First report of cucurbit chlorotic yellows virus infecting watermelon and zucchini in the Canary Islands, Spain

In July 2019, eleven watermelon (Citrullus lanatus) plants, six ‘Augusta negra’ and five ‘Kasmira’, and seven zucchini (Cucurbita pepo) ‘Marcado’ plants showing yellowing and vein clearing on the leaves were collected in Arico, in Tenerife Island of the Canary Islands. Analysis with enzyme-linked immunosorbent assay (ELISA) with polyclonal antibodies using kits from (LOEWE® Biochemica GmbH, Sauerlach, Germany) detected cucurbit chlorotic yellows virus (CCYV) in four watermelon (two ‘Augusta negra’ and two ‘Kasmira’) plants and one zucchini plant. Reverse transcription-polymerase chain reaction (RT-PCR) with primers CCYV-CPs (5'-ATGGAGAAGACTGACAATAAACAA-3’) and CCYV-CPas (5'-TTTACTACAACCTCCCGGTG-3’) (Hamed et al. 2011) yielded 750 bp DNA fragments, which were purified, and directly sequenced by Sanger sequencing. The four CCYV sequences obtained from watermelon plants were identical and showed a 99.6% nucleotide identity with the CCYV isolate from Zucchini. The nucleotide sequences of CCYV isolates 351/19 from watermelon and 361/19 from zucchini were deposited in GenBank under accessions OK562588 and OK562589, respectively. BLASTn analysis showed high nucleotide identity, greater than 99 % with most worldwide CCYV isolates (AB523789, HM581658, JF502222, JF807053, JN126045-6, JQ904629, JX014262, KC990503-5, KC990507, KJ735450, KJ149806, KT946809, KT946816, KU507602, KX118632, KY400632-4, KY618799, LT716000, LT716003-4, MH477612, MH806868, MH819191, MN529560, MN815012-3, MT396249 MT048669, MW033301, MW584337, MW251342, MW521380, MW521381, MW584335-6, MW629380, MZ325848-9 and MZ405664), about 98% with two Saudi Arabian isolates (KT946810 and KT946815) and about 95 % with three Iranian isolates (KC577201-3). These genetic relationships were confirmed with a phylogenetic tree (Supplementary Fig. 1) inferred with the maximum likelihood method with 500 bootstrap replicates and the nucleotide substitution model HKY+G implemented in the program MEGA-X (Kumar et al., 2018). There is no correlation between geographic distance and genetic distance. CCYV is related to viruses in the genus Crinivirus, family Closteroviridae (Okuda et al., 2010). It is widespread and causes high economic losses (yield reduction and unmarketable fruits) in cucurbit crops from East Asia: Japan, China, Taiwan and South Korea; North America (the USA states of California, Texas, Georgia and Alabama); Middle East: Sudan, Saudi Arabia and Iran; and the Mediterranean basin: Egypt, Israel, Lebanon, Turkey, Greece, Algeria and peninsular Spain (Kheireddine et al., 2020; Chynoweth et al., 2021; Jailani, et al., 2021; Kwak et al., 2021). This is the first report of CCYV infecting cucurbits in the Canary Islands. The emergence of this virus poses a threat to the cucurbit crops in the Canary Islands and requires control measures to prevent its spread in Tenerife and the other Canary Islands.

Download Full-text

First Report of Cucurbit aphid-borne yellows virus in Iran Causing Yellows on Four Cucurbit Crops

Plant Disease ◽

10.1094/pd-90-0526a ◽

2006 ◽

Vol 90 (4) ◽

pp. 526-526 ◽

Cited By ~ 7

Author(s):

K. Bananej ◽

C. Desbiez ◽

C. Wipf-Scheibel ◽

I. Vahdat ◽

A. Kheyr-Pour ◽

...

Keyword(s):

Citrullus Lanatus ◽

Healthy Plant ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

First Report ◽

Chain Reactions ◽

Reference Isolate ◽

Sigma Chemical ◽

International Mycological Institute ◽

Das Elisa

A survey was conducted from 2001 to 2004 in the major cucurbit-growing areas in Iran to reassess the relative incidence of cucurbit viruses. Severe yellowing symptoms were observed frequently on older leaves of cucurbit plants in various regions in outdoor crops, suggesting the presence of Cucurbit aphid-borne yellows virus (CABYV, genus Polerovirus, family Luteoviridae) (1,2). Leaf samples (n = 1019) were collected from plants of melon (Cucumis melo L.), cucumber (C. sativus L.), squash (Cucurbita sp.), and watermelon (Citrullus lanatus L.) showing various virus-like symptoms (mosaic, leaf deformation, yellowing). All samples, collected from 15 provinces, were screened for the presence of CABYV by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) with IgGs and alkaline phosphatase-conjugated IgGs against a CABYV reference isolate (1). Of the 1,019 samples tested, 471 were positive for CABYV using DAS-ELISA. Some of the positive samples had typical severe yellowing symptoms while symptoms in other samples were masked by mosaic or leaf deformations caused by other viruses frequently found in mixed infections (data not shown). During the entire survey, CABYV was detected by DAS-ELISA in 201 of 503 melon samples, 72 of 129 cucumber samples, 158 of 249 squash samples, and 40 of 138 watermelon samples. These results indicate that CABYV is widely distributed on four cucurbit species in the major growing areas of Iran. In order to confirm CABYV identification, total RNA extracts (TRI-Reagent, Sigma Chemical, St Louis, MO) were obtained from 25 samples that were positive using DAS-ELISA originating from Khorasan (n = 4), Esfahan (n = 6), Teheran (n = 3), Hormozgan (n = 4), Azerbaiejan-E-Sharqi (n = 4), and Kerman (n = 4). Reverse transcription-polymerase chain reactions (RT-PCR) were carried out using forward (5′-CGCGTGGTTGTGG-TCAACCC-3′) and reverse (5′-CCYGCAACCGAGGAAGATCC-3′) primers designed in conserved regions of the coat protein gene according to the sequence of a CABYV reference isolate (3) and three other unpublished CABYV sequences. RT-PCR experiments yielded an expected 479-bp product similar to the fragment amplified with extracts from the reference isolate. No amplification of the product occurred from healthy plant extracts. To our knowledge, this is the first report of the occurrence of CABYV in Iran on various cucurbit species. The high frequency (46.2%) with which CABYV was detected in the samples assayed indicates that this virus is one of the most common virus infecting cucurbits in Iran. References: (1) H. Lecoq et al. Plant Pathol. 41:749, 1992 (2) M. A. Mayo and C. J. D'Arcy. Page 15 in: The Luteoviridae. H. G. Smith and H. Barker, eds. CAB International Mycological Institute, Wallingford, UK, 1999. (3) H. Guilley et al. Virology 202:1012, 1994.

Download Full-text

Serological survey of antibodies to Toxoplasma gondii and Coxiella burnetii in rodents in north-western African islands (Canary Islands and Cape Verde)

Onderstepoort Journal of Veterinary Research ◽

10.4102/ojvr.v82i1.899 ◽

2015 ◽

Vol 82 (1) ◽

Cited By ~ 8

Author(s):

Pilar Foronda ◽

Josué Plata-Luis ◽

Borja Del Castillo-Figueruelo ◽

Ángela Fernández-Álvarez ◽

Aarón Martín-Alonso ◽

...

Keyword(s):

Toxoplasma Gondii ◽

Coxiella Burnetii ◽

Canary Islands ◽

Q Fever ◽

Rattus Rattus ◽

Cape Verde ◽

Farm Animals ◽

Economic Losses ◽

Enzyme Linked Immunosorbent Assay ◽

North Western

Coxiella burnetii and Toxoplasma gondii are intracellular parasites that cause important reproductive disorders in animals and humans worldwide, resulting in high economic losses. The aim of the present study was to analyse the possible role of peridomestic small mammals in the maintenance and transmission of C. burnetii and T. gondii in the north-western African archipelagos of the Canary Islands and Cape Verde, where these species are commonly found affecting humans and farm animals. Between 2009 and 2013, 108 black rats (Rattus rattus) and 77 mice (Mus musculus) were analysed for the presence of Coxiella and Toxoplasma antibodies by enzyme-linked immunosorbent assay (ELISA) and indirect immunofluorescence (IFA), respectively. Our results showed a wide distribution of C. burnetii and T. gondii, except for T. gondii in Cape Verde, in both rodent species. The overall seroprevalence of C. burnetii antibodies was 12.4%; 21.1% for Cape Verde and 10.2% for the Canary Islands. With respect to T. gondii, seropositive rodents were only observed in the Canary Islands, with an overall seroprevalence of 15%. Considering the fact that both pathogens can infect a large range of hosts, including livestock and humans, the results are of public health and veterinary importance and could be used by governmental entities to manage risk factors and to prevent future cases of Q fever and toxoplasmosis.

Download Full-text

First Report of Pepino mosaic virus on Tomato in Spain

Plant Disease ◽

10.1094/pdis.2001.85.12.1292c ◽

2001 ◽

Vol 85 (12) ◽

pp. 1292-1292 ◽

Cited By ~ 5

Author(s):

C. Jordá ◽

A. Lázaro Pérez ◽

P. Martínez-Culebras ◽

P. Abad ◽

A. Lacasa ◽

...

Keyword(s):

Mosaic Virus ◽

Canary Islands ◽

Plant Protection ◽

Polyclonal Antibodies ◽

Datura Stramonium ◽

Enzyme Linked Immunosorbent Assay ◽

Chenopodium Amaranticolor ◽

Pepino Mosaic Virus ◽

Tomato Plants ◽

First Report

At the beginning of 2000, a damaging disease developed on protected tomato (Lycopersicon esculentum) crops grown in polyethylene greenhouses in different regions of Spain. Production losses were estimated at 15 to 80%. The tomato plants showed a variety of symptoms. The most common symptoms were leaf distortion, chlorosis, and mosaic. Some plants showed a dark green mosaic and bubbling of the leaf surface. Green striations were also observed on the stem and sepals. Most of the diseased plants had discolored fruits. Symptoms decreased as environmental temperature increased. The involvement of Pepino mosaic virus (PepMV) was suspected. To identify the etiological agent, ≈500 symptomatic tomato plants were collected from several locations in Alicante, Murcia, Almeria and the Canary Islands. Flexuous viral particles 510 nm long were observed by transmission electron microscopy, suggesting the presence of a potexvirus in the tissue extracts analyzed. All samples were tested by ELISA (enzyme-linked immunosorbent assay), using polyclonal antibodies to Narcissus mosaic virus (Adgen, Auchincriuve, Scotland), a virus serologically related to PepMV, and two antisera specific to PepMV (Adgen, Scotland and DMSZ, Braunschweig, Germany). PepMV was detected in 35% of the samples. Like PepMV, the virus infected (as confirmed by ELISA) greenhouse-grown Datura stramonium, Nicandra physalodes, Nicotiana benthamiana, N. clevelandii, Solanum tuberosum, and Vigna sinensis and did not infect Capsicum anuum, Cucumis sativus, Chenopodium amaranticolor, C. quinoa, Petunia × hybrida, Phaseolus vulgaris, Physalis floridana, N. glutinosa, N. rustica, or N. tabacum. The virus did infect Gomphrena globosa, which normally is not infected by PepMV. The first report of PepMV was on pepino (Solanum muricatum) in Peru in 1974 (1), but this virus has been recently reported in the Netherlands, England, Germany, and France on protected tomato crops (2). To our knowledge, this is the first report of PepMV in Spain, including the Canary Islands. References: (1) R. A. C. Jones et al. Ann. Appl. Biol. 94:61, 1980. (2) European and Mediterranean Plant Protection Organisation (EPPO). Alert List Viruses. On-line publication/2000/003.

Download Full-text

First Report of Cucurbit chlorotic yellows virus Infecting Cucurbits in Taiwan

Plant Disease ◽

10.1094/pdis-94-9-1168b ◽

2010 ◽

Vol 94 (9) ◽

pp. 1168-1168 ◽

Cited By ~ 33

Author(s):

L.-H. Huang ◽

H.-H. Tseng ◽

J.-T. Li ◽

T.-C. Chen

Keyword(s):

Citrullus Lanatus ◽

Bottle Gourd ◽

Insect Vector ◽

Silverleaf Whitefly ◽

Rt Pcr ◽

Specific Primers ◽

Total Rna ◽

First Report ◽

Dna Fragment ◽

Cucurbit Chlorotic Yellows Virus

In April 2009, chlorosis, yellows, and bleaching accompanied with green veins and brittleness on the lower leaves of cantaloupe (Cucumis melo L.) were observed in Lunbei Township, Yunlin County, Taiwan. The same symptoms were also found on cucumber (Cucumis sativus L.), pumpkin (Cucurbita moschata Duchesne), watermelon (Citrullus lanatus (Thunb.) Matsum. & Nakai), bottle gourd (Lagenaria siceraria (Molina) Standl.), and oriental pickling melon planted in other areas of Yunlin and Changhua counties in central Taiwan. Large populations of whiteflies were observed in association with the diseased cucurbit crops, and they were further identified as silverleaf whitefly (Bemisia argentifolii Bellows & Perring) by PCR with specific primers BaBF (5′-CCACTATAATTATTGCTGTTCCCACA-3′) and l2-N-3014R (5′-TCCAATGCACTAATCTGCCATATTA-3′) (3). In June 2009, samples from symptomatic cantaloupe were collected for virus diagnosis. Flexuous filamentous virions of 700 to 900 nm were observed in crude sap of the symptomatic cantaloupe tissues with transmission electron microscopy. On the basis of the suspected insect vector, symptomology, and virus morphology, a Crinivirus species was suspected as the causal agent. A nested reverse transcription (RT)-PCR assay with degenerate deoxyinosine-containing primers developed for detection of Closterovirus and Crinivirus (1) was conducted. Total RNAs extracted from 16 symptomatic cantaloupe samples with a Plant Total RNA Miniprep Purification Kit (Hopegen, Taichung, Taiwan) were analyzed, and a 0.5-kb DNA fragment was amplified from eight of them. The PCR products were sequenced and the sequences were identical among samples. A comparison of the submitted sequence (Accession No. HM120250) with those in GenBank showed that the sequence was identical to the Hsp70h sequences of Cucurbit chlorotic yellows virus (CCYV) isolates from Japan (Accession No. AB523789) (4) and China (Accession Nos. GU721105, GU721108, and GU721110). To identify CCYV infection in the field, the specific primers, Crini-hsp70-f (5′-GCCATAACCATTACGGGAGA-3′) and Crini-hsp70-r (5′-CGCAGTGAAAAACCCAAACT-3′), that amplify a 389-bp DNA fragment corresponding to the nucleotide 1,324 to 1,712 of RNA2 of the original CCYV Japan isolate (Accession No. AB523789) were designed for detection of CCYV. In RT-PCR analyses, CCYV was identified in cantaloupe (305 of 599 samples), watermelon (27 of 93 samples), cucumber (all 15 samples), melon (82 of 92 samples), pumpkin (8 of 10 samples), and bottle gourd (10 of 17 samples) showing chlorosis and yellowing. The 389-bp DNA fragment was also amplified by RT-PCR with the primer pair Crini-hsp70-f/Crini-hsp70-r from total RNA extracts of 29 of 116 silverleaf whitefly individuals collected from the diseased cantaloupe fields in Lunbei Township from August to October, 2009. CCYV is a newly characterized Crinivirus species, first discovered in Japan in 2004 (2) and also found in China in 2009. To our knowledge, this is the first report that CCYV is emerging as a threat to cucurbit productions in Taiwan. References: (1) C. I. Dovas and N. I. Katis. J. Virol. Methods 109:217, 2003. (2) Y. Gyoutoku et al. Jpn. J. Phytopathol. 75:109, 2009. (3) C. C. Ko et al. J. Appl. Entomol. 131:542, 2007. (4) M. Okuda et al. Phytopathology 100:560, 2010.

Download Full-text

First Report of Cucurbit aphid-borne yellows virus in Tunisia Causing Yellows on Five Cucurbitacious Species

Plant Disease ◽

10.1094/pd-89-0776b ◽

2005 ◽

Vol 89 (7) ◽

pp. 776-776 ◽

Cited By ~ 18

Author(s):

M. Mnari Hattab ◽

J. Kummert ◽

S. Roussel ◽

K. Ezzaier ◽

A. Zouba ◽

...

Keyword(s):

Citrullus Lanatus ◽

Aphis Gossypii ◽

Pcr Amplification ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

Fresh Leaf ◽

First Report ◽

Reference Isolate ◽

Leaf Tissues ◽

Beet Pseudo Yellows Virus

Viruses, distributed worldwide on cucurbits, cause severe damage to crops. Virus surveys in 2003 and 2004 were made in all the major cucurbit-growing areas in Tunisia. Large populations of aphids (Aphis gossypii Glover) and severe yellowing symptoms of older leaves of cucurbits were observed in outdoor and under plastic-tunnel cultivation, suggesting the presence of Cucurbit aphid-borne yellows virus (CABYV, genus Polerovirus, family Luteoviridae). Leaf samples collected from symptomatic and asymptomatic plants of melon (Cucumis melo L.), cucumber (C. sativus L.), squash (Cucurbita pepo L.), watermelon (Citrullus lanatus L.), and ware cucurbit (Ecballium elaterium L. T. Richard) were screened for the presence of CABYV using enzyme-linked immunosorbent assay (ELISA) and reverse transcription-polymerase chain reaction (RT-PCR). Reference isolate, CABYV-N (GenBank Accession No. X76931) was provided by H. Lecoq (INRA-Monfavet Cedex, France). Sample extracts from fresh leaf tissues were tested using ELISA with an antiserum prepared against this isolate. In addition, total RNA was extracted from fresh leaf tissues according to the technique of Celix et al. (2) using the Titan RT-PCR kit from Roche Diagnostics (Penzberg, Germany). Forward primer (5′-GAGGCGAAGGCGAAGAAATC-3′) and reverse primer (5′-TCTGGACCTGGCACTTGATG-3′) were designed with the available sequence of the reference isolate. ELISA tests demonstrated that 91 plants were positive among 160 plants tested with severe yellowing symptoms. All asymptomatic plants were negative. RT-PCR results yielded an expected 550-bp product that was amplified from the reference isolate. Of the 160 plants tested using ELISA, 106 plants were screened with RT-PCR including the 91 plants that were positive in ELISA. These 91 plants also were positive after RT-PCR amplification as were 12 more plants. This demonstrated that the RT-PCR test is more sensitive. No amplicons were produced from extracts of asymptomatic plants, RNA preparations of Cucurbit yellow stunting disorder virus (CYSDV), or Beet pseudo yellows virus (BPYV) positive controls provided by B. Falk (University of California, Davis). CYSDV and BPYV can induce similar yellowing symptoms in cucurbits. The results of the ELISA and RT-PCR tests showed that CABYV is widely distributed on five cucurbit species in the major growing areas of Tunisia including the northern, Sahel, central, and southern regions where it was detected, respectively, in 10 of 25, 11 of 21, 24 of 37, and 58 of 77 samples tested. CABYV was detected at the rates of 63 of 72 on melon, 10 of 21 on cucumber, 17 of 24 on squash, 10 of 25 on watermelon, and 3 of 18 on ware cucurbit. CABYV also seems to be widespread throughout the Mediterranean Basin (1,3,4), but to our knowledge, this is the first report of the occurrence of CABYV in Tunisia on different species of cucurbit and ware cucurbit. References: (1) Y. Abou-Jawdah et al. Crop Prot. 19:217, 2000. (2) A. Celix et al. Phytopathology 86:1370, 1996. (3) M. Juarez et al. Plant Dis. 88:907, 2004. (4) H. Lecoq et al. Plant Pathol. 41:749, 1992.

Download Full-text

First Report of Tomato Yellow Leaf Curl Virus in Réunion Island

Plant Disease ◽

10.1094/pdis.1999.83.3.303b ◽

1999 ◽

Vol 83 (3) ◽

pp. 303-303 ◽

Cited By ~ 22

Author(s):

M. Peterschmitt ◽

M. Granier ◽

R. Mekdoud ◽

A. Dalmon ◽

O. Gambin ◽

...

Keyword(s):

Tomato Yellow Leaf ◽

Economic Losses ◽

Enzyme Linked Immunosorbent Assay ◽

Yield Reduction ◽

Yellow Leaf ◽

Degenerate Primers ◽

Capsid Protein Gene ◽

Pcr Product ◽

Leaf Curl Virus ◽

Leaf Curl

In September 1997, stunting, reduced leaf size, leaf curling, and yellow margins were observed on tomato plants on a farm on the south coast of Réunion, a French island belonging to the Mascarenes archipelago. To our knowledge, these symptoms appeared to be characteristic of a tomato yellow leaf curl virus (TYLCV) infection. Diseased plants gave positive reactions with a triple antibody sandwich-enzyme-linked immunosorbent assay (TAS-ELISA), using ADGEN antibodies specific for begomoviruses (1). The serological results were confirmed by polymerase chain reaction (PCR) with a pair of degenerate primers—MP16, 5′-CCTCTAGATAATATTAC(C/T)(G/T)(G/A)(A/T)(T/G)G(G/A)CC-3′ and MP82, 5′-CGGAATTC(T/C)TGNAC(C/T)TT(G/A)CANGGNCC(T/C)T C(G/A)CA-3′—designed by Malla Padidam (ILTAB, San Diego, CA) to amplify a region of the A component of begomoviruses, between the intergenic conserved nonanucleotide sequence (TAATATTAC) and the first 5′ quarter of the capsid protein gene. A 500-bp PCR product was obtained from a symptomatic plant but not from a healthy looking one. After cloning the PCR product in a pGEM-T Easy vector (Promega, Madison, WI) and sequencing it with plasmid-specific primers (SP6, T7), the sequence was compared with the sequences of the NCBI data base, with the use of BLAST. Nineteen sequences among those producing the highest scoring segment pairs were compared with each other and with the 500-bp PCR product from Réunion by the Clustal method of MegAlign (DNASTAR, London). The Réunion sequence (AJ010790) was at least 94% similar to sequences of TYLCV isolates from the Dominican Republic (AF024715), Cuba (AJ223505), and Israel (X15656, X76319 for the mild clone). Based on these results, it appeared that the analyzed tomato plant was infected by a geminivirus isolate belonging to the Israeli species of TYLCV. A preliminary survey was carried out from December 1997 to April 1998 in both outdoor and protected tomato crops. Infected plants were detected by TAS-ELISA in 52 of the 123 locations visited. Severe economic losses were observed: 14 locations with 60 to 100% yield reduction and 11 locations with 40 to 60% yield reduction. All the infected samples were collected in the leeward coast, which is the driest region of the island. Although Bemisia tabaci (Gennadius) has been recorded since 1938 in Réunion (2), it has been observed on tomato crops only since 1997 and population levels were low compared with those of Trialeurodes vaporariorum Westwood. During the first six months of 1998, B. tabaci was found on Euphorbia heterophylla L., Lantana camara L., Solanum melongena L., S. nigrum L., and Phaseolus vulgaris L. These host plants often occur near infected tomato crops. References: (1) S. Macintosh et al. Ann. Appl. Biol. 121:297, 1992. (2) L. Russell and J. Etienne. Proc. Entomol. Soc. Wash. 87:202, 1985.

Download Full-text

First Report of Cucurbit chlorotic yellows virus in Cucumber, Melon, and Watermelon in Greece

Plant Disease ◽

10.1094/pdis-03-14-0311-pdn ◽

2014 ◽

Vol 98 (10) ◽

pp. 1446-1446 ◽

Cited By ~ 23

Author(s):

C. Orfanidou ◽

V. I. Maliogka ◽

N. I. Katis

Keyword(s):

Citrullus Lanatus ◽

Disease Incidence ◽

Access Time ◽

Cucumber Plant ◽

Post Inoculation ◽

Rt Pcr ◽

First Report ◽

Yellowing Disease ◽

Beet Pseudo Yellows Virus ◽

Cucurbit Chlorotic Yellows Virus

In 2011, an outbreak of a yellowing disease causing chlorosis and Interveinal chlorotic spots on lower leaves was observed in cucumber (Cucumis sativus) and melon (C. melo) plants in two greenhouses on the island of Rhodes, Greece. Similar symptoms were observed in 2012 in open field watermelon (Citrullus lanatus) plants in Rhodes and in November 2013 in a cucumber greenhouse in Tympaki, Crete. Disease incidence ranged from 10 to 40%. The observed symptoms were similar to those caused by whitefly transmitted criniviruses (family Closteroviridae) Cucurbit yellow stunting disorder virus (CYSDV) and Beet pseudo-yellows virus (BPYV), as well as Cucurbit chlorotic yellows virus (CCYV), a recently described crinivirus that infects cucurbits in Japan (4) and by the aphid transmitted polerovirus (family Luteoviridae) Cucurbit aphid-borne yellows virus (CABYV). Dense populations of whiteflies were present in all the affected crops. Leaf samples from cucumber (10 from Rhodes and 10 from Crete), melon (10), and watermelon (10) were collected and tested for the presence of the above viruses. Total RNA was extracted from the samples (2) and detection of BPYV, CYSDV, and CABYV was done as previously described (1,3) whereas detection of CCYV was conducted by herein developed two-step RT-PCR assays. Two new pairs of primers, ‘CC-HSP-up’ (5′-GAAGAGATGGGTTGGTGTAGATAAA-3′)/‘CC-HSP-do’ (5′-CACACCGATTTCATAAACATCCTTT-3′) and ‘CC-RdRp-up’ (5′-CCTAATATTGGAGCTTATGAGTACA-3′)/‘CC-RdRp-do’ (5′-CATACACTTTAAACACAACCCC-3′) were designed based on GenBank deposited sequences of CCYV for the amplification of two regions partially covering the heat shock protein 70 homologue (HSP70h) (226 bp) and the RNA dependent RNA polymerase (RdRp) genes (709 bp). Interestingly, CCYV was detected in all samples tested, while CYSDV was detected in 18 cucumbers (10 from Rhodes and 8 from Crete), 1 melon, and 3 watermelon plants. Neither BPYV nor CABYV were detected. In order to verify the presence of CCYV, the partial HSP70h and RdRp regions of a cucumber isolate from Crete were directly sequenced using the primers ‘CC-HSP-up’/‘CC-HSP-do’ and ‘CC-RdRp-up’/‘CC-RdRp-do’. BLAST analysis of the obtained sequences (HG939521 and 22) showed 99% and 100% identities with the HSP70h and RdRp of cucumber CCYV isolates from Lebanon, respectively (KC990511 and 22). Also, the partial HSP70h sequence of a watermelon CCYV isolate from Rhodes showed 99% identity with the cucumber isolate from Crete. Whitefly transmission of CCYV was also carried out by using an infected cucumber from Crete as virus source. Four groups of 30 whitefly adults of Bemisia tabaci biotype Q were given an acquisition and inoculation access time of 48 and 72 h, respectively. Each whitefly group was transferred to a healthy cucumber plant (hybrid Galeon). Two weeks post inoculation, the plants, which have already been showing mild interveinal chlorosis, were tested for virus presence by RT-PCR. CCYV was successfully transmitted in three of four inoculated cucumbers, which was further confirmed by sequencing. In Greece, cucurbit yellowing disease has occurred since the 1990s, with CYSDV, BPYV, and CABYV as causal agents. To our knowledge, this is the first report of CCYV infecting cucurbits in Greece; therefore, our finding supports the notion that the virus is spreading in the Mediterranean basin and is an important pathogen in cucurbit crops. References: (1) I. N. Boubourakas et al. Plant Pathol. 55:276, 2006. (2) E. Chatzinasiou et al. J. Virol. Methods 169:305, 2010. (3) L. Lotos et al. J. Virol. Methods 198:1, 2014. (4) M. Okuda et al. Phytopathology 100:560, 2010.

Download Full-text

First Report of the US1 Strain of Pepino mosaic virus in Tomato in the Canary Islands, Spain

Plant Disease ◽

10.1094/pdis-92-11-1590c ◽

2008 ◽

Vol 92 (11) ◽

pp. 1590-1590 ◽

Cited By ~ 12

Author(s):

A. Alfaro-Fernández ◽

M. C. Cebrián ◽

C. Córdoba-Sellés ◽

J. A. Herrera-Vásquez ◽

C. Jordá

Keyword(s):

Mosaic Virus ◽

Canary Islands ◽

Sequence Data ◽

Triple Gene Block ◽

Economic Losses ◽

Sequence Information ◽

Specific Primers ◽

Pepino Mosaic Virus ◽

First Report ◽

Gene Block

Pepino mosaic virus (PepMV), a member of the genus Potexvirus, was first described in 1974 on pepino (Solanum muricatum Ait.) in Peru. In 1999, PepMV was reported to be affecting tomato (Solanum lycopersicum L.) (3), and currently, the virus is distributed throughout many parts of the world causing economic losses in tomato crops. This virus induces not only a high variability of symptoms on infected plants, including distortion, chlorosis, mosaic, blistering, and filiformity on leaves and marbling on fruits, but also exhibits substantial genetic diversity. Five strains or genotypes of PepMV have been described, including European tomato (EU), Peruvian (PE), Chilean 2 (CH2), and two American strains, US1 (including CH1) and US2. No correlation has been found between different genotypes and symptom expression of PepMV infection. Studies have demonstrated that field populations of PepMV in Europe belong to EU and US2 or CH2 strains. Mixed infections between these strains and interstrain recombinant isolates are also found (1,2). In Spain, the PE strain was also described, but at a lower relative frequency than other strains (2). In February 2007 in the Canary Islands (Tenerife, Spain), a PepMV isolate (PepMV-Can1) showing the typical leaf symptoms of blistering and mosaic was collected. PepMV was first identified by double-antibody sandwich (DAS)-ELISA with specific antisera against PepMV (DSMZ GMBH, Baunschweig, Germany) according to the manufacturer's instructions. The serological identification was confirmed by reverse transcription (RT)-PCR with two pairs of PepMV-specific primers Pep3/Pep4 and CP-D/CP-R that amplify a fragment of the RNA dependent RNA polymerase (RdRp) gene and the complete coat protein (CP) gene, respectively (2). PCR products were purified and directly sequenced. The amplified RdRp fragment of PepMV-Can1 (GenBank Accession No. EU791618) showed 82% nt identity with the EU and PE strains (GenBank Accession Nos. AJ606360 and AM109896, respectively), but more than 98% identity with the US2 and US1 strains (GenBank Accession Nos. AY509927 and AY 509926, respectively). Sequence information obtained from the amplified CP fragment (GenBank Accession No. EU797176) showed 99% nt identity with US1 and less than 83% with EU, PE, CH2 (GenBank Accession No. DQ000985), and US2. To confirm these results, specific primers for the triple gene block (TGB) were designed using the sequence data from GenBank Accession Nos. AY509926, AY509927, DQ000985, AJ606360, and AM109896. (PepTGB-D:5′ GATGAAGCTGAACAACATTTC 3′ and PepTGB-R: 5′ GGAGCTGTATTRGGATTTGA 3′). A 1,437-bp fragment (GenBank Accession No. EU797177) was obtained, sequenced, and compared with the published sequences, showing 98% nt identity with the US1 strain and less than 86% with the other strains of PepMV. The highest sequence identity in all the studied regions of the PepMV-Can1 isolate was with the US1 strain of PepMV. To our knowledge, this is not only the first report of an isolate of the US1 strain in the Canary Islands (Spain), but also the first report of the presence of this genotype in a different location than its original report (North America). References: (1) I. Hanssen et al. Eur. J. Plant Pathol. 121:131, 2008. (2) I. Pagán et al. Phytopathology 96:274, 2006. (3) R. A. R. Van der Vlugt et al. Plant Dis. 84:103, 2000.

Download Full-text

Tomato Mosaic Tobamovirus, Causal Agent of a Severe Disease of Pepino (Solanum muricatum)

Plant Disease ◽

10.1094/pdis.1998.82.11.1281b ◽

1998 ◽

Vol 82 (11) ◽

pp. 1281-1281 ◽

Cited By ~ 5

Author(s):

J. Prohens ◽

S. Soler ◽

L. Pérez-Benlloch ◽

F. Nuez

Keyword(s):

Severe Disease ◽

Plant Viruses ◽

Hypersensitive Reaction ◽

Economic Losses ◽

Enzyme Linked Immunosorbent Assay ◽

Yield Reduction ◽

Solanum Muricatum ◽

Mother Plants ◽

Young Leaves ◽

Initial Source

Pepino (Solanum muricatum Aiton), a vegetatively propagated herbaceous crop from the Andes, is esteemed for its edible, juicy, and fragrant fruits. Its cultivation as a crop for diversification is increasing in many frost-free areas throughout the world (2). In 1994, a severe viruslike disease, previously undescribed, was observed on pepino plants in Valencia, Spain. The disease has continued to cause economic losses in pepino plantings in subsequent years. Symptoms, which are exacerbated at temperatures above 30°C, include dark and light green mosaic predominantly in young leaves, leaf puckering and distortion, short internodes, fruit deformation, delay in ripening, and yield reduction. Samples from affected plants were analyzed by enzyme-linked immunosorbent assay (ELISA). All samples displaying viruslike symptoms reacted positively with antiserum made against tomato mosaic tobamovirus (ToMV) but not with antisera made against alfalfa mosaic alfamovirus, cucumber mosaic cucumovirus, potato Y potyvirus, tobacco mosaic tobamovirus, tomato spotted wilt tospovirus, or tomato yellow leaf curl bigeminivirus. A leaf extract from diseased plants was heated at 72°C for 10 min. This treatment inactivates most plant viruses but does not eliminate infectivity of ToMV (1). Inoculation of a collection of pepino clones resulted in the development of symptoms in most clones. Symptomatic clones were also ELISA-positive for ToMV. A few clones showed a hypersensitive reaction, which consisted of the development of necrotic lesions in the inoculated area. New growth on these clones was asymptomatic and ELISA-negative for ToMV. These results clearly point to a causal relationship between ToMV infection and the observed disease. The initial source of the infection should be eliminated from commercial plantings, as ToMV is easily transmitted when the pepino plants are trellised and pruned. Special care must also be taken to ensure that mother plants from which cuttings are taken are free from this virus. In addition, ToMV is usually found in meristematic tissues, even after thermotherapy and chemotherapy treatments are applied, making the regeneration of virus-free plants from infected clones by meristem tip culture difficult. Therefore, it seems that the best strategy against this disease is the development of resistant cultivars. References: (1) H. Laterrot. Ann. Amélior. Plant. 23:287, 1973; (2) J. Prohens et al. Econ. Bot. 50:355, 1996.

Download Full-text

First Report of Zucchini yellow mosaic virus Associated with Leaf Crinkle and Yellow Mosaic Diseases of Cucurbit Plants in Mali

Plant Disease ◽

10.1094/pdis-94-7-0923b ◽

2010 ◽

Vol 94 (7) ◽

pp. 923-923 ◽

Cited By ~ 1

Author(s):

W. S. Tsai ◽

I. K. Abdourhamane ◽

D. Knierim ◽

J. T. Wang ◽

L. Kenyon

Keyword(s):

Coat Protein ◽

Mosaic Virus ◽

Citrullus Lanatus ◽

Zucchini Yellow Mosaic Virus ◽

The United States ◽

Yellow Mosaic Virus ◽

Nucleotide Identity ◽

Watermelon Mosaic Virus ◽

Virus Species ◽

First Report

The aphid-transmitted Zucchini yellow mosaic virus (ZYMV; genus Potyvirus, family Potyviridae) has been reported to cause severe epidemics and yield losses in cucurbit crops worldwide (1). In Africa, ZYMV has been detected in Algeria, Egypt, Madagascar, Mauritius, Mayotte, Morocco, Nigeria, Reunion, South Africa, Sudan, Swaziland, and Tunisia (1). In April 2009, leaf yellowing, mosaic, crinkling, and curling were common on cucurbit plants in fields in Mali. Symptomatic leaf samples were collected from five cucumber (Cucumis sativus) plants in Kati, two watermelon (Citrullus lanatus) plants in Samanko, and one weedy melon (Cucumis sp.) plant in Baguineda. All samples tested positive for ZYMV and were negative for Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV), Papaya ringspot virus type W (PRSV-W), Watermelon mosaic virus (WMV), and Watermelon silver mottle virus (WSMoV) by double-antibody sandwich (DAS)-ELISA. They also tested negative for Melon yellow spot virus (MYSV) by indirect ELISA. Antibodies against ZYMV and WMV were obtained from DSMZ, Braunschweig, Germany, and those against CGMMV, MYSV, PRSV-W, and WSMoV were provided by Shyi-Dong Yeh, National Chung Hsing University, Taichung, Taiwan. Six ZYMV ELISA-positive samples (three cucumber, two watermelon, and the weedy melon sample) were also tested by reverse transcription (RT)-PCR using the potyvirus universal primer pair Sprimer1/Oligo(dT) (2). The expected 1.6-kb viral cDNA was amplified from all six samples and each was sequenced. All sequences obtained from cucumber (GenBank Accession Nos. HM005307, HM005308, and HM005309), watermelon (GenBank Accession Nos. HM005311 and HM005312), and weedy melon (GenBank Accession No. HM005310) isolates were 1,684 nucleotides (nt) long excluding the 3′ poly-A tails. They comprised the 3′-terminal of the NIb region (1 to 633 nt), the coat protein region (634 to 1473 nt), and the 3′-untranslated region (1,474 to 1,684 nt). Because the sequences shared high nucleotide identity (98.3 to 99.7%), these isolates were considered to be the same virus species. When the sequences were compared by BLASTn searching in GenBank and analyzed by DNAMAN Sequence Analysis Software (Lynnon Corporation, St-Louis, Pointe-Claire, Quebec, Canada), they were found to have the greatest nucleotide identity (97.4 to 98.0%) with the Connecticut strain of ZYMV (ZYMV-Connecticut; GenBank Accession No. D00692), within a clade of isolates from China, Italy, Japan, and the United States. When assessed separately, their coat protein (97.7 to 98.3% nucleotide and 98.9 to 99.6% amino acid identity) and 3′-untranslated regions (96.7 to 97.2% identity) also had greatest homology with ZYMV-Connecticut. To our knowledge, this is the first report of ZYMV infecting cucurbit plants in Mali. ZYMV should be taken into consideration when breeding cucurbit crops for this region, and managing viral diseases. References: (1) C. Desbiez et al. Plant Pathol. 46:809, 1997. (2) W. S. Tsai et al. Plant Dis. 94:378, 2010.

Download Full-text