First Report of the Stubby-Root Nematode (Paratrichodorus allius) From a Corn Field in Ohio

Stubby-root nematodes (family Trichoridae) are an economically important group of ectoparasites that feed on roots, vector tobraviruses, and cause substantial crop loss (1,2,3). In June 2013, 48 soil samples were submitted to the Nematology Laboratory at Ohio State University for nematode analysis from a field planted to corn in Wood County, Ohio. The soil texture was sandy and the field was previously planted to wheat and soybean in 2011 and 2012, respectively. Nematodes were extracted from 100 cm3 soil by decanting and sieving followed by sucrose centrifugal flotation. Phytoparasitic nematodes were identified and counted based on morphological traits to genus at 40× to 63× magnification. Nematode genera parasitic to corn recovered from these samples included Helicotylenchus, Hoplolaimus, Paratrichodorus, Pratylenchus, and Tylenchorhynchus. Stubby-root nematodes (Paratrichodorus sp.) were detected in more than 60% of the samples with a maximum count of 52 per 100 cm3 soil. Individual stubby-root nematodes were hand-picked and identified to species under a compound light microscope as Paratrichodorus allius (Jensen, 1963) Siddiqi, 1974 according to morphological and morphometric characteristics (1). Females (n = 14) were observed with the intestine not anteriorly overlapping the esophagus, posterior subventral esophageal glands overlapping the intestine, caudal pores, absence of spermatheca, and vaginal sclerotization reduced in lateral view. Body length ranged from 475.8 to 840.5 μm (mean = 652.2 μm), and onchiostylet length ranged from 37.7 to 47.4 μm (mean = 42.9 μm). DNA was extracted from single adult females (n = 4) and the 18S rRNA region was amplified with 18S (TTGATTACGTCCCTGCCCTTT) and 26S (TTTCACTCGCCGTTACTAAGG) primers (4). PCR products were purified and sequenced. The sequence was deposited in GenBank (Accession No. KF887974) and was compared with previously deposited sequences by means of BLAST search. The comparison revealed a sequence similarity of 98 to 99% with both P. allius and P. teres (AM269895, AM087124, AJ439572, FJ040484, AJ439575, and AM087125). P. allius and P. teres can be difficult to discriminate using both morphological characteristics and molecular sequencing (3). Therefore, a universal primer (BL18: 5′ CCCGTCGMTACTACCGATT 3′) and species-specific primers designed to produce PCR products of 432 bp (PAR2: 5′-CCGTTCAAACGCGTATATGATC-3′) and 677 bp (PTR4: 5′-CCTGACAAGC'IWGCACTAGC-3′) were used for P. allius and P. teres, respectively (3). DNA from individuals used for sequencing was used in PCR reactions with each species-specific primer. DNA samples yielded PCR products of 432 bp with the P. allius-specific primer set and had no reaction with the P. teres-specific primer set. Molecular results and morphological observations confirmed the presence of P. allius in the samples. P. allius is a polyphagous migratory ectoparasite and a vector for Tobacco rattle virus (TRV). The known distribution of P. allius has previously been limited to the Pacific Northwest, where it was originally described as an important pathogen in potato production (2,3). Corn and wheat have been reported as suitable hosts; although they are not susceptible to TRV, crop loss may result from direct damage to roots (2,3). Nematode management recommendations for corn and wheat will depend on the distribution of this nematode. To our knowledge, this is the first report of P. allius in Ohio. References: (1) W. Decreamer. Rev. Nematol. 3:81, 1980. (2) H. Mojtahedi and G. S. Santo. Am. J. Potato Res. 76:273, 1999. (3) E. Riga et al. Am. J. Potato Res. 84:2, 2007. (4) T. C. Vrain et al. Fundam. Appl. Nematol. 15:563, 1992.

Download Full-text

First Report of a 16SrII-D Subgroup Phytoplasma Associated with Pale Purple Coneflower Witches'-Broom Disease in Australia

Plant Disease ◽

10.1094/pdis-03-11-0155 ◽

2011 ◽

Vol 95 (6) ◽

pp. 773-773 ◽

Cited By ~ 7

Author(s):

T. L. Pearce ◽

J. B. Scott ◽

S. J. Pethybridge

Keyword(s):

Sequence Homology ◽

Sequence Similarity ◽

Universal Primer ◽

First Report ◽

Purple Coneflower ◽

Echinacea Pallida ◽

Pcr Products ◽

Broom Disease ◽

Plant Pathol ◽

Single Field

Pale purple coneflower, Echinacea pallida (Nutt.) Nutt., is an herbaceous perennial cultivated for its ornamental and medicinal properties. In 2005, phytoplasma-like symptoms, including virescence, phyllody, and chlorotic leaves, were first observed in coneflower fields in northern Tasmania, Australia. During the 2010–2011 growing season, the incidence of affected plants was estimated to be 12% within a single field. Total DNA was extracted from symptomatic plants with a DNeasy Plant Mini Kit (QIAGEN Inc., Valencia, CA) according to the manufacturer's instructions. DNA was also extracted, as described above, from asymptomatic coneflower seedlings obtained by germinating surface-sterilized seed on water agar. DNA was amplified via a nested PCR using universal primer pairs P1/P7 followed by R16F2n/R16R2 to detect putative phytoplasmas (2). Amplifications yielded expected products of 1.8 and 1.2 kb, respectively, only from symptomatic samples. Subsequently, PCR products from six arbitrarily selected samples were used for sequencing (Genome Lab Dye Terminator Cycling Sequence with Quick Start Chemistry) and read in a CEQ8000 sequencer (Beckman Coulter Inc., Brea, CA). Sequence homology indicated 100% similarity between isolates designated EWB1 to EWB4 (GenBank Accession Nos. JF340075 and JF340077 to JF340079) and between EWB5 and EWB6 (JF340076 and JF40080). Sequence homology between the two observed groups was 99.7%, resulting from a 4-bp difference in the R16F2n primer region. Blast search revealed isolates EWB1 to EWB4 were 100% homologous with Catharanthus roseus phytoplasma (EU096500.1), Tomato big bud phytoplasma (EF193359.1), Scaevola witches'-broom phytoplasma (AB257291.1), and Mollicutes sp. (Y10097.1 and Y10096.1). Moreover, isolates EWB5 and EWB6 shared 99% sequence identity with the above isolates. iPhyClassifier (4) was used to perform sequence similarity and generate virtual restriction fragment length polymorphism (RFLP) profiles. The 16S rDNA sequence of isolates EWB1 to EWB4 and EWB5 to EWB6 shared 100 and 99.7% similarity, respectively, to the ‘Candidatus Phytoplasma australasiae’ reference strain (Y10097). RFLP profiles from all isolates suggested that they belonged to the 16SrII-D subgroup. To our knowledge, this is the first report of a 16SrII-D subgroup phytoplasma infecting E. pallida in Australia. Aster yellow phytoplasmas (16SrI-C subgroup) infections of E. purpurea have been recorded in Slovenia (3) and southern Bohemia (1). References: (1) J. Franova et al. Eur. J. Plant Pathol. 123:85, 2009. (2) I. M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998. (3) S. Radišek et al. Plant Pathol. 58:392, 2009. (4) Y. Zhao et al. Int. J. Syst. Evol. Microbiol. 59:2582, 2009.

Download Full-text

First Report of Stem and Foliage Blight of Chrysanthemum Caused by Phytophthora drechsleri in the United States

Plant Disease ◽

10.1094/pdis-03-21-0631-pdn ◽

2021 ◽

Author(s):

Charles Krasnow ◽

Nancy Rechcigl ◽

Jennifer Olson ◽

Linus Schmitz ◽

Steven N. Jeffers

Keyword(s):

United States ◽

South Carolina ◽

Sequence Similarity ◽

Morphological Characteristics ◽

The United States ◽

Universal Primers ◽

Broad Host Range ◽

Pathogenicity Test ◽

First Report ◽

Foliage Blight

Chrysanthemum (Chrysanthemum × morifolium) plants exhibiting stem and foliage blight were observed in a commercial nursery in eastern Oklahoma in June 2019. Disease symptoms were observed on ~10% of plants during a period of frequent rain and high temperatures (26-36°C). Dark brown lesions girdled the stems of symptomatic plants and leaves were wilted and necrotic. The crown and roots were asymptomatic and not discolored. A species of Phytophthora was consistently isolated from the stems of diseased plants on selective V8 agar (Lamour and Hausbeck 2000). The Phytophthora sp. produced ellipsoid to obpyriform sporangia that were non-papillate and persistent on V8 agar plugs submerged in distilled water for 8 h. Sporangia formed on long sporangiophores and measured 50.5 (45-60) × 29.8 (25-35) µm. Oospores and chlamydospores were not formed by individual isolates. Mycelium growth was present at 35°C. Isolates were tentatively identified as P. drechsleri using morphological characteristics and growth at 35°C (Erwin and Ribeiro 1996). DNA was extracted from mycelium of four isolates, and the internal transcribed spacer (ITS) region was amplified using universal primers ITS 4 and ITS 6. The PCR product was sequenced and a BLASTn search showed 100% sequence similarity to P. drechsleri (GenBank Accession Nos. KJ755118 and GU111625), a common species of Phytophthora that has been observed on ornamental and vegetable crops in the U.S. (Erwin and Ribeiro 1996). The gene sequences for each isolate were deposited in GenBank (accession Nos. MW315961, MW315962, MW315963, and MW315964). These four isolates were paired with known A1 and A2 isolates on super clarified V8 agar (Jeffers 2015), and all four were mating type A1. They also were sensitive to the fungicide mefenoxam at 100 ppm (Olson et al. 2013). To confirm pathogenicity, 4-week-old ‘Brandi Burgundy’ chrysanthemum plants were grown in 10-cm pots containing a peat potting medium. Plants (n = 7) were atomized with 1 ml of zoospore suspension containing 5 × 103 zoospores of each isolate. Control plants received sterile water. Plants were maintained at 100% RH for 24 h and then placed in a protected shade-structure where temperatures ranged from 19-32°C. All plants displayed symptoms of stem and foliage blight in 2-3 days. Symptoms that developed on infected plants were similar to those observed in the nursery. Several inoculated plants died, but stem blight, dieback, and foliar wilt were primarily observed. Disease severity averaged 50-60% on inoculated plants 15 days after inoculation. Control plants did not develop symptoms. The pathogen was consistently isolated from stems of symptomatic plants and verified as P. drechsleri based on morphology. The pathogenicity test was repeated with similar results. P. drechsleri has a broad host range (Erwin and Ribeiro 1996; Farr et al. 2021), including green beans (Phaseolus vulgaris), which are susceptible to seedling blight and pod rot in eastern Oklahoma. Previously, P. drechsleri has been reported on chrysanthemums in Argentina (Frezzi 1950), Pennsylvania (Molnar et al. 2020), and South Carolina (Camacho 2009). Chrysanthemums are widely grown in nurseries in the Midwest and other regions of the USA for local and national markets. This is the first report of P. drechsleri causing stem and foliage blight on chrysanthemum species in the United States. Identifying sources of primary inoculum may be necessary to limit economic loss from P. drechsleri.

Download Full-text

First Report of Colletotrichum acutatum sensu lato Causing Anthracnose on Gooseberry Fruits in the Czech Republic

Plant Disease ◽

10.1094/pdis-01-13-0080-pdn ◽

2013 ◽

Vol 97 (9) ◽

pp. 1249-1249 ◽

Cited By ~ 1

Author(s):

J. Víchová ◽

B. Jílková ◽

R. Pokorný

Keyword(s):

Czech Republic ◽

Morphological Characteristics ◽

Colletotrichum Acutatum ◽

Species Determination ◽

Specific Primers ◽

The Czech Republic ◽

First Report ◽

Sterile Needle ◽

Pcr Products ◽

Pathogen Dna

Gooseberry (Ribes uva-crispa L.) is a commonly grown fruit tree or bush in the Czech Republic. Colletotrichum acutatum J. H. Simmonds is a polyphagous fungal plant pathogen. This pathogen has been reported causing anthracnose on strawberry in the Czech Republic (2), and recently it has become an important pathogen on the fruits of apple and tomato (4). In 2012, anthracnose symptoms were noticed on fruits of gooseberry (locality Pribyslavice, near Brno). The symptoms on fruit surfaces were round, brown, shriveled, sunken spots of 1.2 to 2.0 cm, with orange conidial masses on the spots. The pathogen was isolated from symptomatic fruits on PDA and cultured at 25 ± 2°C. The color of colonies varied with age from white to gray with occurrence of orange conidial masses. Conidia were colorless and fusiform, size 13 to 17 × 4 to 5 μm (n = 100). The morphological characteristics classified the pathogen as a Colletotrichum sp. To fulfill Koch's postulates, 25 disinfested healthy gooseberry fruits were pinpricked by sterile needle and 10 μl of spore suspension (1 × 105 conidia ml–1) was inoculated by pipetting into the wound. Control fruits were treated with sterile distilled water. The fruits were transferred to a growth cabinet and maintained at a temperature of 25 ± 2°C, relative humidity 70 ± 5%. Similar anthracnose symptoms were observed on all of gooseberry fruits a week after inoculation, whereas no symptoms appeared on control fruits. The pathogen was reisolated from infected fruits. Species determination of the isolates was confirmed by PCR. Specific primers designed in region ITS1, the 5.8S RNA gene, and region ITS2 of the pathogen DNA were selected. Specific primers CaInt2 and ITS4 were used to identify C. acutatum (3), and primers CgInt and ITS4 were used to determine C. gloeosporioides isolate CCM 177 (1), which was used as a control. Our isolates yielded PCR products (size 490 bp) only with primers designed for C. acutatum. The C. gloeosporioides isolate yielded PCR product (size 450 bp) only with CgInt and ITS4 primers. PCR products were sequenced and identified with the BLAST program. The sequence of the gooseberry fruit isolates (Accession No. JX843763 and JX843764) matched with 100% similarity to the C. acutatum sequences in GenBank. To our knowledge, this is the first report of C. acutatum sensu lato on gooseberry fruits in the Czech Republic. This pathogen can endanger the production of gooseberry fruits in this region. References: (1) P. R. Mills et al. FEMS Microbiol. Lett., 98:137, 1992. (2) D. Novotný et al. Plant Dis. 91:1516, 2007. (3) S. Sreenivasaprasad et al. Plant Pathol. 45:650, 1996. (4) J. Víchová et al. Plant Dis. 96:769, 2012.

Download Full-text

First Report of Powdery Mildew Caused by Golovinomyces ambrosiae on Verbena bonariensis in Korea

Plant Disease ◽

10.1094/pdis-02-21-0349-pdn ◽

2021 ◽

Author(s):

In-Young Choi ◽

Ho-Jong Ju ◽

Kui-Jae Lee ◽

Hyeon-Dong Shin

Keyword(s):

Powdery Mildew ◽

Large Subunit ◽

Morphological Characteristics ◽

Morphological Characterization ◽

Control Measures ◽

Width Ratio ◽

Infected Leaf ◽

Voucher Specimen ◽

First Report ◽

Pcr Products

Verbena bonariensis L., named as purple-top vervain or Argentinian vervain, is native to tropical South America. It is cultivated worldwide as an ornamental plant. During summer and autumn of 2020, over 50% of the leaves of V. bonariensis were found infected with powdery mildew in a flower garden in Seoul (37°35'19"N 127°01'07"E), Korea. White, superficial mycelia developed initially on the leaves and subsequently covered surfaces of leaves and stems, are resulting in leaf discoloration, early defoliation, and shoots distortion. Heavily infected plants lost ornamental value. A representative voucher specimen was deposited in the Korea University herbarium (KUS-F32168). Morphological characterization and measurements of conidiophores and conidia were carried out using fresh samples. Microscopic observation showed that aAppressoria on the superficial hypha were nipple-shaped, but rarely found or nearly absent. Conidiophores (n = 30) were cylindrical, 110 to 220 × 10 to 12 µm, and produced 2 to 5 immature conidia in chains with a sinuate outline, followed by 2 to 3 short cells. Foot-cells of conidiophores were straight, cylindrical, and 46 to 90 μm long. Conidia (n = 30) were hyaline, ellipsoid to doliiform, 28 to 40 × 18 to 24 μm with a length/width ratio of 1.3 to 2.0, and contained small be like oil-like drops, but without distinct fibrosin bodies. Primary conidia were apically rounded and sub-truncate at the base. Germ tubes were produced at perihilar position of the conidia. Chasmothecia were not observed. These morphological characteristics were typical of the conidial stage of the genus Golovinomyces (Braun and Cook 2012, Qiu et al. 2020). To identify the fungus, rDNA was extracted from the voucher sample. PCR products were amplified using the primer pair ITS1F/PM6 for internal transcribed spacer (ITS), and PM3/TW14 for the large subunit (LSU) of the rDNA (Takamatsu and Kano 2001). The resulting sequences were registered to GenBank (MW599742 for ITS, and MW599743 for LSU). Using Blast’n search of GenBank, sequences showed 100% identity for ITS and LSU with G. ambrosiae (MT355557, KX987303, MH078047 for ITS, and AB769427, AB769426 for LSU), respectively. Thus, based on morphology and molecular analysis, the isolate on V. bonariensis in Korea was identified as G. ambrosiae (Schwein.) U. Braun & R.T.A. Cook. Pathogenicity tests were carried out by touching an infected leaf onto healthy leaves of disease-free pot-grown plants using a replication of five plants, with five non-inoculated plants used as controls. After 7 days, typical powdery mildew colonies started to appear on the inoculated leaves. The fungus on inoculated leaves was morphologically identical to that originally observed in the field. All non-inoculated control leaves remained symptomless. On different global Verbena species, tThere have been many reports of Golovinomyces powdery mildews including G. cichoracearum s.lat., G. longipes, G. monardae, G. orontii s.lat., and G. verbenae (Farr and Rossman 2021). In China, G. verbenae was recorded on V.erbena phlogiflora (Liu et al. 2006). Golovinomyces powdery mildew has not been reported on Verbena spp. in Korea. Powdery mildew has been reported on V. bonariensis in California, but identity of the causal agent had not been reported. To our knowledge, this is the first report on the identity of the powdery mildew caused by G. ambrosiae on V. bonariensis in Korea. Since heavily infected plants lost ornamental value, appropriate control measures should be developed.

Download Full-text

First Report of Post-Harvest Tuber Rot of American Groundnut (Apios americana) Caused by Fusarium acuminatum

Plant Disease ◽

10.1094/pdis-07-20-1497-pdn ◽

2021 ◽

Author(s):

Jin Cheon Park ◽

Yeonghoon Lee ◽

Eom-Ji Hwang ◽

Da Eun Kwon ◽

won park ◽

...

Keyword(s):

Sequence Similarity ◽

Morphological Characteristics ◽

Pcr Analysis ◽

Tuber Quality ◽

Species Identity ◽

First Report ◽

Fusarium Acuminatum ◽

Post Harvest ◽

Apios Americana ◽

Tuber Rot

Apios americana Medik, commonly known as American groundnut, is a leguminous perennial vine crop native to North America and is cultivated in Japan and Korea (Chu et al. 2019). Its tubers are edible and believed to be very nutritious, especially for women just after childbirth. The tubers also contain secondary metabolites, saponin and genistein, which is good for human health (Ichige et al. 2013). However, the storage of tubers at inappropriate temperatures and humidity levels can cause severe fungal infection, and adversely affect tuber quality. During March and April 2020, a white to pale-orange fungal mycelia were observed on stored American groundnut tubers, with 10 to 15% of seed tubers rotten. Infected tubers were collected, and fungal isolates were isolated on potato dextrose agar (PDA) using the single spore isolation method (Leslie and Summerell 2006). A pure culture (isolate JC20003) was obtained and stored at the Bioenergy Crop Research Institute, NICS, Muan, Republic of Korea. The fungus was cultured on PDA and V8 liquid media for 7 days at 25℃ to observe its morphological characteristics. The length and width of macroconidia ranged from 20.6 to 52.9 μm and 2.9 to 5.1 μm, respectively (n = 30). The microconidia were 8.5 to 14.9 μm and 2.3 to 4.2 μm in length and width, respectively (n = 30). Macroconidia were broadly falcate, strongly septate, 2 to 6 septations with dorsiventral curvature; chlamydospores were formed in chains; and microconidia were fusiform with 0 to 1 septation observed. Genomic DNA of the isolate was extracted using Solgent DNA extraction kit (Solgent, Daejeon, Korea), followed by PCR analysis using the internal transcribed spacer (ITS5/ITS4) and elongation factor (EF-1/EF2) genes (White et al. 1990; O’Donnel 2000). PCR products were sequenced and analyzed to confirm species identity (Yang et al. 2018). These sequences were deposited in GenBank (accession numbers MT703859/ITS and MT731939/EF). BLASTn search analysis showed 100% sequence similarity with Fusarium acuminatum (isolates N-51-1/ITS and WXWH24/EF). Based on morphological and molecular data analysis, the fungus was identified as F. acuminatum (Leslie and Summerell 2006; Marin et al. 2012). Pathogenicity tests were conducted on five tubers inoculated with 5 mm mycelial plugs with three replicates, while a non-mycelial plug served as the control. After 5 days of incubation in plastic containers at 25 °C with high humidity, typical symptoms developed. No symptoms were observed on the control tubers; F. acuminatum was re-isolated from artificially inoculated tubers to complete Koch’s postulates. This is the first report on post-harvest tuber rot caused by F. acuminatum in Apios americana.

Download Full-text

First Report of Stem Bleeding in Coconut Caused by Ceratocystis paradoxa in Hainan, China

Plant Disease ◽

10.1094/pdis-10-11-0840 ◽

2012 ◽

Vol 96 (2) ◽

pp. 290-290 ◽

Cited By ~ 5

Author(s):

F.-Y. Yu ◽

X.-Q. Niu ◽

Q.-H. Tang ◽

H. Zhu ◽

W.-W. Song ◽

...

Keyword(s):

Cultural Practices ◽

Sequence Similarity ◽

Its Region ◽

Department Of Agriculture ◽

First Report ◽

Florida Department ◽

Pcr Products ◽

Plant Pathol ◽

Ceratocystis Paradoxa ◽

Production Areas

Stem bleeding of coconut was discovered in 2009 in Hainan, China. Affected trunk areas exhibited dark discoloration and a reddish brown or rust-colored liquid bleeding from different points. Stem tissues under the lesions rotted and became brownish yellow to black. Affected plants died within 3 to 4 months after stem symptoms first appeared. Stem bleeding of coconut is known to occur in production areas worldwide. The disease was first reported in Sri Lanka (1), caused severe damage to PB-121 hybrids in Indonesia (2), and is now known to occur in many other coconut-producing countries. However, to our knowledge, this is the first report of the disease in China. A fungus was isolated from lesion margins of diseased coconut trees. Colonies on potato dextrose agar (PDA) were white, became black 1 to 2 days later, and emitted a strong, fruity aroma. The fungus produced conidia, which were cylindrical, colorless to pale brown, and 6.9 to 14.9 × 3.1 to 6.0 μm, and oval, black chlamydospores that were 7.9 to 19.4 × 4.6 to 11.0 μm. The optimum temperature for mycelial growth ranged from 25 to 35°C and it did not grow at temperatures lower than 5°C or higher than 40°C. On the basis of these characteristics, the fungus was identified as Ceratocystis paradoxa (Dade) C. Moreau (anamorph Thielaviopsis paradoxa (de Seynes) Höhn). The internal transcribed spacer (ITS) region was amplified from genomic DNA with primers ITS1 and ITS4 and the PCR products were sequenced (GenBank Accession No. JQ039332). BLAST analysis showed 99% sequence similarity with C. paradoxa (GenBank Accession No. HQ248205.1). Pathogenicity of the fungus was tested by inoculating 10, 3-year-old coconut trees of the cv. green tall at the 12-leaf stage in the field. Agar plugs (5 mm in diameter) from the periphery of 7-day-old C. paradoxa colonies grown on PDA were placed on healthy trunks, rachis, and leaves, which were either wounded or unwounded. Wounds were made with a sterilized cork borer. Sites of the inoculations were wrapped with plastic tape to prevent desiccation; the experiment was repeated three times. Controls received plain PDA discs. Two weeks after inoculation, characteristic rusty brown lesions appeared only on wounded plants that were inoculated with the fungus. A brownish liquid oozed from the points of inoculation. Controls did not show signs of disease development. C. paradoxa was reisolated from the diseased tissues. Infection occurred on wounded sites only, suggesting that wounds may be required for infection. To prevent stem bleeding of coconut trees by C. paradoxa, vigilant cultural practices must be maintained to avoid causing wounds on the trees. References: (1) S. A. Alfieri. Plant Pathol. Circular No. 53. Florida Department of Agriculture Division of Plant Industry, 1967. (2) D. R. N. Warwick and E. E. M. Passos. Trop. Plant Pathol. 34:175, 2009.

Download Full-text

First Report of Leaf Blight on Rubus brasiliensis Caused by Colletotrichum acutatum in Brazil

Plant Disease ◽

10.1094/pdis-06-10-0441 ◽

2010 ◽

Vol 94 (11) ◽

pp. 1378-1378 ◽

Cited By ~ 1

Author(s):

U. P. Lopes ◽

L. Zambolim ◽

H. S. S. Duarte ◽

P. G. C. Cabral ◽

O. L. Pereira ◽

...

Keyword(s):

Native Species ◽

Morphological Characteristics ◽

Minas Gerais ◽

Leaf Blight ◽

Colletotrichum Acutatum ◽

Conidial Suspension ◽

Specific Primer ◽

First Report ◽

Young Leaves ◽

Necrotic Spots

There are more than 300 blackberry (Rubus) species worldwide. Rubus brasiliensis Mart. is a native Brazilian species found in tropical forests. In January 2009, samples of R. brasiliensis with severe leaf blight were collected from an area of rain forest in the city of São Miguel do Anta, State of Minas Gerais, Brazil. Dark spots began developing in the young leaves and progressed to necrotic spots with occasional twig dieback. From the spots, a fungus was isolated with the following morphology: acervuli that were 20 to 50.0 × 50 to 125.0 μm and hyaline amerospores that were ellipsoid and fusiform and 7.5 to 23.75 × 2.5 to 5.0 μm. On the basis of these morphological characteristics, the fungus was identified as Colletotrichum acutatum. In Brazil, C. acutatum is reported in apple, citrus, strawberry, peach, plum, nectarine, olive, medlar, and yerba-mate, but it was not reported as the causal agent of leaf blight in R. brasiliensis. A sample was deposited in the herbarium at the Universidade Federal de Viçosa, Minas Gerais, Brazil (VIC 31210). One representative isolate, OLP 571, was used for pathogenicity testing and molecular studies. Identity was confirmed by amplifying the internal transcribed spacer (ITS) regions of the ribosomal RNA with primers ITS4 (3), CaInt2 (a specific primer for C. acutatum [2]) and CgInt (a specific primer for C. gloeosporioides [1]). Isolates of C. acutatum (DAR78874 and DAR78876) and C. gloeosporioides (DAR78875) obtained from Australian olive trees were used as positive controls. The primers ITS4 and CaInt2 amplified a single DNA product of 500 bp expected for C. acutatum. OLP 571 was grown for 7 days on potato dextrose agar. Young leaves of R. brasiliensis were inoculated with a conidial suspension (106 conidia/ml) on young leaves. Inoculated plants were maintained in a moist chamber for 2 days and subsequently in a greenhouse at 25°C. Necrotic spots similar to those described were detected on young leaves 3 days after the inoculation. Control leaves, on which only water was sprayed, remained healthy. The same fungus was reisolated from the inoculated symptomatic tissues. To our knowledge, this is the first report of C. acutatum causing leaf blight in the native species of R. brasiliensis in Brazil. References: (1) P. R. Mills et al. FEMS Microbiol. Lett. 98:137, 1999. (2) S. Sreenivasaprasad et al. Plant Pathol. 45:650, 1996. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

Download Full-text

First Report of Anthracnose Caused by Colletotrichum gloeosporioides on Malus prunifolia in Korea

Plant Disease ◽

10.1094/pdis-01-12-0063-pdn ◽

2012 ◽

Vol 96 (5) ◽

pp. 766-766 ◽

Cited By ~ 1

Author(s):

W. Cheon ◽

Y. S. Kim ◽

Y. H. Jeon

Keyword(s):

Colletotrichum Gloeosporioides ◽

Sequence Similarity ◽

Morphological Characteristics ◽

Its Rdna ◽

Plant Diseases ◽

Conidial Suspension ◽

Korean Society ◽

First Report ◽

Malus Prunifolia ◽

Crab Apple

In 2010 and 2011, crab apples in Andong Province, Korea were found with dark brown spots on the fruit and mummified fruit on a tree. The fruit surface had red, circular spots that contained smaller, white spots; the color of the inner spots later changed to brown or black. Eventually, the rotten fruit dried and became mummified. Microscopic examination revealed the presence of acervuli and dark brown-to-black, needle-shaped setae. To isolate potential pathogens from infected fruit, small sections (5 to 10 mm2) were excised from the margins of lesions. These sections were surface sterilized with 70% ethanol and 1% NaOCl for 1 min and then rinsed three times with sterile distilled water. The fungus that was isolated produced whitish mycelia when grown on potato dextrose agar (PDA); the mycelia later became gray to dark gray with aerial mycelia in tufts and numerous conidia were produced. The conidia were straight, cylindrical with an obtuse apex and a truncated base, and measured 11.4 to 17.5 × 4.2 to 7.1 μm. The measurements and taxonomic characteristics coincide with those of Colletotrichum gloeosporioides (Penz.) (1). The isolated fungus was tested for pathogenicity on crab apples and cv. Fuji apples by inoculation with a conidial suspension (105 conidia/ml) prepared from 20-day-old PDA cultures. A 20-μl drop of the conidial suspension was placed onto crab apple and apple fruits that had been wounded by piercing them 1 to 2 mm deep with a pin. Small, dark lesions were observed on the artificially inoculated fruit 3 days after inoculation. Nine days after inoculation, dark lesions with salmon-colored masses of conidia were observed on fruit, which were also soft and sunken. Abundant masses of conidia were produced in the decayed tissues. The fungus was reisolated from the parts of the fruits showing the symptoms. The internal transcribed spacer (ITS) rDNA of the isolated fungus was amplified and sequenced by PCR as described by White et al. (2). The resulting 582-bp of ITS rDNA sequence was deposited in GenBank (Accession No. JQ405742). A BLAST analysis for sequence similarity of the ITS region revealed 100% identity with nucleotide sequences for C. gloeosporioides isolates (Accession Nos. HQ645080 and AB458667). The results obtained on morphological characteristics, pathogenicity, and molecular data corresponded with those of C. gloeosporioides described by Sutton (1). To our knowledge, this is the first report of the presence of C. gloeosporioides on crab apple in Korea (3). Crab apple is used as a pollinator for single-cultivar apple orchards and may become a possible source of inoculum for cultivated apple. References: (1) T. B. Sutton. Compendium of Apple and Pear Diseases. The American Phytopathological Society, St. Paul, MN, 1990. (2) T. J. White et al. PCR Protocols: A Guide to Methods and Applications, Academic Press, Inc., New York, 1990. (3) S. H. Yu. List of Plant Diseases in Korea. 5th ed. (in Korean). The Korean Society of Plant Pathology, 2009.

Download Full-text

First Report of Cercospora Leaf Spot Caused by Cercospora apii (= C. molucellae) on Bells-of-Ireland (Molucella laevis) in Mexico

Plant Disease ◽

10.1094/pdis-93-2-0197a ◽

2009 ◽

Vol 93 (2) ◽

pp. 197-197 ◽

Cited By ~ 1

Author(s):

V. Ayala-Escobar ◽

U. Braun ◽

C. Nava-Diaz

Keyword(s):

Uv Light ◽

Morphological Characteristics ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Cercospora Leaf Spot ◽

Single Spore ◽

First Report ◽

Cornell University ◽

Specific Fragment ◽

Species Specific

In late 2007, a new disease was found in commercial cutflower fields of bells-of-Ireland (Molucella laevis L.) in Texcoco, Mexico. Four plantings surveyed during this time had 100% incidence. A few spots on cutflowers make them unmarketable. Symptoms consisted of gray-green spots on leaves, calyxes, and stems, which turned brown with age. Spots were initially circular to oval, delimited by major leaf veins, and were visible on both adaxial and abaxial sides of the leaves. A Cercospora species was consistently associated with the spots. The fungus was isolated on V8 agar medium. Three single-spore cultures were obtained from isolation cultures. Cultures were incubated at 24°C under near-UV light for 7 days. Pathogenicity was confirmed by spraying a conidial suspension (1 × 104 condia/ml) on leaves of 16 potted M. laevis plants, incubating the plants in a dew chamber for 48 h, and maintaining them in a greenhouse (20 to 24°C). Identical symptoms to those observed in the field appeared on all inoculated plants after 2 weeks. No symptoms developed on control plants treated with autoclaved distilled water. The pathogenicity test was repeated twice with similar results. The fungus produced erumpent stromata, which were dark brown, spherical to irregular, 10 to 26 μm diameter, and giving rise to fascicles of five to nine divergent conidiophores, which were clear brown, paler near the subtruncate apex, straight to curved, not branched, rarely geniculate with two to four septa, and 57 × 3.4 μm. The conidia were formed singly, hyaline, acicular, base truncate, tip acute, straight to curved with 11 to 19 septa, and 172 × 3.5 μm. Fungal DNA from single-spore cultures was obtained with a commercial extraction kit (Qiagen, Hilden, Germany), amplified with ITS5 and ITS4 primers, and sequenced. The sequence, deposited at the National Center for Biotechnology Information Database (GenBank Accession No. EU564808), aligned almost perfectly (99% identity) to the bells-of-Ireland isolates from California (GenBank Accession Nos. AY156918 and AY156919) and New Zealand (Accession No. DQ233321). A 176-bp species-specific fragment was amplified with CercoCal-apii primers but not with CercoCal-beta or CercoCal-sp primers. These results, coupled with the morphological characteristics (1) and pathogenicity test, confirm the identity of the fungus as Cercospora apii sensu lato (including C. molucellae) (2,3,4). Although C. apii sensu lato has been reported on other hosts in Mexico (1,2), to our knowledge, this is the first report of this disease on M. laevis plants in this country. References: (1) C. Chupp. A Monograph of the Fungus Cercospora. Cornell University Press, Ithaca, NY, 1954. (2) P. W. Crous and U. Braun. CBS Biodiversity Series 1:1, 2003. (3) M. Groenewald et al. Phytopathology 95:951, 2005. (4) S. T Koike et al. Plant Dis. 87:203, 2003.

Download Full-text

First Report of Phytoplasma Infection of Grasses in Singapore

Plant Disease ◽

10.1094/pdis-92-2-0317c ◽

2008 ◽

Vol 92 (2) ◽

pp. 317-317 ◽

Cited By ~ 4

Author(s):

L. H. Koh ◽

M. L. Yap ◽

C. P. Yik ◽

S. N. Niu ◽

S. M. Wong

Keyword(s):

Disease Surveillance ◽

Cynodon Dactylon ◽

Universal Primer ◽

First Report ◽

White Leaf ◽

Pcr Products ◽

Phytoplasma Infection ◽

Total Dna ◽

Grass Hosts ◽

Leaf Symptoms

In September of 2005, patches of Cynodon dactylon showing symptoms of bleached leaves were first observed in an open field in Singapore. Samples were collected from this site, from which total DNA was extracted with a Qiagen DNeasy kit (Catalog No 69104) and analyzed for phytoplasma DNA by a PCR assay with phytoplasma universal primer pairs P1/PTint (3). Resulting PCR products were each diluted 1:30 with sterilized distilled water and used in nested PCR with primer pair R16F2n and R16R2 (1). Twenty-five C. dactylon samples were assessed by this means, of which eight of eight with bleached leaves and four of seventeen symptomless samples tested positive. Widened disease surveillance identified the grasses, Axonopus compressus and Paspalum conjugatum, with similar bleached leaf symptoms in December 2006 and May 2007, respectively. Twenty-three of fifty-three A. compressus and six of twenty P. conjugatum samples were detected as positive for phytoplasma infection with the above PCR methods. A comparative analysis of sequences derived from the three grass hosts determined that the phytoplasma infecting C. dactylon (Genbank Accession No. EU234510) was most similar (>99%) to ‘Candidatus Phytoplasma cynodontis’ (GenBank Accession No. AB052871.1), whereas those detected in A. compressus (Genbank Accession No. EU234511) and P. conjugatum (Genbank Accession No. EU234512) were most similar (>99%) to the Brachiaria white leaf phytoplasma (GenBank Accession No. AB052872.1) (2). To our knowledge, this is the first report of phytoplasmas in C. dactylon, A. compressus, and P. conjugatum in Singapore. References: (1) I. M. Lee et al. Int. J. Syst. Evol. Microbiol. 48:1153, 1998. (2) C. Marcone et al. Int. J. Syst. Evol. Microbiol. 54:1077, 2004. (3) C. D. Smart et al. Appl. Environ. Microbiol. 62:2988, 1996.

Download Full-text