scholarly journals Litchi anthracnose caused by Colletotrichum karstii in Guangxi, China

Plant Disease ◽  
2021 ◽  
Author(s):  
Jiang Zhao ◽  
Zhihe Yu ◽  
Yun Wang ◽  
Qili Li ◽  
Lihua Tang ◽  
...  
Keyword(s):  
Species Complex ◽  
Southern China ◽  
Pcr Amplification ◽  
Spore Suspension ◽  
Fruit Rot ◽  
Tween 20 ◽  
Healthy Plant ◽  
Leaf Spots ◽  
Plastic Bags ◽  
Medicinal Value

Litchi (Litchi chinensis Sonn.), a native fruit tree from southern China, has been planted in many subtropical and tropical countries for its fruit which are considered delicious and of medicinal value (Anderson et al. 2013). Anthracnose, one of the most important diseases on litchi, can cause flower drop, fruit drop, and fruit rot. Infected leaves form dark brown spots which turn to reddish brown with gray-white edges. Infected fruits formed dark brown spots which developed eventually to entire black rotted fruits. On both tissues, small dots of acervuli appeared with high humidity (Lai et al. 2004). On 20 April 2019, two leaf spots samples of litchi from different plants were collected from a 2 ha litchi orchard in Xintang Town (N 22.38˚, E 108.61˚), Qinzhou City, Guangxi province. The incidence of leaf spots in the orchard was above 20%. Each sample was cut into multiple pieces targeting zone between symptomatic and healthy plant tissues, disinfected with 75% ethanol for 10 s and 1% sodium hypochlorite (NaClO) for 1 min, and then washed three times with sterilized distilled water. The sterilized leaf tissues were placed on potato dextrose agar (PDA) and incubated at 28°C in darkness for one week. The growing hyphae from each sample was transferred to fresh PDA. The pieces from each leaf yielded a similar fungal morphotype over 75% of the time, and a representative one from each leaf was retained and called LZ1-1 and LZ3-1. The resulting colonies were incubated on the PDA for 7 days with gray to white aerial tufted hyphae, and abundant colorless to pale orange conidia in center of colony. The conidia were smooth, apex obtuse, base truncate, straight, cylindrical, and the contents remained granular. The conidial size of LZ1-1 was 10.6 to 21.4 × 4.5 to 9.1 μm (n=100) and that of LZ3-1 was 12.7 to 16.7 × 5.5 to 8.0 μm (n=100). Appressoria of LZ1-1 (6.9 to 14.9 × 6.0 to 11.1 μm) (n=100) and LZ3-1 (6.5 to 15.4 × 5.4 to 11.4 μm) (n=100) were pale to medium brown, ovoid to bullet-shaped, not nodose, and smooth-walled to undulate. DNA was extracted from two isolates, followed by PCR amplification and sequencing using primers for the rDNA internal transcribed spacer (ITS), actin (ACT), calmodulin (CAL), chitin synthase (CHS-1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and β-tubulin (TUB2) (Damm et al. 2012). The resulting sequences were deposited in GenBank (ITS: MW494453 and MW494454, ACT: MW495034 and MW495035, CAL: MW495036 and MW495037, CHS-1: MW495038 and MW495039, GAPDH: MW495040 and MW495041, TUB2: MW495042 and MW495043). The concatenated sequences comprised of six genomic regions of LZ1-1, LZ3-1 and other sequences of Colletotrichum obtained from GenBank were used to construct a Neighbor-Joining (NJ) tree with 1000 bootstrap replicates using MEGA4 (Tamura et al. 2007). The results revealed both LZ1-1 and LZ3-1 were clustered with type strain of C. karstii with high bootstrap value. The pathogenicity of the two isolates was determined by inoculating on leaves of 1-year-old litchi saplings in the greenhouse. Slight scratches were made on the surface of healthy leaves and 10 μL of spore suspension (106 conidia/mL) in 0.1% Tween 20 were inoculated onto each wounded spot. The blank control groups were inoculated with 10 μL 0.1% Tween 20. Each isolate was inoculated onto at least 27 leaves of three saplings, with each leaf wounded at spots. The inoculated saplings were placed in a greenhouse (12 h/12 h light/dark, 25 ± 2°C), and humidity maintained by covering plastic bags. The leaves inoculated with spore suspension showed reddish-brown spots after one week, while no symptoms were observed in the control. Each fungal isolate was consistently reisolated from inoculated leaves, thus fulfilling Koch's postulates. It was reported that members of the C. acutatum species complex and the C. gloeosporioides species complex could cause anthracnose on litchi (Ling et al. 2019), including C. gloeosporioides, C. siamense, C. fioriniae, and C. simmondsii (Ling et al. 2019; 2020). To our knowledge, this is the first report of anthracnose on litchi in China caused by C. karstii, a member of the C. boninense species complex. This study expands the understanding of the pathogen of anthracnose on litchi which can lead to improved management and control.

scholarly journals First Report of Bacterial Spot Caused by Xanthomonas arboricola pv. pruni on Japanese Plum in Taiwan

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 835-835 ◽  
Author(s):  
Y. M. Shen ◽  
T. C. Huang ◽  
C. H. Chao ◽  
H. L. Liu
Keyword(s):  
First Record ◽  
Tween 20 ◽  
Post Inoculation ◽  
Bacterial Spot ◽  
Japanese Plum ◽  
Specific Pcr ◽  
Leaf Spots ◽  
Plastic Bags ◽  
Xanthomonas Arboricola ◽  
Specific Pcr Assay

Prunus salicina Lindl., also known as Japanese plum, is a temperate-zone fruit tree grown in mountainous areas of Taiwan. The planted area in Taiwan is approximately 3,000 ha. In June 2011, more than 20% of plum fruits harvested in an orchard in Lishan (elevation about 2,000 m) showed black, mostly circular, sunken necrotic lesions. Leaves with a shot-hole appearance and cankered branches were found when investigating the orchard. Bacteria were isolated from symptomatic fruits, leaves, and branches. Isolation on nutrient agar detected colonies that were yellow, mucoid, gram-negative, Xanthomonas-like, and induced hypersensitive responses on tomatoes. Three voucher isolates, BCRC80476, BCRC80478, and BCRC80481, obtained from the fruit, leaf, and branch, respectively, were deposited in the Bioresource Collection and Research Center, Hsinchu, Taiwan. Molecular analyses were conducted for species identification. Sequences of the gyrB gene of the three voucher isolates (GenBank Accession Nos. KC202288, KC202289, and KC202287) were 100% identical to that of Xanthomonas arboricola pv. pruni pathotype strain ICMP51 (2). In addition, DNA fragments of the xopE3 gene (an X. arboricola pv. pruni specific T3E gene, approximately 381 bp) were PCR amplified using the primer pair fw-5′CCGACATTGCCGTCAGCGATCACG3′ and rv-5′AGCGTTCTTGGGTGTGTTGAGCATTTG3′ (1). The bacterial isolates were identified as X. arboricola pv. pruni on the basis of the colony characteristics, sequence homology, and the specific PCR assay. Pathogenicity was confirmed by inoculation of greenhouse-potted P. salicina plants with strains BCRC80476, BCRC80478, and BCRC80481 using bacterial suspensions (6.7 × 108 CFU per ml) in 0.01% Tween 20. Five plants were evenly sprayed with inoculum of each bacterial isolate and covered with plastic bags for 3 days. One week post inoculation, at an average temperature of 19°C, the 15 inoculated plants produced brown-purple spots delimited by a chlorotic margin on the leaves. Three weeks post inoculation, the necrotic leaf spots completely deteriorated, leaving a shot-hole appearance, and the branches showed lesions similar to those observed in the fields. The pathogen was reisolated from the symptomatic tissues, fulfilling Koch's postulates. Control plants sprayed with 0.01% Tween 20 remained symptomless. To our knowledge, this is the first record of X. arboricola pv. pruni causing bacterial spot on P. salicina in Taiwan. References: (1) A. Hajri et al. Appl. Environ. Microbiol. 78:371, 2012. (2) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.

scholarly journals Leaf spot caused by Colletotrichum fructicola on star anise (Illicium verum) in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Jiang Zhao ◽  
Zhihe Yu ◽  
Qili Li ◽  
Lihua Tang ◽  
Tangxun Guo ◽  
...  
Keyword(s):  
Leaf Spot ◽  
Southern China ◽  
Tween 20 ◽  
Healthy Plant ◽  
Conidial Suspension ◽  
Single Spore ◽  
Circular Pattern ◽  
Star Anise ◽  
Fungal Isolates ◽  
Illicium Verum

Star anise (Illicium verum) has been cultivated for centuries in southern China, and its fruit is an important seasoning spice, and can be used as a medicine (Wang et al. 2011). It is grown mainly in Guangxi, Guangdong, Guizhou, and Yunnan provinces, in China. Anthracnose is one of the important diseases of star anise, which seriously affects the yield and quality by infecting twigs, pedicels, fruit stalks and fruits (Liao et al. 2017). When leaf spots first appear, they are round, water-stained, small, dark brown spots, which expands into round separated spots, then the spots become yellowish brown with small black acervuli arranged in a circular pattern. On 22 August 2019, four leaf spot samples of star anise were collected, with two each from Shanglin County and Jinxiu County in Guangxi Province. The plantations in this area of around 8 ha had more than 80% leaf spot incidence. Small pieces of tissues (5 mm × 5 mm) were taken from the zone between symptomatic and healthy plant tissues, surface-disinfected in 75% ethanol for 10 s and 1% NaClO (sodium hypochlorite) for 1 min, and washed three times in sterilized distilled water. The sterilized leaf tissues were placed on potato dextrose agar (PDA) and incubated at 28°C in darkness for a week. Hyphae growing from tissue pieces were subcultured onto fresh PDA. Three of the four leaves yielded cultures resembling Colletotrichum spp. Four fungal isolates were obtained by a single-spore isolation method. The isolates JX1-2 and JX1-5 were collected from Jinxiu County while SL1-2 and SL2-1 were collected from Shanglin County. Genomic DNA was extracted from these four fungal isolates, followed by PCR amplification and sequencing of the rDNA internal transcribed spacer (ITS), actin (ACT), Apn2-Mat1-2 intergenic spacer, partial mating type (Mat1-2) (ApMat), calmodulin (CAL), chitin synthase (CHS-1), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Weir et al. 2012). The sequences have been deposited in GenBank (ITS: MW301215 to MW301218; ACT: MW348965 to MW348968; ApMat: MW348973 to MW348976; CAL: MW348957 to MW348960; CHS-1: MW348969 to MW348972; GAPDH: MW348961 to MW348964). For phylogenetic analysis, MEGAX (Kumar et al. 2018) was used to produce a Maximum Likelihood (ML) tree with 1000 bootstrap replicates, based on a concatenation of the sequenced genomic regions for each of the four isolates from this study as well as sequences of other Colletotrichum species obtained from GenBank. The results revealed that isolates JX1-2, JX1-5, and SL1-2 were C. horii, and SL2-1 was C. fructicola (Weir et al.2012). The resulting colonies were initially white with abundant aerial hyphae, and white-gray after three days at 28°C on PDA. Isolate SL2-1 eventually turned greenish-grey after 14 days, while the center of C. horii isolates turned iron-gray with white-gray marginal. Both species of Colletotrichum had hyaline conidia that were terete, smooth, apex obtuse, base truncate, and there were no significant differences (P>0.05) in conidial size between C. horii (10.5 to 33.6 × 3.6 to 9.3 μm) (n=300) and C. fructicola (13.1 to 16.2 × 4.7 to 7.1 μm) (n=100). Pathogenicity tests were conducted in the greenhouse on 1-year-old star anise seedlings, and performed with a conidial suspension (10 µL of 106 conidia/mL) containing 0.1% Tween 20 placed onto lightly wounded sites on healthy leaves. Light cross-shaped wounds were made with sterilized toothpicks, gently scratching the surface without piercing the leaf. Each isolate was inoculated onto three seedlings, with at least eight leaves per seedling inoculated in two spots after light wounding. Control seedlings were inoculated with water containing 0.1% Tween 20. All inoculated seedlings were maintained in the greenhouse (12 h/12 h light/dark, 25±2°C), and covered with plastic bags to maintain high humidity throughout. The wounded sites inoculated with C. horii darkened to greenish-brown after 24 h, and C. fructicola gave similar symptoms after 36 h. Then the wounds turned to light brown round spots, and after 5 days, the spots expanded to water-stained spots with dots of acervuli arranged in a circular pattern. No symptoms were observed for the non-inoculated control. Each fungal isolate was consistently re-isolated from inoculated leaves, thus fulfilling Koch's postulates. There were significant differences (P<0.05) in aggressiveness between the two species, with C. horii showing larger diameter lesions (averaging 10.2 mm) than C. fructicola (averaging 8.4 mm). Anthracnose of star anise caused by C. horii (Liao et al. 2017) and C. coccdes (Wu et al. 2003) has been previously reported in China; however, to our knowledge, this is the first report of C. fructicola infecting star anise in China. This study may provide reference for further epidemiological study and prevention of anthracnose on star anise.

scholarly journals First Report of Infection of Kiwifruit by Pestalotiopsis sp. in Turkey

Plant Disease ◽  
2001 ◽  
Vol 85 (9) ◽  
pp. 1028-1028 ◽  
Author(s):  
A. Karakaya
Keyword(s):  
Spore Suspension ◽  
Actinidia Deliciosa ◽  
High Humidity ◽  
Disease Symptoms ◽  
First Report ◽  
Leaf Spots ◽  
Plastic Bags ◽  
Brown Leaf ◽  
Pathogenicity Tests

Circular to irregular brown leaf spots, 0.2 to 1.5 cm in diameter, were commonly observed on kiwifruit (Actinidia deliciosa) cv. Hayward plants in the Artvin-Arhavi region of northeastern Turkey. Leaf spots sometimes covered large portions of infected leaves, giving them a blighted appearance. Fruit symptoms consisted of brown, sunken, shriveled areas that were 0.5 to 3 cm in diameter. A fungus, later identified as a Pestalotiopsis sp. (1), was consistently isolated from diseased tissues. Pathogenicity tests were performed on 2-year-old kiwifruit plants and mature fruits at 18/22°C (day/night). A spore suspension (1 × 106 conidia per ml) was sprayed on leaves of 2-year-old kiwifruit plants. Agar pieces, 3 mm in diameter, from 10-day-old cultures also were applied to the leaves. Controls were treated with water and agar alone. Plants were covered with plastic bags for 3 days to ensure high humidity. After 2 weeks, disease symptoms were observed on inoculated leaves. Pestalotiopsis sp. was consistently isolated from these regions. Agar pieces from 10-day-old cultures were placed in small wounds made on the surfaces of mature, surface-disinfested fruits. Controls were treated with agar pieces alone. Softening of tissues next to the wound was observed 1 week after inoculation. Pestalotiopsis sp. was isolated from these areas. No symptoms were observed on noninoculated leaves or fruits. It was concluded that this disease is caused by Pestalotiopsis sp. This is the first report of its occurrence in Turkey. Reference: (1) T. R. Nag Raj. Coelomycetous anamorphs with appendage bearing conidia. Mycologue Publications, Ontario, Canada, 1993.

First Report of Botrytis cinerea Causing Leaf Spot on Strawberry in Florida

Plant Disease ◽  
2021 ◽  
Author(s):  
Marcus Vinicius Marin ◽  
Natalia A. Peres
Keyword(s):  
Botrytis Cinerea ◽  
Leaf Spot ◽  
Fungicide Resistance ◽  
Disease Incidence ◽  
Deionized Water ◽  
Fruit Rot ◽  
Tween 20 ◽  
Isolation Medium ◽  
First Report ◽  
Leaf Spots

During the 2020-2021 Florida strawberry season (October to April), strawberry (Fragaria × ananassa) plants showing leaf spots were observed on samples submitted to the Diagnostic Clinic at the University of Florida’s Gulf Coast Research and Education Center. Disease incidence was up to 5% and observed on four different farms in Plant City, FL on cultivars SensationTM Florida127 and Florida Brilliance. All the samples were submitted early in the season (November) and shared the same nursery source in California. Symptoms consisted of circular or irregular lesions with purple or brown halos, eventually developing leaf blight with sporulation at the center on advanced lesions. Diseased tissues (0.5 mm2) were surface disinfested with 10% bleach solution for 90 s, rinsed twice in sterile deionized water, and plated on general isolation medium (Amiri et al. 2018). Plates were incubated at 25°C and a 12-h photoperiod. A fungus producing white mycelia with sparse sporulation of Botrytis-like spores was consistently isolated. Isolates were single-spored and grown on HA medium to induce sporulation (Leroch et al. 2013). Three isolates (20-291, 20-293, and 20-295) were selected for identification and pathogenicity assays. Resulting cultures on HA had profuse sporulation resembling gray mold. Conidia (n=50) were round to ellipsoid ranging from 9 to 14.6 μm long (Avg=10.8, SD=1.3) and 6.3 to 9.5 μm wide (Avg=7.7, Sd=0.7). No sclerotia formation was observed on GI and HA medium. Based on morphology, the pathogen was tentatively identified as Botrytis cinerea (Hong et al. 2001; Jarvis 1977). DNA was extracted from the same three isolates using the FastDNA kit (MP Biomedicals, Solon, OH), and the heat shock protein (HSP60), RNA polymerase II-binding (RPB2), and glyceraldehyde 3-phosphate dehydrogenase (G3PDH) genes were amplified (Staats et al. 2004). Sequences were deposited in GenBank (accession nos. MZ288746 - MZ288754). BLASTn searches revealed that isolates were 100% identical to B. cinerea reported causing leaf spot on strawberry in California; accession numbers MK919494 (HSP60, 996/996 bp), MK919495 (RPB2, 1131/1131 bp), and MK919496 (G3PDH, 877/877 bp). To test for pathogenicity, four one-month-old plants of 'Florida Brilliance' were used per isolate and control treatment. Spores were harvested from two-week-old cultures grown on HA medium, and the suspension adjusted to 106 spores/mL in a solution of 0.1% of Tween 20. Plants were spray inoculated until run-off and kept inside clear plastic boxes for 48 h. Control plants were sprayed with sterile deionized water. Afterward, plants were kept in a misting table in the greenhouse with a water regime of 3 s every 10 min during the day. Disease incidence was evaluated weekly, and the experiment repeated once. Two weeks after inoculation, leaf spots were observed in all inoculated plants, while controls remained healthy. Fungi morphologically identical to the original isolates were re-isolated from the diseased tissues. To our knowledge, this is the first report of B. cinerea causing leaf spot on strawberry in Florida. This disease was recently reported in California (Mansouripour and Holmes 2020), which is where the transplants originated from. Considering the disease was observed early in the Florida season, it is likely that it was introduced with transplants from the nursery. This pathogen is also the causal agent of Botrytis fruit rot, which is considered a major disease of strawberry, and a previous study has shown that populations resistant to multiple fungicides are introduced with transplants (Mertely et al. 2018, Oliveira et al. 2018). While Botrytis leaf spot is currently considered rare and of minor significance (Mansouripour and Holmes 2020), it could contribute to the spread of fungicide resistance to from nursery to strawberry fruit production fields. Efforts should be implemented to monitor its occurrence and spread considering the high variability and fungicide resistance profile of this pathogen.

scholarly journals First Report of Botryosphaeria dothidea Causing Fruit Rot of Plum in Spain

Plant Disease ◽  
2013 ◽  
Vol 97 (4) ◽  
pp. 556-556 ◽  
Author(s):  
L. F. Roca ◽  
M. C. Raya ◽  
A. Trapero
Keyword(s):  
Relative Humidity ◽  
Its Region ◽  
Southern Spain ◽  
Stone Fruit ◽  
Fruit Rot ◽  
Tween 20 ◽  
Botryosphaeria Dothidea ◽  
First Report ◽  
Leaf Spots ◽  
Morphological Criteria

Species in the Botryosphaeriaceae are known to produce cankers, dieback, blights, and leaf spots on many hosts, mainly under stress conditions. Several Botryosphaeria spp. may also cause pre- or post-harvest decay of stone fruit, such as peaches (2). In June 2012, fruit of plum (Prunus domestica cv. Golden Japan) showing soft, brown, and slightly sunken necrotic lesions were observed in several orchards affected by hail in Cordoba province (southern Spain). Symptomatic fruit were collected and incubated at 25°C and 100% relative humidity. Isolations were done on potato dextrose agar (PDA). Mycelium and black pycnidia developed on the surface of incubated fruit and on PDA plates. Conidia were hyaline, aseptate, and fusoid. According to morphological criteria, the fungus was identified as Fusicoccum aesculi, the anamorph of Botryosphaeria dothidea (3). The internal transcribed spacer (ITS) region of rDNA was amplified with primers ITS4/ITS5 and sequenced. BLAST analysis of the 528-bp fragment showed 100% homology with the sequence of B. dothidea. Pathogenicity tests were performed on immature healthy fruit (2 weeks before harvest) of the same cultivar from the same orchards. Fruit were washed in deionized water with Tween 20 (Polyoxyethylene 20 sorbitan monolaureate 99%, 0.1 ml/liter) and surface sterilized in 10% sodium hypochlorite for 1 min. Twenty-four fruit were inoculated using mycelial-agar discs. Twelve fruit were previously wounded with a sterile 0.5-mm-diameter needle. The same number of fruit, wounded and unwounded, served as a control. All fruit were incubated at 25°C and 100% relative humidity. Seven days after inoculation, 83% of wounded inoculated fruit showed rot symptoms. After 9 days, fruit rot symptoms started to appear on unwounded inoculated fruit. Twenty days after inoculation, 100% of wounded and unwounded fruit showed rot symptoms that led to mummification of the fruit. Pycnidia developed on inoculated fruit and the fungus was reisolated. No symptoms developed on control fruit. These results demonstrate that B. dothidea is pathogenic on plum and that wounds favor infection, although they are not needed. To our knowledge this is the first report of B. dothidea causing fruit rot of plum in Spain. This pathogen is well known in southern Spain causing a serious fruit rot of olive (1) and could have a great impact on plum production in this region, especially when there is damage to the fruits as occurred this year with hail. References: (1) J. Moral et al. Phytopathology 100:1340, 2010. (2) J. M. Ogawa et al. Compendium of Stone Fruit Diseases. APS Press, St. Paul, MN, 1995. (3) B. Slippers et al. Mycologia 96:83, 2004.

scholarly journals Veronica sibirica Leaf Spots Caused by Phacellium veronicae, a New Disease in China

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1662-1662 ◽  
Author(s):  
Q. R. Bai ◽  
S. Han ◽  
Y. Y. Xie ◽  
J. Gao ◽  
Y. Li
Keyword(s):  
Morphological Characteristics ◽  
Its Region ◽  
Control Treatment ◽  
Perennial Herb ◽  
Conidial Suspension ◽  
New Disease ◽  
Medical College ◽  
Leaf Spots ◽  
Plastic Bags ◽  
Insect Bites

Veronica sibirica (Veronicastrum sibiricum) is an erect perennial herb, an ornamental, and a traditional Chinese medicine plant distributed mostly in northeastern, northern, and northwestern China. It has dehumidifying and detoxifying properties, and is mainly used for the treatment of cold, sore throat, mumps, rheumatism, and insect bites (4). In June 2008 through 2012, leaf spots of V. sibirica were observed in the Medicinal Herb Garden of Jilin Agricultural University (43°48′N, 125°23′E) and the medicinal plantations of Antu County (43°6′N, 128°53′E), Jilin Province. Leaf spots were amphigenous, subcircular, angular-irregular, brown, and 1 to 10 mm in diameter; they occasionally merged into a larger spot with an indefinite margin or with a pale center and dark border. Pale conidiomata were hypophyllous and scattered on the spots. The conidiophores were 100 to 400 μm high and clustered together to form synnemata 20 to 50 μm in diameter, which splayed out apically and formed loose to dense capitula. Conidiophores occasionally emerged through the stomata individually and produced conidia on the surface of the infected leaves. The conidiogenous cell terminal was geniculate-sinuous with somewhat thickened and darkened conidial scars. Conidia were solitary or catenulate, ellipsoid-ovoid or subcylindric-fusiform, hyaline and spinulose, 4.01 to 7.18 × 11.16 to 20.62 μm with obtuse to somewhat attenuated ends, and slightly thickened, darkened hila. Six isolates were obtained from necrotic tissue of leaf spots and cultured on potato dextrose agar at 25°C. After incubation for 14 days, colony surfaces were white to pinkish. The colony diameter increased by 12 mm after 21 days' incubation. Hyphae were hyaline, septate, and branched. Conidiophores grew individually or fascicularly. The symptoms and morphological characteristics were consistent with previous descriptions (1,2), and the fungus was identified as Phacellium veronicae (Pass.) (U. Braun 1990). The internal transcribed spacer (ITS) region of the nuclear rDNA was amplified using primers ITS4/ITS5 (3). The ITS was identical among all six isolates (HE995799) and 98% identical to that of P. veronicae (JQ920427, HQ690097). Pathogenicity was confirmed by spraying five 1-year-old V. sibirica seedlings with a conidial suspension (106 conidia/ml) of each isolate and five seedlings with sterile water as a control treatment. Plants were grown in the greenhouse at 20 to 25°C and were covered with plastic bags to maintain humidity on the foliage for 72 h. After 15 days, the same symptoms appeared on the leaves as described earlier for the field-grown plants; the control plants remained healthy. The same fungus was reisolated from the leaf spots of inoculated plants. Currently, the economic importance of this disease is limited, but it may become a more significant problem, as the cultivated area of V. sibirica is increasing. To our knowledge, although P. veronicae was recorded on the other species of Veronica (V. austriaca, V. chamaedrys, V. grandis, V. longifolia, V. paniculata, and V. spicata ssp. incana) in Europe (Germany, Denmark, Ireland, Romania) and V. wormskjoldii in North America (Canada) (1), this is the first report of V. sibirica leaf spots caused by P. veronicae in the world, and it is a new disease in China. References: (1) U. Braun. A monograph of Cercosporella, Ramularia and allied genera (phytopathogenic Hyphomycetes) 2, IHW-Verlag, Germany, 1998. (2) U. Braun. Nova Hedwigia 50:499, 1990. (3) D. E. L. Cooke et al. Mycol. Res. 101:667, 1997. (4) Jiangsu New Medical College. Dictionary of Chinese Materia Medica. Shanghai: Shanghai Scientific and Technical Publishers, China, 1977.

ISSR-Derived Species-Specific SCAR Marker for Rapid and Accurate Authentication of Ocimum tenuiflorum L.

Planta Medica ◽  
2017 ◽  
Vol 84 (02) ◽  
pp. 117-122 ◽  
Author(s):  
Amit Kumar ◽  
Vereena Rodrigues ◽  
Priyanka Mishra ◽  
Kuppusamy Baskaran ◽  
Ashutosh Shukla ◽  
...  
Keyword(s):  
Pcr Amplification ◽  
High Volume ◽  
Inter Simple Sequence Repeat ◽  
Rapid Identification ◽  
Medicinal Species ◽  
Accurate Identification ◽  
Sequence Characterized Amplified Region ◽  
Medicinal Value ◽  
Ocimum Tenuiflorum ◽  
Species Specific

Abstract Ocimum tenuiflorum has been widely used in traditional medicine and has high medicinal value. High volume trade of this potential medicinal plant species led to unscrupulous adulteration of both crude drugs as well as formulations. Morphology-based authentication is difficult in cases of incomplete or damaged samples and in dried herbal materials. In such cases, PCR-based molecular methods may aid in accurate identification. The present study aimed at developing species-specific DNA marker(s) for the authentication of O. tenuiflorum. A species-specific amplicon (279 bp) generated through an inter-simple sequence repeat marker (UBC 835) in all individuals of O. tenuiflorum was cloned, sequenced, and a primer pair was developed (designated as CIM-OT-835F/CIM-OT-835R). The newly developed sequence characterized amplified region marker was validated through PCR amplification in all available seven species of Ocimum, and its specificity for O. tenuiflorum was confirmed with the consistent generation of an amplicon of 177 bp. The developed marker can be used for accurate and rapid identification of the species for certification purposes and will be useful in quality control of medicinal preparations containing this important medicinal species.

scholarly journals Thlaspi arvense, a New Host for Alternaria brassicicola

Plant Disease ◽  
1998 ◽  
Vol 82 (8) ◽  
pp. 960-960 ◽  
Author(s):  
A. C. Cobb ◽  
H. R. Dillard
Keyword(s):  
Leaf Spot ◽  
Production Systems ◽  
Geographic Location ◽  
Alternaria Brassicicola ◽  
New Host ◽  
Cornell University ◽  
Thlaspi Arvense ◽  
Leaf Spots ◽  
Plastic Bags ◽  
Field Pennycress

A leaf spot was observed on cruciferous weeds growing in a cabbage field located in Geneva, NY, on 1 August 1996. The leaf spots on the weeds were dark gray to black in color and varied in size from pinpoints to 1 mm in diameter. The cabbage (Brassica oleracea L. var. capitata L.) was infected with Alternaria brassicicola (Schwein.) Wiltshire, the cause of Alternaria leaf spot. The weeds were identified as Thlaspi arvense L., a winter annual commonly referred to as field pennycress, stinkweed, or fanweed depending on geographic location. Isolations from the diseased weed tissue yielded A. brassicicola (2). The numerous conidia occurred in chains of 10 or more, ranged in size from 14 to 53 μm in length, were 5 to 18 μm wide, contained from 1 to 6 transverse septa with rare longitudinal septa, and were olivaceous in color. An apical beak was absent. On potato dextrose agar (PDA) the colony was dark olive-green to black in color and velvety. Seed was collected from the T. arvense plannts in the spring of 1997. One hundred seeds were placed in petri plates containing PDA amended with 0.01% of chloramphenicol and streptomycin sulfate. A. brassicicola was not isolated from the seeds. A different area of the field was planted to cabbage in 1997 and the cruciferous weeds were allowed to grow. The 1997 population of T. arvense consisted of plants from the previous season that flowered early and plants from seeds that germinated late in the season but did not flower. A. brassicicola was isolated from nonflowering weeds in September and from flowering weeds in October. Nonflowering plants were removed from the field in November, planted in pots, and placed in the greenhouse to induce flowering. Identity of both plant populations was confirmed as T. arvense (Warren Lamboy, Cornell University, Geneva, NY). Pathogencity of A. brassicicola isolates from T. arvense was demonstrated on cabbage and T. arvense by following Koch's postulates. Conidia (105) from a 5-day-old culture isolated from T. arvense grown on PDA were atomized onto field pennycress and cabbage plants with a Preval sprayer. The plants were enclosed in plastic bags and put under lathe shading in the greenhouse. The pathogen was reisolated from symptomatic tissue of both plants after 5 days. This weed could serve as a potential source of A. brassicicola inoculum because it is not controlled by herbicides used in crucifer production systems. Alternaria raphani has been reported on T. arvense in Canada (1). This is believed to be the first report of A. brassicicola on T. arvense. References: (1) K. Mortensen et al. Can. Plant Dis. Surv. 73:129, 1993. (2) P. Neergaard. 1945. Danish Species of Alternaria and Stemphylium. Oxford University Press, London. pp. 137–138.

scholarly journals First Report of a Fruit Rot of Pumpkin Caused by Acidivorax avenae subsp. citrulli in Georgia

Plant Disease ◽  
1999 ◽  
Vol 83 (2) ◽  
pp. 199-199 ◽  
Author(s):  
D. B. Langston ◽  
R. D. Walcott ◽  
R. D. Gitaitis ◽  
F. H. Sanders
Keyword(s):  
Polyclonal Antibodies ◽  
Pcr Amplification ◽  
Tween 80 ◽  
Soft Rot ◽  
Fruit Rot ◽  
Identification System ◽  
Banding Patterns ◽  
First Report ◽  
Microbial Identification ◽  
Necrotic Spots

In September 1998, a fruit rot was reported affecting pumpkin (Cucurbita pepo) in a commercial field in Terrell Co., Georgia. Symptoms on the surface of fruit occurred as round, necrotic spots or cracks a few millimeters in diameter. With age, the tissue surrounding these lesions became soft and wrinkled. A soft rot expanded into the flesh of the pumpkin, originating from the lesions observed on the surface. In time, infected pumpkins totally collapsed. V-shaped, necrotic lesions occurred at the margin of the leaf and extended inward toward the mid-rib. Samples were collected from the field and bacteria were isolated from fruit and leaf lesions onto King's medium B (1). The bacterium isolated was rod shaped, gram negative, nonflourescent, oxidase positive, Tween 80 positive, carboxymethyl cellulose positive, β-OH butyrate positive, and malonate negative. The bacterium reacted positively with polyclonal antibodies specific for the watermelon fruit blotch pathogen Acidivorax avenae subsp. citrulli and was identified as A. avenae subsp. citrulli by MIDI (Microbial Identification System, Newark, DE) according to statistical analysis of fatty acid data. Results from polymerase chain reaction (PCR) amplification of the bacterium isolated from pumpkin yielded 360-bp fragments that, when digested with the restriction enzyme HaeIII, had DNA banding patterns identical to those of stock A. avenae subsp. citrulli DNA. Koch's postulates were completed successfully with 2-week-old watermelon seedlings. This is the first report of A. avenae subsp. citrulli causing fruit rot of pumpkin in Georgia. Reference: (1) E. O. King et al. J. Lab. Clin. Med. 44:301, 1954.

Sign in / Sign up

Export Citation Format

Share Document