

Régine Coranson-Beaudu ◽

Mathis Delmonteil--Girerd ◽

Joanye Canguio ◽

...

Keyword(s):

Bacterial Wilt ◽

Ralstonia Solanacearum ◽

Disease Incidence ◽

Bacterial Suspension ◽

Diagnostic Pcr ◽

Tomato Plants ◽

First Report ◽

Initial Symptoms ◽

Plectranthus Amboinicus ◽

Negative Controls

Plectranthus amboinicus, commonly known as Gwo ten in the French West Indies (Martinique), is a semi-succulent perennial plant of the Lamiaceae family. This aromatic plant wich is widespread naturally throughout the tropics is of economic importance because of the therapeutic and nutritional properties attributed to its natural phytochemical compounds wich are highly valued in the pharmaceutical industry. In March 2019, wilted P. amboinicus plants intercropped with tomato plants (cv. Heatmaster) in order to reduce the insect-pest damages on tomato, were observed in a field located at the CIRAD experimental station in Lamentin, Martinique (14.663194 N, -60.999167 W). Average disease incidence of 65.74% was recorded on P. amboinicus, in 3 plots with an area of 22.04 m2. The initial symptoms observed were irregular, black, necrotic lesions on leaves. After 10 days, plants wilted and black stripes were observed on stems. Within 4 weeks, more than 50% of plants were fully wilted. Longitudinal stem sections of the wilted plants showed brown vascular discoloration. The cut stems of the wilted plants released a whitish bacterial ooze in water. In all, 108 stem sections were collected, surface disinfected with 70% ethanol and each was crushed in 2 mL of Tris-buffer, then processed for bacterial isolation by plating on modified Semi-Selective Medium from South Africa SMSA (Engelbrecht 1994). Typical Ralstonia solanacearum colonies grew on SMSA medium for 100 of the 108 samples after incubation for 48h at 28°C and were identified as Ralstonia solanacearum using diagnostic PCR with 759/760 primers (Opina et al. 1997). A phylotype-specific multiplex PCR (Fegan and Prior 2005) classified all the strains in R. solanacearum Phylotype IIA. A subset of 11 strains was selected for sequevar identification. All the strains were identified as sequevar I-39 (100% nucleotide identity with strain ANT92 - Genbank accession EF371828), by partial egl sequencing (Fegan and Prior 2005) (GenBank Accession Nos. MT314067 to MT314077). This sequevar has been reported to be widespread in the Caribbean and tropical America on vegetable crops (particularly on tomato), but not on P. amboinicus (Deberdt et al. 2014; Ramsubhag et al. 2012; Wicker et al. 2007). To fulfil Koch’s postulates, a reference strain, isolated from diseased P. amboinicus (CFBP 8733, Phylotype IIA/sequevar 39), was inoculated on 30 healthy P. amboinicus plants. A common tomato cultivar grown in Martinique (cv. Heatmaster) was also inoculated on 30 plants with the same bacterial suspension. Three-weeks-old plants of both crops grown in sterilized field soil were inoculated by soil drenching with 20 ml of a calibrated suspension (108 CFU/mL). P. amboinicus and tomato plants drenched with sterile water served as a negative controls. Plants were grown in a fully controlled environment at day/night temperatures of 30–26°C ± 2°C under high relative humidity (80%). The P. amboinicus plants started wilting 9 days after inoculation, and within four weeks 60% of the P. amboinicus plants had wilted. The tomato plants started wilting 5 days after inoculation with 62% of wilted plants within four weeks. R. solanacearum was recovered from all symptomatic plants on modified SMSA medium. No symptoms were observed and no R. solanacearum strains were isolated from negative controls plants. To our knowledge, this is the first report of R. solanacearum causing bacterial wilt on Gwo ten (P. amboinicus) in Martinique. The importance of this discovery lies in the reporting of an additional host for R. solanacearum, which can be associated with other crops as tomato crop in order to reduce the abundance of insect-pests. Further studies need to be conducted to assess the precise distribution of bacterial wilt disease on P. amboinicus in Martinique and to develop a plan of action avoiding its association with R. solanacearum host crops as tomato for reducing epidemic risk.

Download Full-text

First Report of Web Blight on Oregano (Origanum vulgare L.) Caused by Rhizoctonia solani AG-1-IB in Italy

Plant Disease ◽

10.1094/pdis-02-13-0138-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1119-1119 ◽

Cited By ~ 2

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

P. Pensa ◽

A. Poli ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Morphological Identification ◽

Pathogenicity Test ◽

Origanum Vulgare ◽

First Report ◽

Plastic Bags ◽

Hyphal Diameter

Origanum vulgare L., common name oregano, family Labiatae, is grown for its aromatic and medicinal properties and as ornamental. In the fall of 2012, a blight was observed in a farm located near Albenga (northern Italy) on 6% of 30,000 50-day-old plants, grown in trays in a peat/perlite mix. Semicircular, water soaked lesions appeared on leaves and stems, starting from the basal ones. As the disease progressed, blighted leaves turned brown, withered, clung to the shoots, and matted on the surrounding foliage. Eventually, infected plants died. Leaf and stem fragments taken from the margin of the diseased tissues belonging to 10 plants were disinfected for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA). A fungus with the morphological characters of Rhizoctonia solani was consistently recovered. Three isolates of R. solani obtained from affected plants were successfully anastomosed with R. solani isolate AG 1 (ATCC 58946). Three pairings were made for each tester strain. The hyphal diameter at the point of anastomosis was reduced, the anastomosis point was obvious, and death of adjacent cells was observed. Results were consistent with other reports on anastomosis reactions (2). Isolates from oregano were paired with R. solani isolates AG 2, 3, 4, 6, 7, or 11 and examined microscopically. Anastomosis was not observed in any of the pairings. Tests were conducted twice. Mycelium of 10-day-old isolates from oregano appeared reddish brown, coarse, and radiate. Numerous dark brown sclerotia, 0.3 to 1.0 mm diameter (average 0.7) developed within 10 days after transfer of mycelia to PDA in 90 mm diameter petri dishes at 21 to 24°C. The descriptions of mycelium and sclerotia were typical for subgroup IB Type 1 (4). The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS1/ITS4 and sequenced. BLASTn analysis (1) of the 538 bp showed a 99% homology with the sequence of R. solani FJ746937, confirming the morphological identification of the species. The nucleotide sequence has been assigned the GenBank Accession KC493638. For pathogenicity tests, one of the isolates assigned to the anastomosis group AG-1-IB was tested by placing 9 mm diameter mycelial disks removed from PDA 10-day-old cultures of the fungus on leaves of 90-day-old oregano plants (n = 35). Thirty-five plants inoculated with non-inoculated PDA disks served as controls. Plants were covered with plastic bags and maintained in a growth chamber at 25 ± 1°C with 12 h light/dark. The first symptoms, similar to those observed in the farm, developed 3 days after inoculation. Nine days after the artificial inoculation, 50% of plants were dead. About 10 colonies of R. solani were reisolated from infected leaves of inoculated plants. Control plants remained healthy. The pathogenicity test was carried out twice with similar results. Symptoms caused by R. solani have been recently observed on O. vulgare in Greece (3). This is, to our knowledge, the first report of blight of O. vulgare caused by R. solani in Italy. References: (1) S. F. Altschul et al. Nucleic Acids Res., 25:3389, 1997. (2) D. E. Carling. Grouping in Rhizoctonia solani by hyphal anastomosis reactions. In: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease control. Kluwer Academic Publishers, The Netherlands, pp. 37-47, 1996. (3) C. D. Holevas et al. Benaki Phytopathol. Inst., Kiphissia, Athens, 19:1-96, 2000. (4) R. T. Sherwood. Phytopathology 59:1924, 1969.

Download Full-text