scholarly journals First Report of the Foliar Nematode Aphelenchoides ritzemabosi Infecting Chrysanthemum in Iran

Plant Disease ◽  
2007 ◽  
Vol 91 (5) ◽  
pp. 637-637
Author(s):  
A. Mohammad Deimi ◽  
S. Barouti ◽  
J. E. Palomares Rius ◽  
P. Castillo
Keyword(s):  
New York ◽  
Tail Length ◽  
Cut Flowers ◽  
Lateral Field ◽  
First Report ◽  
Stylet Length ◽  
Foliar Nematode ◽  
The University ◽  
And Control ◽  
Aphelenchoides Ritzemabosi

During a nematode survey on cut flowers in the Pakdasht Region, Tehran Province, Iran, a species of foliar nematode belonging to the genus Aphelenchoides Fischer was detected in leaves of 10- to 11-month-old, greenhouse-grown (26 to 28°C) chrysanthemum (Dendranthema grandiflorum Kitam., cv. Puja) plants. Chrysanthemum leaves appeared discolored and slightly deformed. Diseased plants comprised approximately 40% of all plants in the greenhouse and occurred in scattered clumps along irrigation paths. Spots and blackish brown, irregular, necrotic areas occupied 5 to 50% of the leaf surface. Symptomatic tissue contained females, males, juveniles, and embryonated eggs of the nematode. All life stages of the nematode were detected in the mesophyll of younger and older infected leaves. The nematode population was extracted and quantified from symptomatic samples of 5 g of leaf tissues by modified Baermann funnel extraction and from 250 g of soil with a modification of the sugar centrifugal flotation method (1), counted, and identified. Morphological observations showed four incisures in the lateral field, excretory pore posterior to nerve ring, ovary single with oocytes in multiple rows, post-vulval uterine sac extending more than one-half of the vulva-anus distance, often containing sperm, tail elongate-conoid bearing a terminal peg with 2 to 4 minute processes. Males common (40% of females) posteriorly curved through 180° upon relaxation, tail conoid bearing a terminal peg with 2 to 3 processes. Measurements of 14 females and 11 males (body length = 987 ± 48 μm, a = 49.2 ± 4.4, b = 12.3 ± 1.1, c = 20.6 ± 2.8, V = 71 ± 1.7, T = 49 ± 2.3, stylet length = 12.6 ± 0.6 μm, tail length = 47.9 ± 5.2 μm; position of vulva = 70.8 ± 1.7%; spicules length = 22.8 ± 1.4 μm) conformed to the description of the chrysanthemum foliar nematode Aphelenchoides ritzemabosi (Schwartz) Steiner & Buhrer, (2). Voucher specimens have been deposited in the University of California Davis Collection. An average of 1,064 A. ritzemabosi per gram were found in the leaves of chrysanthemum, while only 48 nematodes were detected in the soil. To our knowledge, this is the first report of A. ritzemabosi infecting chrysanthemum plants in Iran. References: (1) W. A. Coolen. Page 317 in: Root-Knot Nematodes (Meloidogyne Species) Systematics, Biology, and Control. F. Lamberti and C. E. Taylor, eds., Academic Press, New York, 1979. (2) N. Vovlas et al. Nematology 7:301, 2005.

scholarly journals First Report of Lesion Nematode (Pratylenchus vulnus) on Boxwood in Ohio

Plant Disease ◽  
2012 ◽  
Vol 96 (9) ◽  
pp. 1385-1385
Author(s):  
H. D. Lopez-Nicora ◽  
T. Mekete ◽  
N. J. Taylor ◽  
T. L. Niblack
Keyword(s):  
Body Length ◽  
Tail Length ◽  
The Body ◽  
28S Rrna ◽  
Lateral Field ◽  
First Report ◽  
Pratylenchus Vulnus ◽  
Buxus Sempervirens ◽  
Stylet Length ◽  
De Man

Boxwood (Buxus sempervirens L. and other species) is a popular evergreen shrub used in landscaping. In January 2012, three nursery-grown plants of cv. Green Gem boxwood were submitted from Warren County, Ohio to the C. Wayne Ellet Plant and Pest Diagnostic Clinic at The Ohio State University, an Ohio Plant Diagnostic Network laboratory. The plants, established for 4 years, exhibited orange to bronze discoloration of the foliage; foliage was not desiccated and dieback was not evident although stunting was present. Plant root symptoms ranged from nearly complete necrosis to distinct black lesions on living roots. A root scraping showed nematodes present in the lesions. Nematodes were extracted from root and soil subsamples with a Baermann funnel apparatus for 48 h (3). A high number of lesion nematodes (Pratylenchus sp.) were observed from both soil and root samples. Individual nematodes were handpicked and identified under a compound light microscope as Pratylenchus vulnus Allen & Jensen, 1951 according to morphologic and morphometric characteristics (2). Males and females were observed with stylets having rounded knobs, labial regions continuous with the body contour, and three to four lip annuli. The lateral field contained four incisures, with the two inner incisures closer to each other than to the outer ones. The esophagus overlapped the intestine ventrally. Female (n = 12) body length ranged from 410.3 to 654.5 μm (mean 583.0 μm), stylet length from 15.0 to 17.8 μm (mean 16.8 μm), tail length from 23.2 to 37.5 μm (mean 29.2 μm), vulva position from 78.9 to 85.6% (mean 81.7%), dorsal esophageal outlet (DGO) from 2.6 to 3.5 μm (mean 3.1 μm), and with functional oblong spermathecae. De Man ratios were as follows: a = 25.3 to 33.3 (mean 28.4), b = 4.1 to 7.6 (mean 6.0), c = 16.1 to 23.5 (mean 20.1), and c′ = 1.8 to 2.6 (mean 2.1). Male (n = 16) body length ranged from 478.0 to 589.0 μm (mean 537.9 μm), stylet length from 15.0 to 17.2 μm (mean 16.2 μm), tail length from 22.7 to 28.1 μm (mean 25.5 μm), spicule from 15.0 to 17.5 μm (mean 16.4 μm), gubernaculum from 3.5 to 4.7 μm (mean 4.0 μm), and DGO from 2.6 to 3.7 μm (mean 3.1 μm). De Man ratios were as follows: a = 26.4 to 36.3 (mean 30.5), b = 5.0 to 7.9 (mean 5.8), c = 19.1 to 23.0 (mean 21.1), and c′ = 1.6 to 2.4 (mean 2.0). DNA was extracted from single adult females and the D2-D3 expansion region of the 28S rRNA gene was amplified using forward primer ACAAGTACCGTGAGGGAAAGTTG and reverse primer TCGGAAGGAACCAGCTACTA (4). The PCR product was purified and sequenced. The sequence was deposited in GenBank (Accession No. JQ692308) and was compared with sequences previously deposited in GenBank by means of BLAST search. The comparison revealed a sequence similarity of 98 to 99% with P. vulnus (e.g., GenBank Accession Nos. HM469437.1, EU130886.1, and JQ003994.1). P. vulnus is a known pathogen of boxwood (1). To our knowledge, this is the first report of P. vulnus in Ohio. References: (1) K. R. Barker. Plant Dis. Rep. 58:991, 1974. (2) P. Castillo and N. Vovlas. Pratylenchus (Nematoda: Pratylenchidae): Diagnosis, Biology, Pathogenicity and Management. Koninklijke Brill NV, Leiden, the Netherlands, 2007. (3) D. J. Hooper. In: Laboratory Methods for Work with Plant and Soil Nematodes. J. F. Southey, ed. Reference book 402. Ministry of Agriculture, Fisheries and Food, London, 1986. (4) G. C. Tenente et al. Nematropica 34:1, 2004.

scholarly journals First Report of the Cereal Cyst Nematode Heterodera filipjevi on Wheat in Serbia

Plant Disease ◽  
2012 ◽  
Vol 96 (10) ◽  
pp. 1583-1583 ◽  
Author(s):  
V. Oro ◽  
S. Živković ◽  
Ž. Ivanović ◽  
L. Waeyenberge
Keyword(s):  
New York ◽  
Tail Length ◽  
Its Region ◽  
Molecular Data ◽  
Cyst Nematode ◽  
Cereal Cyst Nematode ◽  
Important Species ◽  
First Report ◽  
Wheat Field ◽  
Heterodera Filipjevi

The most globally recognized and economically important nematode on wheat is the cereal cyst nematode (CCN) complex (1). One of the most important species of this group is Heterodera filipjevi (Madžidov, 1981) Mulvey and Golden, 1983. During regular soil quarantine control in September 2010, Heterodera sp. cysts were found in soil samples originating from a wheat field in Gunaroš, Vojvodina Province, in northern Serbia. The wheat was a winter crop grown in a dryland production system and had an average cyst density of 2.50/100 cm3 of soil. Morphologically, the cysts were golden brown and lemon shaped with a posterior protuberance. The vulval cone was bifenestrate with horseshoe-shaped semifenestra, bullae, and underbridge. Cyst measurements (n = 30) ranged as follows: cyst length (without neck): 511.50 to 899.00 μm, cyst width: 201.50 to 682.00 μm, fenestral length: 44.80 to 65.60 μm, fenestral width: 24.00 to 40.00 μm, vulval bridge length: 12.80 to 20.80 μm, vulval bridge width: 6.40 to 14.40 μm, vulval slit: 6.00 to 12.80 μm, and underbridge length: 60.00 to 112.00 μm. The second-stage juveniles had an offset head, stylet with characteristic anchor-shaped basal knobs, four incisures, and a conical tail with a rounded tip. The J2 morphometrics (n = 30) were: length: 447.30 to 611.10 μm, width: 22.40 to 25.60 μm, stylet: 20.80 to 24.00 μm, tail length: 56.00 to 68.80 μm, tail width: 14.40 to 19.20 μm, and hyaline length: 35.20 to 44.80 μm. The ITS region was used for molecular analysis. Each DNA sample was extracted from a single cyst. Sequencing was done with primers TW81 and AB28 (2). In comparison with other H. filipjevi populations, the obtained sequence (GenBank Accession No. JX235959) revealed 99 to 100% similarity. Morphological and molecular data confirmed the existence of H. filipjevi. This is, to our knowledge, the first report of H. filipjevi from Serbia. Since wheat has important socioeconomic value for Serbia, after extensive surveys, additional phytosanitary measures may be necessary to prevent the spread of this parasite. References: (1) J. M. Nicol et al. Current Nematode Threats to World Agriculture. Genomics and Molecular Genetics of Plant-Nematode Interactions, Springer, New York, 2011. (2) A. M. Skantar et al. J. Nematol. 39:133, 2007.

scholarly journals First Report of Subanguina moxae Infecting Mugwort in Yunnan, China

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1232-1232 ◽  
Author(s):  
R. Y. Yao ◽  
X. Q. Hu ◽  
J. P. Xue
Keyword(s):  
Body Length ◽  
Tail Length ◽  
Total Body Length ◽  
Guizhou Province ◽  
Universal Primers ◽  
Parasitic Nematodes ◽  
Its Sequence ◽  
First Report ◽  
Stylet Length ◽  
Total Body

Mugwort is a perennial in the Compositae family distributed throughout Asia and Europe. The leaves are reported to have various pharmaceutical properties, e.g., antibacterial, antiviral, antitussive, and hemostatic properties, and have been used in traditional Chinese medicine for more than 2,000 years. In August 2011, a field of mugwort in Kunming, Yunnan Province, China, exhibited more than 90% incidence of whitish and rounded galls on the leaves. There were approximately 10 galls on each leaf, impacting the quality of the leaves for medicinal use. Parasitic nematodes were found upon dissection of the galls, then eggs, second-stage juveniles (J2), and mature males and females were observed. Through the morphologic observation of juveniles and female and male adults, the parasitic nematode was identified as Subanguina moxae (Yokoo and Choi, 1968) Brzeski, 1981 (3). Key morphological features are as follows: eggs (n = 20) measured 54.0 to 71.4 × 24.1 to 30.0 μm; J2 (n = 20) had the following characteristics: body length 689.3 to 873.2 μm (x = 775.5 μm); stylet length 8.2 to 9.8 μm (x = 8.8 μm); tail length 49.5 to 74.5 μm (x = 60.1 μm); a (total body length/maximum body width) ranged from 28.6 to 38.6 μm (x = 34.1 μm); and c (total body length/the length of the tail) ranged from 11.2 to 16.0 μm (x = 13.0 μm). Females (n = 20) had the following characteristics: body length 1,252.8 to 1,665.2 μm (x = 1,475.7 μm); stylet length 7.2 to 9.2 μm (x = 8.2 μm); V of 88.0 to 92.3 μm (x = 89.6 μm); a ranged from 17.6 to 24.5 μm (x = 21.3 μm); and c ranged from 20.2 to 28.9 μm (x = 22.8 μm). Males (n = 20) had the following characteristics: body length 994.2 to 1,453.6 μm (x = 1,253.2 μm); stylet length 7.5 to 9.9 μm (x= 9.1 μm); tail length 69.2 to 88.1 μm (x = 78.0 μm); spicule length 22.2 to 33.4 μm (x = 29.4 μm); gubernaculum length 10.4 to 14.2 μm (x = 12.2 μm); a ranged from 23.1 to 37.2 μm (x = 29.9 μm); and c ranged from 13.9 to 18.7 μm (x = 16.1 μm). Amplification of the rDNA-internal transcribed spacer (ITS) region and the D2/D3 (1) fragments of the 28S RNA with universal primers rDNA1/rDNA2 and D2A/D3B yielded PCR fragments of 934 bp and 754 bp, respectively. The ITS sequence (JN865234) and D2D3 sequence (JN885540) were submitted to GenBank. The ITS sequence (JN865234) exhibited 99.4% similarity with Mesoanguina moxae (AF396314) (synonym of S. moxae) (4). S. moxae has been identified from the common mugwort in Japan (2) and in China, was reported to infect wheat in Guizhou Province, but to our knowledge, this is the first report of this nematode affecting mugwort in Yunnan, China. References: (1) S. Amiri et al. Eur. J. Plant Pathol. 108:497, 2002. (2) K. Daigo et al. Bull. School Agric. Meiji University. 56:237, 2007. (3) M. R. Siddiqi. Tylenchida: Parasites of Plants and Insects. CABI Publishing, New York, 2000. (4) S. A. Subbotin et al. Mol. Phylogenet. Evol. 30:226, 2004.

scholarly journals First Report of Downy Mildew on Greenhouse and Landscape Coleus Caused by a Peronospora sp. in Louisiana and New York

Plant Disease ◽  
2006 ◽  
Vol 90 (8) ◽  
pp. 1111-1111 ◽  
Author(s):  
M. L. Daughtrey ◽  
G. E. Holcomb ◽  
B. Eshenaur ◽  
M. E. Palm ◽  
L. Belbahri ◽  
...  
Keyword(s):  
New York ◽  
Downy Mildew ◽  
Pathogenic Fungi ◽  
Early Summer ◽  
First Report ◽  
Stunted Growth ◽  
Solenostemon Scutellarioides ◽  
Leaf Surfaces ◽  
And Control ◽  
Disease Free

In May 2005, two commercial greenhouse flower growers, one in Louisiana (LA) and one in New York (NY), submitted coleus, Solenostemon scutellarioides (L.) Codd, plants for diagnosis after observing stunted growth, inward curling and twisting of leaves, and leaf abscission on multiple cultivars. Downy mildew-like growth was observable with hand lens or a microscope on the abaxial leaf surfaces of affected plants. Irregular necrotic spotting was present on some, but not all, plants on which sporulation was evident. Microscopic examination of LA material led to tentative identification of the pathogen as Peronospora lamii A. Braun (2). The pale brown conidia ranged from 17 to 26 × 15 to 26 μm (average 23 × 19 μm). Conidiophores ranged from 345 to 561 × 9 to 15 μm. No oospores were found. Additional coleus plants with downy mildew were subsequently found in three retail nurseries in LA in early summer. In NY, infected coleus plants were observed in landscapes in Farmington, Rochester, Ithaca, and in two commercial greenhouses between August and October 2005. NY samples sent to the USDA/APHIS in Beltsville, MD were examined, and the fungus was found to have morphology consistent with P. lamii. Two pathogenicity trials were conducted in NY. Conidia were rubbed from an infected coleus leaf onto the leaves of six healthy potted coleus plants of five cultivars and two basil plants that were placed in a shaded plastic tent in the greenhouse where temperatures ranged from 17 to 22°C. A household humidifier was used to supply mist inside the tent for 5 h per day. Six noninoculated plants of each coleus cultivar and two basil plants, placed in the same environment, served as controls. Downy mildew sporulation and some curling and twisting of leaves were observed 14 days after inoculation on all inoculated plants for three of the five cultivars (Florida Rustic Orange, Aurora Peach, and Aurora Mocha). Cvs. Florida Sun Rose and Lava showed no symptoms or signs of downy mildew. An irregularly shaped brown lesion developed on one inoculated basil leaf, and downy mildew sporulation was evident on the abaxial surface 35 days after inoculation. All noninoculated control plants remained disease free. In a second trial, conidia were rinsed from infected coleus leaves and sprayed onto the abaxial leaf surfaces of three coleus cv. Aurora Mocha plants. Three noninoculated plants served as controls and all were placed in a humidity tent. Leaf twisting and downy mildew sporulation were observed 13 days later on all inoculated plants, and control plants showed no sporulation or symptoms. A downy mildew causing disease of greenhouse-grown basil in Europe, originally identified as P. lamii on the basis of morphology, has recently been reported to be taxonomically distinguishable from P. lamii when tested by molecular methods (1). ITS sequences of coleus downy mildew from NY and LA were nearly identical (99% homology) to those of basil downy mildew from Switzerland and Italy (1). To our knowledge, this is the first report of downy mildew occurrence on coleus. References: (1) L. Belbahri et al. Mycol. Res. 109:1276, 2005. (2) S. M. Francis. Peronospora lamii. Descriptions of Pathogenic Fungi and Bacteria. No. 688. CMI, Kew, England, 1981.

Canadian species of Merlinius Siddiqi, 1970 and a diagnosis and description for Mulveyotus hyalacus n. gen., n. sp. (Nematoda: Tylenchorhynchidae)

1982 ◽  
Vol 60 (4) ◽  
pp. 521-529 ◽  
Author(s):  
R. V. Anderson ◽  
B. A. Ebsary
Keyword(s):  
Tail Length ◽  
New Combination ◽  
New Genus And Species ◽  
Long Tail ◽  
Lateral Field ◽  
Differential Characters ◽  
Low Head ◽  
Stylet Length ◽  
Thickened Cuticle ◽  
A New Species

Three new bisexual species of Merlinius Siddiqi, 1970, characterized by apically flattened heads and elongate–conoid tails with narrowly rounded or pointed ends, and a new genus and species (Tylenchorhynchidae) in Canada are described and illustrated. The distinguishing female characters of Merlinius plerorbus n. sp. are the constricted head, 16- to 17-μm-long stylet, 45- to 54-μm-long tail with 38–40 annules and a smoothly rounded terminus, and lobed spermathecae. Diagnostic for females of Merlinius circellus n. sp. are the continuous low head, 9- to 10-μm-long stylet, tail with 72–75 annules and a pointed terminus, and spherical spermathecae. The female of Merlinius tetylus n. sp. has a stylet length of 14 μm, a 98-μm-long tail with about 100 fine annules, and lobed spermathecae. Supplemental descriptive data for M. processus Siddiqi, 1979, a new species record for Canada, is provided, and included in a key to the species of Merlinius. Merlinius laminatus (Wu, 1969) Siddiqi, 1970 is transferred as a new combination to Scutylenchus Jairajpuri, 1971. Differential characters of Mulveyotus hyalacus n. gen., n. sp., are a body length of over 1 mm, alow, flattened continuous head, an areolated lateral field of three incisures, and a conoid tail over 100 μm long with a tapered smooth terminus of thickened cuticle comprising 24% of the tail length.

First Report of the Apple Root-Knot Nematode, Meloidogyne mali, on Maple Trees in Republic of Korea

Plant Disease ◽  
2021 ◽  
Author(s):  
Heonil Kang ◽  
Jongmin Seo ◽  
Hyoung-Rai Ko ◽  
Sohee Park ◽  
Nam-Sook Park ◽  
...  
Keyword(s):  
Body Length ◽  
National Park ◽  
Its Region ◽  
28S Rdna ◽  
Republic Of Korea ◽  
Egg Mass ◽  
Lateral Field ◽  
First Report ◽  
Future Production ◽  
Stylet Length

Meloidogyne mali was originally described in Japan on roots of an apple rootstock (Malus prunifolia) (Itoh et al. 1969) and found on elm trees in Italy, Netherlands, Belgium, France and United Kingdom, and euonymus in the USA (EPPO 2018; Prior et al. 2019). In Italy, the nematode was initially described as a new species, Meloidogyne ulmi, but was later synonymized with M. mali (Ahmad et al., 2013). During the study of Meloidogyne species in Republic of Korea, galled roots were found on Acer palmatum collected in Naejangsan National Park, Republic of Korea located at 35°29'29.1"N, 126°55'42.7"E, altitude 147.8 m. Morphologically, the perineal patterns of the females was very similar to M. mali due to rounded dorsal arch and smooth, finely-spaced, indistinct striae. Lateral field shallow, narrow, and faint. Phasmids large, very distinct. Head region of second–stage juveniles flattened anteriorly to hemispherical, slightly set-off from body, without annulations, low head cap. Stylet slender, sharply pointed cone, cylindrical shaft with rounded knob sloping posteriorly. Tail conoid with irregular, and rounded end. Rectum undilated. Several micrographs were made from 25 J2s and females for mean, standard deviation and range. J2s were measured with a body length: 408.2 ± 25.1 (366-449) µm, maximum body width: 15.9 ± 1.0 (14.1-17.9) µm, stylet length: 14.1 ± 0.5 (13.1-15.3) µm, hyaline tail terminus: 10.0 ± 0.9 (8.3-11.0) µm and tail length: 31.7 ± 3.0 (26.0-36.1) µm. Females (n=25) were characterized by a body length: 656.7 ± 102.7 (516-947) µm, a stylet length: 16.4 ± 2.2 (13.9-19.0) µm, a vulval slit length: 22.2 ± 1.8 (19.8-25.7) µm, and a vulva-anal distance: 20.2 ± 2.4 (17.1-25.4) µm. Morphological measurements and configuration of perineal patterns (Fig. 1S) were comparable to M. mali (Itoh et al. 1969; Ahmed et al. 2013; Gu et al. 2020). To confirm pathogenicity, a modified version of Koch’s postulates was conducted in the greenhouse by inoculating 300 eggs from a single egg mass onto each of three, two-year-old A. palmatum plants, grown in sterilized sandy soil. After about one year, symptoms developed on the maple tree roots, with numerous galls containing females and egg masses by visual inspection. In addition, PCR was performed for the 28S rDNA D2-D3 segment and ITS region using the primers D2A, D3B, TW81 and AB28. The resulting sequences (MW522548, MW522549, MW523004 and MW523005) were at least 99% identical to other 28S rDNA D2-D3 segment and ITS region sequences on Genbank (MT406757 and JX978229). The molecular phylogenetic relationships of this species strongly supports M. mali (Fig. 2S). To the best of our knowledge, this is the first report of M. mali in Republic of Korea. The host range of M. mali includes many species which are of economic importance in fruit trees (e.g. apple, chestnut, fig, mulberry), forestry trees (e.g. elm, maple, oak, Yew), and vegetable crops (e.g. cabbage, carrot, cucumber, eggplant, soybean, watermelon). The potential danger to these economically important plants caused M. mali to be added the EPPO Alert List and also the Quarantine List of the Korean Animal and Plant Quarantine Agency. Additionally, in our survey around the Naejangsan National Park, M. mali was not found on other economically important host crops, such as grapes. Although this nematode was not detected other crops, it requires regular monitoring because it poses a serious threat to the future production of these crops.

Heterodera circeae sp. n. and H. scutellariae sp. n. (Tylenchida: Heteroderidae) from Germany, with notes on the goettingiana group

Nematology ◽  
2004 ◽  
Vol 6 (3) ◽  
pp. 343-355 ◽  
Author(s):  
Sergei Subbotin ◽  
Dieter Sturhan
Keyword(s):  
New Species ◽  
Tail Length ◽  
Molecular Data ◽  
The Other ◽  
Phylogenetic Position ◽  
Lateral Field ◽  
Second Stage ◽  
Rdna Sequences ◽  
Dicotyledonous Plants ◽  
Stylet Length

Abstract Two species of cyst-forming nematodes belonging to the goettingiana group are described from woodland in Germany. Heterodera circeae sp. n., parasitising Circaea lutetiana (Onagraceae), most closely resembles H. carotae and H. cruciferae, from which it differs by larger cysts (430-720 μm) and longer fenestral length (27-54 μm) and rounded stylet knobs of the second-stage juveniles. Heterodera scutellariae sp. n., found on the labiate Scutellaria galericulata (Lamiaceae), is distinguished from the other species of this group by shorter body (358-437 μm) and tail (41-53 μm) of the second-stage juveniles. The ITS-rDNA sequences of the new species are very similar and differ from each other by only a few nucleotides. The phylogenetic position of the new species within the group is presented based on analyses of molecular data. A revised diagnosis of the goettingiana group is proposed. The species of the group have lemon-shaped, ambifenestrate and abullate (small bullae occasionally present) cysts with egg sac, long vulval slit (> 35 μm), thin vulval bridge, low semifenestrae (average fenestral length 30-45 μm), and weak underbridge. Second-stage juveniles are characterised by body length > 400 μm, tail length > 45 μ m, hyaline tail portion > 20 μm, stylet length > 20 μm, lateral field with four incisures and small phasmids. All known species of the goettingiana group exclusively parasitise dicotyledonous plants.

scholarly journals First report of the nematodes Filenchus orientalis and Hemicriconemoides californianus on faba bean in Iran

2016 ◽  
Vol 9 (1) ◽  
pp. 44-50
Author(s):  
S. Azimi ◽  
E. Mahdikhani-Moghadam ◽  
H. Rouhani ◽  
H. Rajabi Memari
Keyword(s):  
Body Length ◽  
Tail Length ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Morphometric Characters ◽  
Lateral Field ◽  
Stylet Length ◽  
First Time ◽  
Plant Parasitic ◽  
Iranian Populations

Summary During a survey in Iran, two known species of plant-parasitic nematodes of the families Tylenchidae and Criconematidae were reported for the first time. The morphological and morphometric characters of Iranian populations of the two recovered species are discussed and illustrated based on morphological and morphometrics data. Iranian population of Filenchus orientalis is characterized by having a 601-755μm body length, stylet length of 9.0-11.3 μm, lateral field with four incisures, tail length of 100-118 μm and males with 15-21 μm long spicules. Hemicriconemoides californianus population is characterized by having a body length of 430-550μm, lip region with two annuli, stylet length of 75-83μm and tail length of 20-28 μm. The morphological and morphometric characters of both species are in agreement with those in original descriptions.

Sign in / Sign up

Export Citation Format

Share Document