scholarly journals First Report of Pepino mosaic virus on Tomato in Spain

Plant Disease ◽  
2001 ◽  
Vol 85 (12) ◽  
pp. 1292-1292 ◽  
Author(s):  
C. Jordá ◽  
A. Lázaro Pérez ◽  
P. Martínez-Culebras ◽  
P. Abad ◽  
A. Lacasa ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Canary Islands ◽  
Plant Protection ◽  
Polyclonal Antibodies ◽  
Datura Stramonium ◽  
Enzyme Linked Immunosorbent Assay ◽  
Chenopodium Amaranticolor ◽  
Pepino Mosaic Virus ◽  
Tomato Plants ◽  
First Report

At the beginning of 2000, a damaging disease developed on protected tomato (Lycopersicon esculentum) crops grown in polyethylene greenhouses in different regions of Spain. Production losses were estimated at 15 to 80%. The tomato plants showed a variety of symptoms. The most common symptoms were leaf distortion, chlorosis, and mosaic. Some plants showed a dark green mosaic and bubbling of the leaf surface. Green striations were also observed on the stem and sepals. Most of the diseased plants had discolored fruits. Symptoms decreased as environmental temperature increased. The involvement of Pepino mosaic virus (PepMV) was suspected. To identify the etiological agent, ≈500 symptomatic tomato plants were collected from several locations in Alicante, Murcia, Almeria and the Canary Islands. Flexuous viral particles 510 nm long were observed by transmission electron microscopy, suggesting the presence of a potexvirus in the tissue extracts analyzed. All samples were tested by ELISA (enzyme-linked immunosorbent assay), using polyclonal antibodies to Narcissus mosaic virus (Adgen, Auchincriuve, Scotland), a virus serologically related to PepMV, and two antisera specific to PepMV (Adgen, Scotland and DMSZ, Braunschweig, Germany). PepMV was detected in 35% of the samples. Like PepMV, the virus infected (as confirmed by ELISA) greenhouse-grown Datura stramonium, Nicandra physalodes, Nicotiana benthamiana, N. clevelandii, Solanum tuberosum, and Vigna sinensis and did not infect Capsicum anuum, Cucumis sativus, Chenopodium amaranticolor, C. quinoa, Petunia × hybrida, Phaseolus vulgaris, Physalis floridana, N. glutinosa, N. rustica, or N. tabacum. The virus did infect Gomphrena globosa, which normally is not infected by PepMV. The first report of PepMV was on pepino (Solanum muricatum) in Peru in 1974 (1), but this virus has been recently reported in the Netherlands, England, Germany, and France on protected tomato crops (2). To our knowledge, this is the first report of PepMV in Spain, including the Canary Islands. References: (1) R. A. C. Jones et al. Ann. Appl. Biol. 94:61, 1980. (2) European and Mediterranean Plant Protection Organisation (EPPO). Alert List Viruses. On-line publication/2000/003.

scholarly journals First Report of Tobacco vein banding mosaic virus in China (Xian, Shaanxi Province) in Datura stramonium and Tobacco

Plant Disease ◽  
2000 ◽  
Vol 84 (10) ◽  
pp. 1152-1152 ◽  
Author(s):  
P. Roggero ◽  
G. P. Accotto ◽  
M. Ciuffo ◽  
R. Lenzi ◽  
C. Desbiez ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Tobacco Plant ◽  
Severe Disease ◽  
Datura Stramonium ◽  
Shaanxi Province ◽  
Chinese Isolate ◽  
Enzyme Linked Immunosorbent Assay ◽  
Chenopodium Amaranticolor ◽  
First Report ◽  
White Burley

Tobacco vein banding mosaic virus (TVBMV) has been reported in Taiwan (1), North America (Tennessee) (2), and Japan (3) and induces a severe disease of tobacco. During surveys on viruses of vegetables in China, TVBMV was isolated from a Datura stramonium weed plant in July 1998 in Shaanxi Province. It showed severe mosaic with blistering of the leaves. The plant was also infected by Cucumber mosaic virus (CMV). When sap from D. stramonium was frozen, thawed, and mechanically inoculated, only TVBMV was recovered. The 3′-end of the viral genome was amplified by reverse transcription-polymerase chain reaction (RT-PCR) using primers derived from the potyviridae primers (4) and cloned in pBlueScript. The sequence of 1,630 bp (GenBank AF274315) was determined on both DNA strands and found to have approximately 94% homology with other TVBMV sequences (L 28816 from Tennessee, X77637 from Taiwan, and AB020524 from Japan). The host range of the Chinese isolate was similar to that reported for the U.S. isolate. D. stramonium, Nicotiana benthamiana, N. clevelandii, N. glutinosa, N. tabacum Samsun, White Burley type and Xanthi, Lycopersicon esculentum cv. Marmande, and Petunia hybrida were systemically infected. A local infection developed in N. rustica, Chenopodium amaranticolor, C. quinoa, and Ocimum basilicum. The Chinese isolate did not infect Capsicum annuum cv. Quadrato d'Asti, Solanum melongena, or several Cucurbitaceae and Leguminosae species. Myzus persicae transmitted the Chinese TVBMV in a non-persistent mode from both D. stramonium and tobacco to the same plants and to tomato. No seed transmission occurred in experimentally infected D. stramonium (20 seedlings), tobacco White Burley type (200 seedlings), and tomato cv. Marmande (100 seedlings). The virus was found in the roots of D. stramonium and tobacco. Since the virus was not seed-transmissible, overwintering rootstocks may provide sites for winter survival of the virus. An antiserum was produced against the virus and an enzyme-linked immunosorbent assay survey was carried out in solanaceous crops including D. stramonium collected in July 1999 in Shaanxi, Shanxi, Henan, and Hebei provinces and Beijing surroundings. TVBMV was found only in the same field as in 1998 in four D. stramonium plants in association with CMV and in a tobacco plant 200 m from D. stramonium. TVBMV was not found in the closest tomato crops, where infection of CMV was severe. This is the first report of TVBMV in China, and Xian is the most northern location in which this virus has been found. References: (1) J. K. Chiang et al. Bull. Tobacco Res. Inst. 32:39, 1990. (2) B. B. Reddick et al. Plant Dis. 76:856, 1992. (3) H. Tochihara. Rev. Plant Prot. Res. 13:122, 1980. (4) A. Gibbs and A. Mackenzie. J. Virol. Meth. 63:9, 1997.

scholarly journals First Report of Pepino mosaic virus on Natural Hosts

Plant Disease ◽  
2001 ◽  
Vol 85 (12) ◽  
pp. 1292-1292 ◽  
Author(s):  
C. Jordá ◽  
A. Lázaro Pérez ◽  
P. V. Martínez Culebras ◽  
A. Lacasa
Keyword(s):  
Mosaic Virus ◽  
Solanum Nigrum ◽  
Enzyme Linked Immunosorbent Assay ◽  
New Disease ◽  
Nicotiana Glauca ◽  
Pepino Mosaic Virus ◽  
Tomato Plants ◽  
First Report ◽  
Sonchus Oleraceus ◽  
Chenopodium Murale

Pepino mosaic virus (PepMV) is a potexvirus recently identified as the causal agent of a new disease occurring in protected tomato (Lycopersicon esculentum Mill.) crops in the Netherlands (2). PepMV has been subsequently identified in England, Germany, Italy, Morocco, Portugal, and Spain. The new disease has become a serious problem for tomato production in Europe. Most infected tomato plants expressed leaf distortion, chlorosis, and yellow mosaic. Other plants expressed mosaic and bubbling of the leaf surface. Tomato fruits showing severe discoloration and mosaic were observed in protected tomato crops. Symptoms attenuated in tomato plants as the ambient temperature increased. At present, only Solanum muricatum Ait. (Peruvian pepino) and L. esculentum are affected by PepMV.To determine possible reservoir hosts for this virus, 70 samples from Amaranthus sp., A. viridis (L.) Britton et al., Chenopodium murale L., Convolvulus arvensis L., Malva parviflora L., Nicotiana glauca Grah., Polypogon monspeliensis (L.) Desf., Senecio vulgaris L., Sisybrium sp., Solanum nigrum L., and Sonchus oleraceus L. were analyzed. The plants were collected around greenhouses affected by PepMV from different regions in Spain (Murcia and Canary Islands). The samples were analyzed for PepMV by double-antibody sandwich enzyme-linked immunosorbent assay with a commercial antiserum (DSMZ AS-0554, Biologische Bundesantstal, Braunschweig, Germany). Only Amaranthus sp., M. parviflora, N. glauca, Solanum nigrum, and Sonchus oleraceus tested postive. The presence of PepMV in these weed species was confirmed by electron microscopy and reverse transcription-polymerase chain reaction using degenerate primers for potexvirus (1). All the hosts analyzed were asymptomatic. However, symptoms were reproduced by mechanically inoculating tomato plants with sap from naturally infected weeds. To our knowledge, this is the first report of natural infection of weeds by PepMV. References: (1) A. Gibbs et al. J. Virol. Methods 74:67, 1998. (2) R. A. A. Van der Vlugt et al. Plant Dis. 84:103, 2000.

scholarly journals First Report of Tobacco mild green mosaic virus Infecting Capsicum annuum in Tunisia

Plant Disease ◽  
2009 ◽  
Vol 93 (7) ◽  
pp. 761-761 ◽  
Author(s):  
M. I. Font ◽  
M. C. Córdoba-Sellés ◽  
M. C. Cebrián ◽  
J. A. Herrera-Vásquez ◽  
A. Alfaro-Fernández ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Capsicum Annuum ◽  
Polyclonal Antibodies ◽  
Plant Viruses ◽  
Mottle Virus ◽  
Tomato Mosaic Virus ◽  
Rt Pcr ◽  
Tomato Plants ◽  
First Report ◽  
Pepper Plants

During the springs of 2007 and 2008, leaf deformations as well as symptoms of mild green and chlorotic mosaic were observed on pepper (Capsicum annuum) plants grown in Monastir (northwest Tunisia) and Kebili (southeast Tunisia). With the support of projects A/5269/06 and A/8584/07 from the Spanish Agency for International Cooperation (AECI), symptomatic leaf samples were analyzed by transmission electron microscopy (TEM) of leaf-dip preparations. Typical tobamovirus-like particles (rigid rods ≈300 nm long) were observed in crude plant extracts. According to literature, at least six tobamoviruses infect peppers: Paprika mild mottle virus (PaMMV); Pepper mild mottle virus (PMMoV); Ribgrass mosaic virus (RMV); Tobacco mild green mosaic virus (TMGMV); Tobacco mosaic virus (TMV); and Tomato mosaic virus (ToMV) (1). Extracts from six symptomatic plants from Monastir and four from Kebili fields tested negative for ToMV, TMV, and PMMoV and tested positive for TMGMV by double-antibody sandwich (DAS)-ELISA using polyclonal antibodies specific to each virus (Loewe Biochemica GMBH, Sauerlach, Germany). To confirm the positive TMGMV results, total RNAs from 10 symptomatic plants that tested positive by ELISA were extracted and analyzed by reverse transcription (RT)-PCR using primers designed to specifically amplify a region of the coat protein gene (CP) of TMGMV (2). The 524-bp TMGMV-CP specific DNA fragment was amplified from all samples, but was not amplified from healthy plants or the sterile water used with negative controls. RT-PCR products were purified and directly sequenced. BLAST analysis of the obtained sequence (GenBank No. EU770626) showed 99 to 98% nucleotide identity with TMGMV isolates PAN-1, DSMZ PV-0113, TMGMV-Pt, and VZ1 (GenBank Nos. EU934035, EF469769, AM262165, and DQ460731, respectively) and less than 69% with PaMMV and PMMoV isolates (GenBank Nos. X72586 and AF103777, respectively). Two TMGMV-positive, singly, infected symptomatic pepper plants collected from Monastir and Kebili were used in mechanical transmissions to new pepper and tomato plants. Inoculated pepper plants exhibited mild chlorosis symptoms and tested positive for TMGMV only; however, inoculated tomato plants cv. Marmande were asymptomatic and tested negative as expected for TMGMV infection (1). To our knowledge, although C. annuum has been shown as a natural host for TMGMV (2), this is the first report of TMGMV in Tunisia. Reference: (1) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20th August 1996. Online publication, 1996. (2) J. Cohen et al. Ann. Appl. Biol. 138:153, 2001.

scholarly journals First Report of the US1 Strain of Pepino mosaic virus in Tomato in the Canary Islands, Spain

Plant Disease ◽  
2008 ◽  
Vol 92 (11) ◽  
pp. 1590-1590 ◽  
Author(s):  
A. Alfaro-Fernández ◽  
M. C. Cebrián ◽  
C. Córdoba-Sellés ◽  
J. A. Herrera-Vásquez ◽  
C. Jordá
Keyword(s):  
Mosaic Virus ◽  
Canary Islands ◽  
Sequence Data ◽  
Triple Gene Block ◽  
Economic Losses ◽  
Sequence Information ◽  
Specific Primers ◽  
Pepino Mosaic Virus ◽  
First Report ◽  
Gene Block

Pepino mosaic virus (PepMV), a member of the genus Potexvirus, was first described in 1974 on pepino (Solanum muricatum Ait.) in Peru. In 1999, PepMV was reported to be affecting tomato (Solanum lycopersicum L.) (3), and currently, the virus is distributed throughout many parts of the world causing economic losses in tomato crops. This virus induces not only a high variability of symptoms on infected plants, including distortion, chlorosis, mosaic, blistering, and filiformity on leaves and marbling on fruits, but also exhibits substantial genetic diversity. Five strains or genotypes of PepMV have been described, including European tomato (EU), Peruvian (PE), Chilean 2 (CH2), and two American strains, US1 (including CH1) and US2. No correlation has been found between different genotypes and symptom expression of PepMV infection. Studies have demonstrated that field populations of PepMV in Europe belong to EU and US2 or CH2 strains. Mixed infections between these strains and interstrain recombinant isolates are also found (1,2). In Spain, the PE strain was also described, but at a lower relative frequency than other strains (2). In February 2007 in the Canary Islands (Tenerife, Spain), a PepMV isolate (PepMV-Can1) showing the typical leaf symptoms of blistering and mosaic was collected. PepMV was first identified by double-antibody sandwich (DAS)-ELISA with specific antisera against PepMV (DSMZ GMBH, Baunschweig, Germany) according to the manufacturer's instructions. The serological identification was confirmed by reverse transcription (RT)-PCR with two pairs of PepMV-specific primers Pep3/Pep4 and CP-D/CP-R that amplify a fragment of the RNA dependent RNA polymerase (RdRp) gene and the complete coat protein (CP) gene, respectively (2). PCR products were purified and directly sequenced. The amplified RdRp fragment of PepMV-Can1 (GenBank Accession No. EU791618) showed 82% nt identity with the EU and PE strains (GenBank Accession Nos. AJ606360 and AM109896, respectively), but more than 98% identity with the US2 and US1 strains (GenBank Accession Nos. AY509927 and AY 509926, respectively). Sequence information obtained from the amplified CP fragment (GenBank Accession No. EU797176) showed 99% nt identity with US1 and less than 83% with EU, PE, CH2 (GenBank Accession No. DQ000985), and US2. To confirm these results, specific primers for the triple gene block (TGB) were designed using the sequence data from GenBank Accession Nos. AY509926, AY509927, DQ000985, AJ606360, and AM109896. (PepTGB-D:5′ GATGAAGCTGAACAACATTTC 3′ and PepTGB-R: 5′ GGAGCTGTATTRGGATTTGA 3′). A 1,437-bp fragment (GenBank Accession No. EU797177) was obtained, sequenced, and compared with the published sequences, showing 98% nt identity with the US1 strain and less than 86% with the other strains of PepMV. The highest sequence identity in all the studied regions of the PepMV-Can1 isolate was with the US1 strain of PepMV. To our knowledge, this is not only the first report of an isolate of the US1 strain in the Canary Islands (Spain), but also the first report of the presence of this genotype in a different location than its original report (North America). References: (1) I. Hanssen et al. Eur. J. Plant Pathol. 121:131, 2008. (2) I. Pagán et al. Phytopathology 96:274, 2006. (3) R. A. R. Van der Vlugt et al. Plant Dis. 84:103, 2000.

scholarly journals First Report of Tomato torrado virus in Tomato in the Canary Islands, Spain

Plant Disease ◽  
2007 ◽  
Vol 91 (8) ◽  
pp. 1060-1060 ◽  
Author(s):  
A. Alfaro-Fernández ◽  
C. Córdoba-Sellés ◽  
M. C. Cebrián ◽  
J. A. Sánchez-Navarro ◽  
A. Espino ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Canary Islands ◽  
Polyclonal Antibodies ◽  
Tomato Mosaic Virus ◽  
Rt Pcr ◽  
Water Control ◽  
First Report ◽  
Pcr Product ◽  
Negative Controls ◽  
Wilt Virus

In 2003, greenhouse-grown tomato crops (Lycopersicon esculentum Mill.) in the Canary Islands (Spain) were observed showing an initial yellowing in defined areas at the base of the leaflet that later developed into necrotic spots or an extensive necrotic area progressing from the base to tip. Fruits were also affected, showing necrotic areas and often developing cracking. Generally, the plants that were affected seemed to be burnt, their growth was reduced, and the production level was seriously damaged. Similar symptoms have been observed in Murcia (Spain) since 2001, which have been recently associated with Tomato torrado virus (ToTV) infection (2). Twenty-two tomato samples showing “torrado disease” symptoms were collected from different greenhouses between 2003 and 2006 in Las Palmas (Canary Islands, Spain). To verify the identity of the disease, double-antibody sandwich (DAS)-ELISA was performed on leaf and fruit extracts of symptomatic plants using polyclonal antibodies specific to Potato virus Y (PVY), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany), and Pepino mosaic virus (PepMV) (DSMZ, Braunschweig, Germany). Total RNA was extracted from the 22 tomato samples with the RNAwiz Extraction kit (Ambion, Huntingdon, United Kingdom) and tested using one-step reverse-transcription (RT)-PCR with the SuperScript Platinum Taq kit (Invitrogen Life Technologies, Barcelona, Spain) with primers specific to PepMV (1) and ToTV (2). All analyses included healthy tomato plants as negative controls. Five of the twenty-two tomato samples were positive for PepMV and negative for the other viruses tested by serological analysis. However, all 22 samples were positive in RT-PCR performed with the primers specific to ToTV segment RNA2. The RT-PCR assay to detect ToTV produced an amplicon of the expected size (580 bp). No amplification product was observed when healthy plants or a water control were used as a template in the RT-PCR reaction. The ToTV RT-PCR product was purified (High Pure PCR Product Purification kit, Roche Diagnostics, Mannheim, Germany) and sequenced. BLAST analysis of one sequence (GenBank Accession No. EF436286) showed 99% identity to ToTV RNA2 sequence (GenBank Accession No. DQ388880). To our knowledge, this is the first report of ToTV in the Canary Islands. References: (1) I. Pagán et al. Phytopathology 96:274, 2006. (2) M. Verbeek et al. Online Publication. doi:10.1007/s00705-006-0917-6. Arch. Virol., 2007.

scholarly journals Occurrence of Radish mosaic virus on Cauliflower and Turnip Crops in Iran

Plant Disease ◽  
2004 ◽  
Vol 88 (8) ◽  
pp. 909-909 ◽  
Author(s):  
S. Farzadfar ◽  
R. Pourrahim ◽  
A. R. Golnaraghi ◽  
S. Jalali ◽  
A. Ahoonmanesh
Keyword(s):  
Mosaic Virus ◽  
Brassica Rapa ◽  
Polyclonal Antibodies ◽  
The United States ◽  
Plant Viruses ◽  
Enzyme Linked Immunosorbent Assay ◽  
Leaf Extracts ◽  
Chenopodium Amaranticolor ◽  
Local Lesions ◽  
Ring Spot

During the spring and summer of 2003, symptoms of mosaic, mottle, and crinkle were observed in cauliflower (Brassica oleracea) and turnip (Brassica rapa) fields in the Qazvin and Esfahan provinces of Iran, respectively. Leaf extracts of these plants, made infective by mechanical inoculation, caused necrotic local lesions on Chenopodium amaranticolor, chlorotic ring spot on Nicotiana tabacum cv. Samsun, and chlorotic local lesions followed by systemic mosaic on Brassica rapa (1). Using double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) and specific polyclonal antibodies (As-0120 and PV-0355) that were kindly prepared by S. Winter (DSMZ, Braunschweig, Germany), the samples were tested for the presence of Radish mosaic virus (RaMV) (family Comoviridae, genus Comovirus). ELISA results showed that the original leaf samples and inoculated indicator plants reacted positively to RaMV antibodies. RaMV has been reported in the United States, Japan, and Europe on turnip and other crucifers (1,2). To our knowledge, this is the first report of RaMV occurring in Iran. References: (1) R. N. Campbell. Radish mosaic virus. No. 121 in: Descriptions of Plant Viruses. CMI/AAB, Surrey, England, 1973. (2) D. D. Sutic et al. Handb. Plant Virus Diseases. CRC Press, Boca Raton, FL, 1999.

scholarly journals First Report of Tomato apical stunt viroid in Tomato in Italy

Plant Disease ◽  
2014 ◽  
Vol 98 (8) ◽  
pp. 1164-1164 ◽  
Author(s):  
G. Parrella ◽  
G. Numitone
Keyword(s):  
Mosaic Virus ◽  
Sequence Similarity ◽  
Field Isolate ◽  
Biological Properties ◽  
Whole Genome ◽  
Chenopodium Amaranticolor ◽  
Tomato Plants ◽  
First Report ◽  
Stunt Viroid ◽  
Plant Pathol

During a survey conducted in October 2013 in tomato greenhouses in Diano Marina (Imola Province, northwest Italy), in a single greenhouse, unusual disease symptoms were observed in four out 1,400 (~0.3%) of tomato plants cv. Ingrid, grafted on ‘Beaufort’ rootstock. Symptoms including shortened apical internodes associated with tiny, deformed, and brittle chlorotic leaves, while ripe fruits appeared reduced in size and pale red. Samples of leaves from the four plants were collected and examined using commercial antisera (Bioreba AG, Reinach, Switzerland) by double antibody sandwich (DAS)-ELISA against Tomato spotted wilt virus, Cucumber mosaic virus, Alfalfa mosaic virus, Tomato/Tobacco mosaic viruses, and by indirect plate trapped antigen (PTA)-ELISA against potyviruses (potygroup test). None of the tested viruses were detected in the four leaf samples. In addition, PCR tests for begomoviruses and phytoplasmas were also negative. In a host range study, the original symptoms, consisting mainly of stunting and chlorosis, were reproduced within ~10 days in tomato seedlings (Momor line), mechanically inoculated at two true leaves stage with sap extract obtained from the four symptomatic tomato plants, whereas no symptoms were observed in Chenopodium amaranticolor, C. quinoa, Nicotiana tabacum (cv. Xanthi nc), N. glutinosa, or Phaseolus vulgaris (cv. Borlotto rosso). Total RNAs extracted with the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) from symptomatic samples were tested in RT-PCR using pospiviroids generic primers PSTVd-32/33 (1), designed to amplify the whole genome of Potato spindle tuber viroid (PSTVd), Tomato apical stunt viroid (TASVd), and Columnea latent viroid (CLVd), and CEVd-FW/RE primers, designed to amplify the whole genome of Citrus exocortis viroid (CEVd) and TASVd (3). Each of the four samples yielded amplicons of the same size (364 bp) with both primer combinations. The identity of the viroid was then determined by sequencing, on both strands, amplicons obtained from the four symptomatic plants at MWG (Ebersberg, Germany). Sequences obtained were identical, showing the highest nucleotide identity (99.7%) with the TASVd isolate Sj1 (AM777161), identified in Germany on Solanum jasminoides. The sequence was deposited in GenBank (Accession No. HG916812) and the field isolate named To1-IT. Two other cases of pospiviroid infection in tomato in Italy have been reported so far and the viroid species detected were PSTVd (2) and CLVd (4), respectively. To our knowledge, this is the first report of TASVd infecting tomato in Italy. The origin of this infection is still unclear, although based on the biological properties and sequence similarity, the To1-IT isolate probably originated from an ornamental species, most likely S. jasminoides, as recently reported for other tomato TASVd isolates, according to their biological and genetic features (5). References: (1) F. Di Serio. J. Plant Pathol. 89:297, 2007. (2) B. Navarro et al. J. Plant Pathol. 91:723, 2009. (3) N. Önelge. Turk. J. Agric. For. 21:419, 1997. (4) G. Parrella et al. Acta Hortic. 914:149, 2011. (5) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 133:803, 2012.

scholarly journals First Report of Pepino mosaic virus Infecting Greenhouse Cherry Tomatoes in Greece

Plant Disease ◽  
2011 ◽  
Vol 95 (1) ◽  
pp. 78-78 ◽  
Author(s):  
K. E. Efthimiou ◽  
A. P. Gatsios ◽  
K. C. Aretakis ◽  
L. C. Papayiannis ◽  
N. I. Katis
Keyword(s):  
Mosaic Virus ◽  
Leaf Tissue ◽  
Tomato Mosaic Virus ◽  
Sequencing Analysis ◽  
Rt Pcr ◽  
Pepino Mosaic Virus ◽  
Tomato Plants ◽  
First Report ◽  
Negative Controls ◽  
Das Elisa

Pepino mosaic virus (PepMV) (genus Potexvirus, family Flexiviridae) is a mechanically transmitted virus that has emerged as a significant problem of greenhouse tomato crops in Europe and around the world during the past 10 years (1). In spring of 2010, mosaic symptoms were observed on leaves of cherry tomato (Lycopersicon esculentum var. cerasiforme) greenhouse crops (hybrids Shiren, Tomito, and Rubino top) in the areas of Drymos and Vonitsa, located at Aitoloakarnania Prefecture, in Greece. A total of 63 tomato samples (55 from symptomatic and 8 from asymptomatic plants) were collected from 11 greenhouses where disease incidence ranged from 10 to 20%. All samples were tested by double-antibody sandwich (DAS)-ELISA using polyclonal antibodies from BIOREBA, AG (Reinach, Switzerland) for the presence of PepMV, Cucumber mosaic virus (CMV), and Tomato mosaic virus (ToMV). Leaf tissue from PepMV-, CMV-, and ToMV-infected samples and virus-free tomato plants were included in all tests as positive and negative controls, respectively. Results showed that 53 symptomatic samples collected from all greenhouses were infected with PepMV and two were co-infected with PepMV and CMV. Total RNA was extracted from all infected plants with a commercially available kit (Qiagen, Hilden, Germany) and amplified by conventional and real-time reverse transcription (RT)-PCR, using previously reported protocols (2). Positive and negative controls were also included in each assay. The 200-bp amplified PCR fragments of Triple Gene Block 3 (TGB3) obtained from five infected samples were purified and both strands were sequenced. Sequencing data were analyzed, deposited in the GenBank, and compared with other reported sequences. In addition, leaf tissue from five samples infected with only PepMV was used for mechanical inoculation of four plants of Nicotiana glutinosa, N. benthamiana, and tomato (L. esculentum FA 179 hybrid) plants. As negative controls, two plants from each species were used. Sequencing analysis showed that all five PepMV sequences were identical (GenBank Accession Nos. FR686904 to FR686908) and possessed 100% identity PepMVstrain CH2 (DQ000985). Inoculation results showed that the virus was successfully transmitted to N. benthamiana and tomato plants which developed mosaic symptoms, and tested positive by DAS-ELISA and RT-PCR. N. glutinosa plants did not develop any symptoms and were found to be free of PepMV when tested by DAS-ELISA and RT-PCR. To our knowledge, this is the first report of PepMV in Greece. Further studies on the disease prevalence and incidence and its economic impact on tomato production are required. PepMV is currently under quarantine status in the EU and therefore new protective measures should be recommended to prevent the spread of PepMV to other regions of Greece. References: (1) I. M. Hanssen and B. P. H. J. Thomma. Mol. Plant Pathol. 11:179, 2010. (2) K. S. Ling et al. J. Virol. Methods 144:65, 2007.

scholarly journals First Report of Cucumber mosaic virus Subgroup II Infecting Lycopersicon esculentum in India

Plant Disease ◽  
2006 ◽  
Vol 90 (11) ◽  
pp. 1457-1457 ◽  
Author(s):  
N. Sudhakar ◽  
D. Nagendra-Prasad ◽  
N. Mohan ◽  
K. Murugesan
Keyword(s):  
Coat Protein ◽  
Cucumber Mosaic Virus ◽  
Mosaic Virus ◽  
Tamil Nadu ◽  
Indian Subcontinent ◽  
Enzyme Linked Immunosorbent Assay ◽  
Infected Leaf ◽  
Polymorphism Analysis ◽  
First Report ◽  
Subgroup Ii

During a survey in January 2006 near Salem in Tamil Nadu (south India), Cucumber mosaic virus was observed infecting tomatoes with an incidence of more than 70%. Plants exhibiting severe mosaic, leaf puckering, and stunted growth were collected, and the virus was identified using diagnostic hosts, evaluation of physical properties of the virus, compound enzyme-linked immunosorbent assay (ELISA) (ELISA Lab, Washington State University, Prosser), reverse-transcription polymerase chain reaction (RT-PCR), and restriction fragment length polymorphism analysis (DSMZ, S. Winter, Germany). To determine the specific CMV subgroup, total RNA was extracted from 50 infected leaf samples using the RNeasy plant RNA isolation kit (Qiagen, Hilden, Germany) and tested for the presence of the complete CMV coat protein gene using specific primers as described by Rizos et al. (1). A fragment of the coat protein was amplified and subsequently digested with MspI to reveal a pattern of two fragments (336 and 538 bp), indicating CMV subgroup II. No evidence of mixed infection with CMV subgroup I was obtained when CMV isolates representing subgroups I (PV-0419) and II (PV-0420), available at the DSMZ Plant Virus Collection, were used as controls. Only CMV subgroup I has been found to predominantly infect tomato in the Indian subcontinent, although Verma et al. (2) identified CMV subgroup II infecting Pelargonium spp., an ornamental plant. To our knowledge, this is the first report of CMV subgroup II infecting tomato crops in India. References: (1) H. Rizos et al. J. Gen. Virol. 73:2099, 1992. (2) N. Verma et al. J. Biol. Sci. 31:47, 2006.

scholarly journals Short communication: Pepino mosaic virus, a new threat for Serbia’s tomatoes

2020 ◽  
Vol 18 (4) ◽  
pp. e10SC05
Author(s):  
Ivana Stankovic ◽  
Ana Vucurovic ◽  
Katarina Zecevic ◽  
Branka Petrovic ◽  
Danijela Ristic ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Rt Pcr ◽  
Tomato Production ◽  
Pepino Mosaic Virus ◽  
Tomato Plants ◽  
Rapid Spread ◽  
Infected Tomato ◽  
Dark Green ◽  
Relationship Of ◽  
Das Elisa

Aim of study: To report the occurrence of Pepino mosaic virus (PepMV) on tomato in Serbia and to genetically characterize Serbian PepMV isolates.Area of study: Tomato samples showing virus-like symptoms were collected in the Bogojevce locality (Jablanica District, Serbia).Material and methods: Collected tomato samples were assayed by DAS-ELISA using antisera against eight economically important or quarantine tomato viruses. Three selected isolates of naturally infected tomato plants were mechanically transmitted to tomato ‘Novosadski jabučar’ seedlings. For confirmation of PepMV infection, RT-PCR was performed using specific primers PepMV TGB F/PepMV UTR R. Maximum-likelihood phylogenetic tree was constructed with 47 complete CP gene sequences of PepMV to determine the genetic relationship of Serbian PepMV isolates with those from other parts of the world.Main results: The results of DAS-ELISA indicated the presence of PepMV in all tested samples. Mechanically inoculated ‘Novosadski jabučar’ seedlings expressed yellow spots and light and dark green patches, bubbling, and curled leaves. All tested tomato plants were RT-PCR positive for the presence of PepMV. The CP sequence analysis revealed that the Serbian PepMV isolates were completely identical among themselves and shared the highest nucleotide identity of 95.1% (99.2% aa identity) with isolate from Spain (FJ263341). Phylogenetic analysis showed clustering of the Serbian PepMV isolates into CH2 strain, but they formed separate subgroup within CH2 strain.Research highlights: This is the first data of the presence of PepMV in protected tomato production in Serbia. Considering increased incidence and rapid spread in Europe, the presence of PepMV on tomato could therefore represent serious threat to this valuable crop in Serbia.

Sign in / Sign up

Export Citation Format

Share Document