First Report on the Susceptibility of Sweet Pepper Crops to Tomato chlorosis virus in Brazil

In June of 2009, sweet pepper (Capsicum annuum cvs. Elisa and Prador) plants exhibiting interveinal chlorosis, some necrosis, and mild upward leaf curling on the intermediate leaves were found in three protected crops in the municipality of São Miguel Arcanjo, São Paulo state, Brazil. Incidence of symptomatic plants varied from 70 to 100%. Abundant whitefly adults were seen in all crops. Initially, total DNA was separately extracted from seven symptomatic plants and submitted to a PCR reaction using the universal primer pairs PAL1v1978/PAR1c496 and PBL1v2040/PCRc1 for begomovirus (3). The results were negative. The same samples were also analyzed for infection with Tomato infectious chlorosis virus (TICV) and Tomato chlorosis virus (ToCV) (genus Crinivirus, family Closteroviridae). Total RNA was extracted separately from leaves of each symptomatic plant and used for one-step reverse transcription (RT)-PCR using the HS-11/HS-12 primer pair, which amplifies a fragment of 587 bp from the highly conserved region of the heat shock protein (HSP-70) homolog gene reported for TICV and ToCV (1). The RT-PCR product was subsequently tested by nested-PCR for single detection of TICV and ToCV using primer pairs TIC-3/TIC-4 and ToC-5/ToC-6, respectively (1). Only one fragment of approximately 463 bp was amplified from the five plants with the primer pair specific for ToCV. No amplification was obtained with the primers specific for TICV. Four purified amplicons of 463 bp were directly sequenced in both directions. Sequence comparisons of the 419-bp consensus sequence, encompassing nucleotides 750 and 1,167 of the HSP-70 homolog gene, revealed 98% identity with the reported sequences of tomato infecting isolates of ToCV from Brazil (GenBank Accession No. EU868927) and the United States (GenBank Accession No. AY903448). Virus-free adults of Bemisia tabaci biotype B were confined on symptomatic pepper leaves for a 48-h acquisition access period. Twenty adults were transferred to one plant of sweet pepper cv. Magda for a 24-h inoculation access period. The sweet pepper plant exhibited the original symptoms on the leaves 67 days after inoculation under greenhouse conditions. Infection by ToCV was confirmed by RT-PCR. The susceptibility of sweet pepper plants to ToCV was previously reported in Spain (2), whereas in the United States, this species was experimentally found as nonhost for this virus (4). Further studies are needed to better understand the variable susceptibility of sweet pepper to ToCV. References: (1) C. I. Dovas et al. Plant Dis. 86:1345, 2002. (2) G. Lozano et al. Plant Dis. 88:224, 2004. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) W. M. Wintermantel et al. Plant Dis. 90:814, 2006.

Download Full-text

First report of Coleus blumei viroid 1 in commercial Coleus blumei in the United States

Plant Disease ◽

10.1094/pdis-05-21-0917-pdn ◽

2021 ◽

Author(s):

Gardenia Orellana ◽

Alexander V Karasev

Keyword(s):

United States ◽

Leaf Tissue ◽

The United States ◽

Universal Primers ◽

Rt Pcr ◽

Universal Primer ◽

Tissue Samples ◽

First Report ◽

Specific Pcr ◽

Coleus Blumei

Coleus scutellarioides (syn. Coleus blumei) is a widely grown evergreen ornamental plant valued for its highly decorative variegated leaves. Six viroids, named Coleus blumei viroid 1 to 6 (CbVd-1 to -6) have been identified in coleus plants in many countries of the world (Nie and Singh 2017), including Canada (Smith et al. 2018). However there have been no reports of Coleus blumei viroids occurring in the U.S.A. (Nie and Singh 2017). In April 2021, leaf tissue samples from 27 cultivars of C. blumei, one plant of each, were submitted to the University of Idaho laboratory from a commercial nursery located in Oregon to screen for the presence of viroids. The sampled plants were selected randomly and no symptoms were apparent in any of the samples. Total nucleic acids were extracted from each sample (Dellaporta et al. 1983) and used in reverse-transcription (RT)-PCR tests (Jiang et al. 2011) for the CbVd-1 and CbVd-5 with the universal primer pair CbVds-P1/P2, which amplifies the complete genome of all members in the genus Coleviroid (Jiang et al. 2011), and two additional primer pairs, CbVd1-F1/R1 and CbVd5-F1/R1, specific for CbVd-1 and CbVd-5, respectively (Smith et al. 2018). Five C. blumei plants (cvs Fire Mountain, Lovebird, Smokey Rose, Marrakesh, and Nutmeg) were positive for a coleviroid based on the observation of the single 250-nt band in the RT-PCR test with CbVds-P1/P2 primers. Two of these CbVd-1 positive plants (cvs Lovebird and Nutmeg) were also positive for CbVd-1 based on the presence of a single 150-nt band in the RT-PCR assay with CbVd1-F1/R1 primers. One plant (cv Jigsaw) was positive for CbVd-1, i.e. showing the 150-nt band in RT-PCR with CbVd1-F1/R1 primers, but did not show the ca. 250-bp band in RT-PCR with primers CbVds-P1/P2. None of the tested plants were positive for CbVd-5, either with the specific, or universal primers. All coleviroid- and CbVd-1-specific PCR products were sequenced directly using the Sanger methodology, and revealed whole genomes for five isolates of CbVd-1 from Oregon, U.S.A. The genomes of the five CbVd-1 isolates displayed 96.9-100% identity among each other and 96.0-100% identity to the CbVd-1 sequences available in GenBank. Because the sequences from cvs Lovebird, Marrakesh, and Nutmeg, were found 100% identical, one sequence was deposited in GenBank (MZ326145). Two other sequences, from cvs Fire Mountain and Smokey Rose, were deposited in the GenBank under accession numbers MZ326144 and MZ326146, respectively. To the best of our knowledge, this is the first report of CbVd-1 in the United States.

Download Full-text

First Report of Tomato chlorosis virus Infecting Tomato Crops in Brazil

Plant Disease ◽

10.1094/pdis-92-12-1709c ◽

2008 ◽

Vol 92 (12) ◽

pp. 1709-1709 ◽

Cited By ~ 25

Author(s):

J. C. Barbosa ◽

A. P. M. Teixeira ◽

A. G. Moreira ◽

L. E. A. Camargo ◽

A. Bergamin Filho ◽

...

Keyword(s):

Consensus Sequence ◽

The United States ◽

Sao Paulo ◽

São Paulo ◽

Rt Pcr ◽

Greenhouse Whitefly ◽

Thin Sections ◽

First Report ◽

Tomato Chlorosis Virus ◽

Biotype B

During 2006 and 2007 in the region of Sumaré, state of São Paulo, Brazil, surveys were done on tomato (Solanum lycopersicum L.) virus diseases in three open field-grown crops. The data revealed low incidence (0.25 to 3.42%) of randomly distributed plants exhibiting interveinal chlorosis and some necrosis on the basal leaves. Symptoms were only observed on old fruit-bearing plants. Preliminary analysis of thin sections of symptomatic leaves from one plant by transmission electron microscopy revealed the presence of aggregates of thin, flexible, and elongated particles in some phloem vessels, suggesting infection with a member of the genus Crinivirus, family Closteroviridae. Total RNA was extracted separately from leaves of 10 symptomatic plants and used for one-step reverse transcription (RT)-PCR using the HS-11/HS-12 primer pair, which amplifies a fragment of 587 bp from the highly conserved region of the heat shock protein (HSP-70) homolog gene reported for Tomato infectious chlorosis virus (TICV) and Tomato chlorosis virus (ToCV) (1). The RT-PCR product was subsequently tested by nested-PCR for single detection of TICV and ToCV using primer pairs TIC-3/TIC-4 and ToC-5/ToC-6, respectively (1). Only one fragment of approximately 463 bp was amplified from 7 of the 10 plants with the primer pair specific for ToCV. No amplification was obtained with the primers specific for TICV. Two amplicons of 463 bp were purified and directly sequenced in both directions. Sequence comparisons of the 463-bp consensus sequence (GenBank Accession No. EU868927) revealed 99% identity with the reported sequence of ToCV from the United States (GenBank Accession No. AY903448) (3). Virus-free adults of Bemisia tabaci biotype B confined on symptomatic tomato leaves for a 24-h acquisition access period were able to transmit the virus to healthy tomato plants, which reproduced the original symptoms on the bottom leaves 65 days after inoculation under greenhouse conditions. Infection from transmission was confirmed by RT-PCR using the HS-11/HS-12 primer pair. In addition to B. tabaci biotype B, the greenhouse whitefly, Trialeurodes vaporariorum, has also been reported as a vector of ToCV, although it is less efficient than the B. tabaci biotype B in transmission of this virus (4). T. vaporariorum, which was previously considered limited to greenhouses, was recently reported in tomato and green bean (Phaseolus vulgaris L.) crops under field conditions in São Paulo State (2). Therefore, it might also contribute to the spread of ToCV in tomato crops in São Paulo. To our knowledge, this is the first report of ToCV in Brazil and South America. References: (1) C. I. Dovas et al. Plant Dis.86:1345, 2002. (2) A. L. Lourenção et al. Neotrop. Entomol. 37:89, 2008. (3) W. M. Wintermantel et al. Arch. Virol. 15:2287, 2005. (4) W. M. Wintermantel and G. C. Wisler. Plant Dis. 90:814, 2006.

Download Full-text

First Report of Strawberry latent ringspot virus in a Mentha sp. from North America

Plant Disease ◽

10.1094/pdis.2004.88.8.907b ◽

2004 ◽

Vol 88 (8) ◽

pp. 907-907 ◽

Cited By ~ 18

Author(s):

J. D. Postman ◽

I. E. Tzanetakis ◽

R. R. Martin

Keyword(s):

United States ◽

North America ◽

Consensus Sequence ◽

The United States ◽

Ringspot Virus ◽

Yellow Vein ◽

Cdna Clones ◽

Meristem Culture ◽

Rt Pcr ◽

First Report

Yellow veinbanding symptoms have been observed in several mint clones at the U.S. Department of Agriculture, Agricultural Research Service, National Clonal Germplasm Repository (NCGR) mint collection in Corvallis, Oregon. The most dramatic symptoms are in a “variegated” clone of Mentha × gracilis Sole (NCGR Accession No. MEN-454), which is marketed widely in the nursery industry under cultivar names such as Golden Ginger Mint and Green and Gold. Tucker and Fairbrothers (2) proposed the name Mentha gentilis (= M. × gracilis) L. ‘Variegata’ for forms of this species with a graft transmissible variegation. Doublestranded RNA (dsRNA) was extracted from three mint clones with veinbanding symptoms of varying intensity. The dsRNA from MEN-454 was cloned, and sequences from several clones corresponded to RNA 2 of Strawberry latent ringspot virus (SLRSV), a tentative member of the family Sequiviridae. Sequences of additional cDNA clones suggested that two previously unknown viruses and the satellite RNA of SLRSV were also present in MEN-454. On the basis of the sequences of the SLRSV clones, primers F (5′ CCTCTCCAACCTGCTAGACT 3′) and R (5′ AAGCGCATGAAGGTGTAACT 3′) were developed and used in reverse transcription-polymerase chain reaction (RT-PCR) to amplify a 497-bp fragment of RNA 2 of SLRSV from MEN-454. No amplicons in RT-PCR tests or dsRNA was obtained from a clone of MEN-454 that was freed of the yellow vein symptom by heat therapy and apical meristem culture. The consensus sequence of cloned dsRNA and sequenced PCR products for SLRSV from MEN-454 has been deposited in GenBank (Accession No. AY 438666). Chenopodium quinoa, inoculated mechanically with leaf extracts from MEN-454, developed chlorosis and apical necrosis that were similar to symptoms reported for SLRSV infection (1). The presence of SLRSV in C. quinoa was confirmed using RT-PCR. Variegated M. × gracilis clones were obtained from wholesale and mail-order nurseries in Maryland, Ohio, and Nebraska. Samples were assayed using RT-PCR utilizing the F and R primers for presence of SLRSV. All samples tested positive for the virus using RT-PCR. Because of the presence of additional viruses, we cannot attribute yellow vein symptoms solely to SLRSV, however the presence of this virus in clones of M. × gracilis ‘Variegata’ from different regions throughout the United States demonstrates that SLRSV is distributed widely in the United States. To our knowledge, this is the first report of SLRSV in mint in North America. References: (1) K. Schmelzer. Phytopathol. Z. 66:1, 1969. (2) A. O. Tucker and D. E. Fairbrothers. Taxon 21:209, 1972.

Download Full-text

First Report of Plantago asiatica mosaic virus in Imported Asiatic and Oriental Lilies (Lilium hybrids) in the United States

Plant Disease ◽

10.1094/pdis-08-14-0792-pdn ◽

2015 ◽

Vol 99 (2) ◽

pp. 292-292 ◽

Cited By ~ 8

Author(s):

J. Hammond ◽

D. Bampi ◽

M. D. Reinsel

Keyword(s):

United States ◽

The Netherlands ◽

Mosaic Virus ◽

Consensus Sequence ◽

Chenopodium Quinoa ◽

The United States ◽

Rt Pcr ◽

Protein Amino Acid ◽

Lily Symptomless Virus ◽

Plantago Asiatica

Asiatic and Oriental hybrid lilies (Lilium sp., Liliaceae) are bulbous ornamentals valued for their flowers. Bulbs of several varieties of each lily type, imported from the Netherlands, were purchased in spring 2013 from retail nurseries and grown in a cool greenhouse; additional bulbs were obtained in 2014. After flowering in 2013, but prior to leaf senescence, necrotic streaking was observed in midstem leaves of several plants. RNA extracted from leaves of several individual plants was subjected to reverse-transcription–polymerase chain reaction (RT-PCR) assay using NSNC-odT primed cDNA and PCR with primers PxDeg/BNSNC or potyS/BNSNC to amplify potexvirus/carlavirus and potyvirus products respectively (2,3,4). Sequencing of a c. 1.7-kb PCR product from one lily identified Lily symptomless virus (LSV). Mechanical inoculation of pooled lily leaf samples to Nicotiana benthamiana, N. glutinosa, and Chenopodium quinoa (not hosts of LSV) yielded chlorotic or necrotic local lesions on C. quinoa and systemic mosaic with necrotic spotting, streaking, or apical necrosis on N. benthamiana; electron microscopy revealed potexvirus-like flexuous particles. RT-PCR from C. quinoa and N. benthamiana with PxDeg/BNSNC yielded a c. 1.3-kb product, which was cloned and sequenced; the consensus sequence (KM205357) had 98.7% nucleotide identity to a Dutch isolate of Plantago asiatica mosaic virus (PlAMV, KF471012; 78.5 to 87.8% to other isolates), and 99.0% coat protein amino acid identity to KF471012 (88.9 to 93.2% to other isolates). The 2013 lilies were stored overwinter at 4°C, and RNA was extracted from roots of individual bulbs. Primers PlAMV CP-F2 (TTCGTCACCCTCAGCGG) and PlAMV CP-R3 (AAACGGTAAAATACACACCGGG) were designed based on alignment of KM205357 with all PlAMV sequences available in GenBank. RT-PCR using PlAMV CP-F2/CP-R3 yielded products of the expected 511 bp from 20 bulbs and no product from a no-template control. ELISA of root and bulbscale samples using PlAMV-lily specific antibody and conjugate (a gift of R. Miglino, BKD, The Netherlands) confirmed PlAMV in seven of 20 bulbs positive by RT-PCR. Bioassay of PCR-positive lilies on N. benthamiana, C. quinoa, and Tetragonia expansa confirmed infection in three out of eight by both symptoms and ELISA. Altogether nine out of 13 Asiatic lilies (four of four cultivars: America, Connecticut King, Grand Cru, and Pink Pixie) and 11 Oriental lilies (cvs. Stargazer and Starfighter) were found to be infected with PlAMV by RT-PCR, of which seven were confirmed by bioassay and/or ELISA. Bulbs obtained in 2014 were tested only by ELISA; five of 18 Asiatic lilies (three of six cultivars: Connecticut King, Crimson Pixie, and Yellow Electric) and three of 13 Oriental lilies (three of six cultivars: Anastasia, Casa Blanca, and Garden Party) were found to be infected. PlAMV was reported in lilies in the Netherlands in 2010, with losses of up to 80% in greenhouse cut-flower production (1). The Nandina mosaic isolate (PlAMV-NMV) has been known in the United States since 1976 (5), but PlAMV infection of lily has not previously been documented in the United States. Both RT-PCR and ELISA tests also detected PlAMV-NMV. The degree of damage observed in the Netherlands suggests that growers should seek bulb stocks free of PlAMV. References: (1) Anonymous. https://www.vwa.nl/txmpub/files/?p_file_id=2001424 , accessed June 11, 2014. (2) S. Chen et al. Acta Biochim. Biophys. Sin. 43:465, 2011. (3) J. Hammond et al. Arch. Virol. 151:477, 2006. (4) J. Hammond and M. Reinsel. Acta Hort. 901:119, 2011. (5) P. Moreno et al. Proc. Am. Phytopathol. Soc. 3:319, 1976.

Download Full-text

First Report of Catharanthus mosaic virus in Mandevilla in the United States

Plant Disease ◽

10.1094/pdis-09-14-0913-pdn ◽

2015 ◽

Vol 99 (1) ◽

pp. 165-165 ◽

Cited By ~ 4

Author(s):

D. Mollov ◽

M. A. Guaragna ◽

B. Lockhart ◽

J. A. M. Rezende ◽

R. Jordan

Keyword(s):

United States ◽

Amino Acid ◽

Mosaic Virus ◽

Consensus Sequence ◽

The United States ◽

Amino Acid Sequences ◽

Universal Primers ◽

Rt Pcr ◽

First Report ◽

Virus Particles

Mandevilla (Apocynaceae) is an ornamental tropical vine popular for its bright and attractive flowers. During 2012 to 2013, 12 Mandevilla sp. samples from Minnesota and Florida nurseries were submitted for analysis at the University of Minnesota Plant Disease Clinic. Plants showed mosaic symptoms, leaf deformation, premature leaf senescence, and vine dieback. Filamentous virus particles with modal lengths 700 to 900 nm were observed by transmission electron microscopy (TEM) in partially purified preparations from symptomatic leaves. Partially purified virions were obtained using 30% sucrose cushion centrifuged at 109,000 gmax for 2 h at 10°C (5). No other virus particles were observed in these samples, nor were any observed in non-symptomatic samples. One sample was submitted as potted plant (Mandevilla ‘Sunmandeho’ Sun Parasol Giant White) and was kept under greenhouse conditions for subsequent analyses. Total RNA (Qiagen) was extracted from this sample, and Potyvirus was detected using the universal primers Poty S (5′-GGN AAY AAY AGY GGN CAR CC-3′) and PV1 (5′-20(T)V-3′) (1) by reverse transcription (RT)-PCR (3). The amplified product was the expected ~1.7-kb, corresponding to the partial nuclear inclusion body gene, the coat protein (CP) gene, and the 3′ end untranslated region. The RT-PCR amplicon was cloned (NEB) and sequenced, and the 1,720-bp consensus sequence was deposited in GenBank (Accession No. KM243928). NCBI BLAST analysis at the nucleotide level revealed highest identity (83%) with an isolate of Catharanthus mosaic virus (CatMV) from Brazil (Accession No. DQ365928). Pairwise analysis of the predicted 256 amino acid CP revealed 91% identity with the CatMV Brazilian isolate (ABI94824) and 68% or less identity with other potyviruses. Two potyviruses are usually considered the same species if their CP amino acid sequences are greater than 80% identical (2). Serological analysis of the infected sample Mandevilla ‘Sunmandeho’ Sun Parasol Giant White using a CatMV specific antiserum (4) resulted in positive indirect ELISA reactions. CatMV has been previously reported in periwinkle (Catharanthus roseus) in Brazil (4). Based on the analyses by TEM, RT-PCR, nucleotide and amino acid sequence identities, and serological reactivity, we identify this virus as a U.S. Mandevilla isolate of CatMV. To our knowledge, this is the first report of Catharanthus mosaic virus both in the United States and in Mandevilla. References: (1) J. Chen et al. Arch Virol. 146:757, 2001. (2) A. Gibbs and K. Ohshima. Ann. Rev. Phytopathol. 48:205, 2010. (3) R. L. Jordan et al. Acta Hortic. 901:159, 2011. (4) S. C. Maciell et al. Sci. Agric. Piracicaba, Brazil. 68:687, 2011. (5) D. Mollov et al. Arch Virol. 158:1917, 2013.

Download Full-text

First report of dasheen mosaic virus infecting taro (Colocasia esculenta) in Louisiana

Plant Disease ◽

10.1094/pdis-04-21-0854-pdn ◽

2021 ◽

Author(s):

Cesar Escalante ◽

David Galo ◽

Rodrigo Diaz ◽

Rodrigo Valverde

Keyword(s):

United States ◽

Mosaic Virus ◽

Consensus Sequence ◽

The United States ◽

Colocasia Esculenta ◽

Rt Pcr ◽

Serological Tests ◽

First Report ◽

Pcr Products ◽

The University

Taro [Colocasia esculenta (L.) Schott], also called dasheen or malanga is an important staple crop in many tropical and subtropical countries (Chaïr et al. 2016). In October 2020, taro plants showing foliar symptoms consisting of mosaic, feathery mottle, and vein clearing patterns were observed in the Hilltop Arboretum, the Bluebonnet Swamp Nature Center, the Louisiana State University Agricultural Center Botanic Gardens, and the University Lake, in Baton Rouge, Louisiana. Unidentified aphids were also observed infesting the plants showing the described symptoms. From each location, two foliar samples from symptomatic and two from asymptomatic plants were collected and tested by ELISA using antiserum for general potyvirus group (Agdia, Elkhart, IN). Seven of eight symptomatic samples tested positive while the asymptomatic samples were negative. The seven positive samples were used to perform an additional ELISA test using antiserum specific for dasheen mosaic virus (DsMV) (Agdia). All seven samples tested positive for DsMV. To confirm the identity of the virus, total RNA was extracted from the seven samples using the PureLink® Plant RNA Reagent Kit (Invitrogen, Carlsbad, CA). After DNA digestion with PerfeCta® DNase I (Qiagen, Beverly, MA), the RNA was used to perform reverse transcription polymerase chain reaction (RT-PCR) with primer set DMV 5708-5731-F/DMV 6131-6154-R which is specific for DsMV (Wang et al. 2017). RT-PCR was performed using the AccessQuickTM RT-PCR System (Promega, Madison, WI) following the reaction conditions described by Wang et al. PCR products of the expected size (~447 bp) were obtained with all seven samples and were Sanger-sequenced. A consensus sequence (MW284936) was obtained with the two sequences from samples collected at the University Lake and aligned with other sequences available in the GenBank using BLASTn. Our isolate of DsMV showed 90.6% nt identity to an isolate of DsMV from Ethiopia (MG602229). Mechanical inoculations to healthy taro plants were conducted using leaf tissue of symptomatic plants as source of inoculum. Inoculated plants exhibited mosaic symptoms three weeks after inoculation and were ELISA-positive for DsMV. Symptomatology, serological tests, RT-PCR testing, and DNA sequencing of RT-PCR products support that the symptomatic taro plants were infected with DsMV. Taro is a crop in Hawaii, but in the contiguous United States, it is mostly grown as an ornamental and is considered an invasive species. Its distribution is restricted to the southern continental states and Hawaii (Cozad et al. 2018). CABI, EPPO (1998) lists the presence of DsMV in several states of the United States, including Louisiana; however, there is no record in the literature of the identification of this virus in Louisiana. The potential impact of DsMV in taro and related ornamental species in southern United States is unknown. To the best of our knowledge, this is the first report documenting DsMV infecting taro in Louisiana.

Download Full-text

First Report of Potato spindle tuber viroid Naturally Infecting Field Tomatoes in the Dominican Republic

Plant Disease ◽

10.1094/pdis-09-13-0992-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 701-701

Author(s):

K.-S. Ling ◽

R. Li ◽

D. Groth-Helms ◽

F. M. Assis-Filho

Keyword(s):

United States ◽

Dominican Republic ◽

Mosaic Virus ◽

Potato Spindle Tuber Viroid ◽

The United States ◽

Disease Outbreak ◽

Ringspot Virus ◽

Rt Pcr ◽

Spot Virus ◽

Three Samples

In recent years, viroid disease outbreaks have resulted in serious economic losses to a number of tomato growers in North America (1,2,3). At least three pospiviroids have been identified as the causal agents of tomato disease, including Potato spindle tuber viroid (PSTVd), Tomato chlorotic dwarf viroid (TCDVd), and Mexican papita viroid (MPVd). In the spring of 2013, a severe disease outbreak with virus-like symptoms (chlorosis and plant stunting) was observed in a tomato field located in the Dominican Republic, whose tomato production is generally exported to the United States in the winter months. The transplants were produced in house. The disease has reached an epidemic level with many diseased plants pulled and disposed of accordingly. Three samples collected in May of 2013 were screened by ELISA against 16 common tomato viruses (Alfalfa mosaic virus, Cucumber mosaic virus, Impatiens necrotic spot virus, Pepino mosaic virus, Potato virus X, Potato virus Y, Tobacco etch virus, Tobacco mosaic virus, Tobacco ringspot virus, Tomato aspermy virus, Tomato bushy stunt virus, Tomato mosaic virus, Tomato ringspot virus, Tomato spotted wilt virus, Groundnut ringspot virus, and Tomato chlorotic spot virus), a virus group (Potyvirus group), three bacteria (Clavibacter michiganensis subsp. michiganensis, Pectobacterium atrosepticum, and Xanthomonas spp.), and Phytophthora spp. No positive result was observed, despite the presence of symptoms typical of a viral-like disease. Further analysis by RT-PCR using Agdia's proprietary pospiviroid group-specific primer resulted in positive reactions in all three samples. To determine which species of pospiviroid was present in these tomato samples, full-genomic products of the expected size (~360 bp) were amplified by RT-PCR using specific primers for PSTVd (4) and cloned using TOPO-TA cloning kit (Invitrogen, CA). A total of 8 to 10 clones from each isolate were selected for sequencing. Sequences from each clone were nearly identical and the predominant sequence DR13-01 was deposited in GenBank (Accession No. KF683200). BLASTn searches into the NCBI database demonstrated that isolate DR13-01 shared 97% sequence identity to PSTVd isolates identified in wild Solanum (U51895), cape gooseberry (EU862231), or pepper (AY532803), and 96% identity to the tomato-infecting PSTVd isolate from the United States (JX280944). The relatively lower genome sequence identity (96%) to the tomato-infecting PSTVd isolate in the United States (JX280944) suggests that PSTVd from the Dominican Republic was likely introduced from a different source, although the exact source that resulted in the current disease outbreak remains unknown. It may be the result of an inadvertent introduction of contaminated tomato seed lots or simply from local wild plants. Further investigation is necessary to determine the likely source and route of introduction of PSTVd identified in the current epidemic. Thus, proper control measures could be recommended for disease management. The detection of this viroid disease outbreak in the Dominican Republic represents further geographic expansion of the viroid disease in tomatoes beyond North America. References: (1). K.-S. Ling and M. Bledsoe. Plant Dis. 93:839, 2009. (2) K.-S. Ling and W. Zhang. Plant Dis. 93:1216, 2009. (3) K.-S. Ling et al. Plant Dis. 93:1075, 2009. (4) A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997.

Download Full-text

First Report of Lolium latent virus in Ryegrass in the United States

Plant Disease ◽

10.1094/pd-90-0528c ◽

2006 ◽

Vol 90 (4) ◽

pp. 528-528 ◽

Cited By ~ 3

Author(s):

C. J. Maroon-Lango ◽

J. Hammond ◽

S. Warnke ◽

R. Li ◽

R. Mock

Keyword(s):

United States ◽

Lolium Perenne ◽

The United States ◽

Latent Virus ◽

Hybrid Population ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

High Sequence Identity ◽

Lolium Perenne L ◽

Pcr Test

Initial reports of the presence of Lolium latent virus (LLV) in Lolium perenne L. and L. multiflorum Lam. breeding clones in Germany, the Netherlands, France (2), and recently the United Kingdom (3,4; described as Ryegrass latent virus prior to identification as LLV) prompted us to evaluate clonally propagated Lolium plants from the United States. Four genetically distinct plants (viz., MF22, MF48, MF125, and MF132) that have been maintained clonally for 5 years from a Lolium perenne × L. multiflorum hybrid population established in the United States exhibited either no symptoms or mild chlorotic flecking that coalesced to form chlorotic to necrotic streaking on the leaves. All four clonal plants tested positive using reverse transcription-polymerase chain reaction (RT-PCR) with the Potexvirus group PCR test (Agdia, Inc., Elkhart, IN), whereas all clones but MF48 tested positive using the Potyvirus group PCR test (Agdia, Inc.). No amplicons were obtained when the same plants were tested for tobamovirus, carlavirus, and closterovirus using appropriate virus group-specific primers. Cloning and sequencing of the potexviral amplicons revealed very high sequence identity with the comparable region of LLV-UK (GenBank Accession No. DQ333886), whereas those of the potyviral amplicons (GenBank Accession Nos. DQ355837 and DQ355838) were nearly identical with the comparable region of Ryegrass mosaic virus (RGMV), a rymovirus first reported from the United States in 1957 (1). Using indirect enzyme-linked immunosorbent assay (ELISA), extracts from all four Lolium clonal propagations tested positive for LLV using the antiserum raised to LLV-Germany (courtesy of Dr. Huth), whereas the potyvirus-positive results from RT-PCR of the three clones were confirmed using indirect ELISA with the broad spectrum potyvirus monoclonal antibody, PTY-1. LLV from singly or dually infected Lolium clones was transmitted to Nicotiana benthamiana Domin. but not to N. tabacum L. by mechanical inoculation. LLV was purified from infected N. benthamiana. Similar sized flexuous rods were observed using electron microscopy in leaf dip samples from Lolium clones and aliquots of the virions purified from N. benthamiana. References: (1) G. W. Bruehl et al. Phytopathology 47:517, 1957. (2) W. Huth et al. Agronomie 15:508, 1995. (3) R. Li et al. Asian Conf. Plant Pathol. 2:89, 2005. (4) C. Maroon-Lango et al. Int. Congr. Virol. 13:63, 2005.

Download Full-text

Alternanthera mosaic virus Found in Scutellaria, Crossandra, and Portulaca spp. in Florida

Plant Disease ◽

10.1094/pd-90-0833c ◽

2006 ◽

Vol 90 (6) ◽

pp. 833-833 ◽

Cited By ~ 11

Author(s):

C. A. Baker ◽

L. Breman ◽

L. Jones

Keyword(s):

Electron Microscopy ◽

United States ◽

Mosaic Virus ◽

Plant Species ◽

The United States ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

Indicator Plants ◽

Partial Identity ◽

Pcr Products

In the fall of 1998, the Division of Plant Industry (DPI) received vegetative propagations of Scutellaria longifolia (skullcap) with symptoms of foliar mosaic, chlorotic/necrotic ringspots, and wavy line patterns from a nursery in Manatee County. Flexuous particles approximately 500 nm long were found with electron microscopy. The plants tested positive for Papaya mosaic virus (PaMV) in an enzyme-linked immunosorbent assay (ELISA) test with antiserum to PaMV (Agdia, Elkhart, IN). However, in immunodiffusion tests (antiserum from D. Purcifull, University of Florida), this virus gave a reaction of partial identity indicating it was related but not identical to PaMV (1). The original infected plants were kept in a greenhouse. In January 2005, a specimen of Crossandra infundibuliformis (firecracker plant) with mosaic symptoms was submitted to the DPI from a nursery in Alachua County. Inclusions found with light microscopy and particles found with electron microscopy indicated that this plant was infected with a potexvirus. This was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) with primers designed to detect members of the virus family Potexviridae (3). These plants reacted positive to PaMV antiserum in ELISA and gave a reaction of partial identity to PaMV in immunodiffusion. A specimen of Portulaca grandiflora (moss rose) with distorted leaves found at a local retail store was also tested and gave the same results. Leaves from each of the three plant species were rubbed onto a set of indicator plants using Carborundum and potassium phosphate buffer. Total RNA was extracted from symptomatic indicator plants of Nicotiana benthamiana. RT-PCR (3) was performed, and PCR products were sequenced directly. Sequences of approximately 700 bp were obtained for all three plant species and showed 98% identity with each other. BLAST search results showed that these sequences were 93% identical to an Alternanthera mosaic virus (AltMV) sequence at the nucleotide level but only 76% identical to PaMV. The amino acid sequences were 98 and 82% identical to AltMV and PaMV, respectively. The PCR products of the virus from Scutellaria sp. were cloned, resequenced, and the sequence was entered into the GenBank (Accession No. DQ393785). The bioassay results matched those found for AltMV in Australia (2) and the northeastern United States (4), except that the Florida viruses infected Datura stramonium and Digitalis purpurea (foxglove). The virus associated with the symptoms of these three plants appears to be AltMV and not PaMV. AltMV has been found in ornamental plants in Australia, Italy, and the United States (Pennsylvania, Maryland, and now Florida). Since this virus is known to infect several plants asymptomatically and can be easily confused with PaMV serologically, it is likely that the distribution of this virus is much wider than is known at this time. References: (1) L. L. Breman. Plant Pathology Circular No. 396. Fla. Dept. Agric. Consum. Serv. DPI, 1999. (2) A. D. W. Geering and J. E. Thomas. Arch Virol 144:577, 1999. (3) A. Gibbs et al. J Virol Methods 74:67, 1998. (4) J. Hammond et al. Arch Virol. 151:477, 2006.

Download Full-text

Molecular Characterization of Recombinant Strains of Potato virus Y From Saudi Arabia

Plant Disease ◽

10.1094/pdis-05-15-0562-re ◽

2016 ◽

Vol 100 (2) ◽

pp. 292-297 ◽

Cited By ~ 14

Author(s):

Mohamad Chikh-Ali ◽

Hayam Alruwaili ◽

Dalton Vander Pol ◽

Alexander V. Karasev

Keyword(s):

United States ◽

Saudi Arabia ◽

Seed Potato ◽

Potato Virus ◽

Potato Virus Y ◽

The United States ◽

Tuber Quality ◽

Rt Pcr ◽

First Report ◽

Recombinant Strains

Potato virus Y (PVY) exists as a complex of strains, many of which are recombinants. The practical importance of PVY recombinant strains has increased due to their ability to induce potato tuber necrotic ring spot disease (PTNRD) that seriously affects tuber quality. In Saudi Arabia, potato production has increased fivefold during the last three decades, reaching 460,000 tons per year. Although PVY has been reported as one of the main viruses affecting potatoes, no information is available on PVY strains circulating in the country. In August 2014, a survey was conducted in a seed potato field at Al-Jouf, Saudi Arabia. PVY-positive samples selected based on visual symptoms and serological reactivity were subjected to strain typing using multiplex RT-PCR assays and were determined to represent recombinant PVY strains. Whole genome sequences were determined for two representative isolates, S2 and S9, through direct sequencing of a series of overlapping RT-PCR fragments for each isolate, and found to represent strains PVY-NE11 and PVYZ (SYR-III), respectively. One of the recombinant types, SYR-III, was previously found in nearby Syria and Jordan, but the second recombinant, PVY-NE11, was found before only in the United States. Both recombinants, PVY-NE11 and SYR-III, were previously found associated with PTNRD and thought to be rare. The current identification of PVY-NE11 and SYR-III in seed potato in a new geographic region suggests that these recombinants may not be as rare as previously believed. This is the first report on the occurrence of recombinant strains of PVY in potato in Saudi Arabia, and the first report on the PVY-NE11 strain of PVY found in potato outside of the United States.

Download Full-text