First Report of Tomato infectious chlorosis virus in Tomato in Indonesia

In 2002, a breeding company submitted several samples of tomato (Lycopersicon esculentum) for diagnosis. Samples originated in Indonesia and were taken from protected and nonprotected crops. Plants exhibited severe chlorosis on fully expanded leaves, while young leaves were symptomless. Symptoms resembled those of the criniviruses Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV). Moreover, large numbers of whiteflies, potential vectors of these viruses, had been observed at the plots with symptomatic plants. A reverse transcription-polymerase chain reaction (RT-PCR) with specific primers for TICV (1) yielded amplicons of the expected size of approximately 500 bp for all samples. One of the amplicons was sequenced (Genbank Accession No. AY221097) and revealed more than 98.9% identity to six isolates of TICV in NCBI Genbank. cDNA synthesis using the universal crinivirus primer HSP_M2-DW (5′ -TCRAARGTWCCKCCNCCRAA-3′) followed by PCR with a ToCV specific primerset (ToCV-UP 5′-TCATTAAAACTCAATGGGACCGAG-3′ and ToCV-DW 5′-GCGACGT AAATTGAAACCC-3′) was negative in all cases. Grafting of symptomatic shoots onto healthy tomato seedlings of cv. Money-maker showed transmission of the virus, as chlorosis appeared on fully expanded leaves of lateral shoots after 6 weeks. The presence of TICV in the graft-inoculated plants was confirmed by RT-PCR. Furthermore, mechanical inoculation to a range of herbaceous test plants did not evoke any virus symptoms, indicating the absence of mechanically transmissible viruses. Although other nonmechanically transmissible viruses cannot be fully excluded, the results together with the symptoms observed, indicate that TICV is the cause of the disease. TICV has been reported from Greece, Italy, Japan, Spain, and the United States, but to our knowledge, this is the first report of TICV in Indonesia. Reference: (1) A. M. Vaira et al. Phytoparasitica 30:290, 2002.

Download Full-text

First Report of Tomato chlorosis virus in Lebanon

Plant Disease ◽

10.1094/pd-90-0378c ◽

2006 ◽

Vol 90 (3) ◽

pp. 378-378 ◽

Cited By ~ 15

Author(s):

Y. Abou-Jawdah ◽

C. El Mohtar ◽

H. Atamian ◽

H. Sobh

Keyword(s):

The United States ◽

Limiting Factor ◽

Rt Pcr ◽

Tomato Seedling ◽

Tomato Production ◽

First Report ◽

Tomato Seedlings ◽

Plant Pathol ◽

Tomato Chlorosis Virus ◽

Leaf Curl

Tomato seedlings showing leaf curl and yellowing symptoms characteristic of Tomato yellow leaf curl virus (TYLCV) were brought to the university laboratory from a commercial tomato greenhouse located in the Damour coastal area, south of Beirut, Lebanon. They were first tested using polymerase chain reaction (PCR) to ascertain their infection by TYLCV and then they were used in a trial to evaluate resistance of three local accessions of tomato to TYLCV, the major limiting factor to tomato production in Lebanon. Whiteflies (Bemisia tabaci), reared on broccoli for several generations, were allowed an acquisition access period of 48 h on tomato seedlings putatively infected with TYLCV and then were transferred to test plants at an average of 40 to 60 whiteflies per tomato seedling at the first-true leaf stage for an inoculation feeding period of 3 days. All treatments were conducted in insect-proof cages. Clear TYLCV symptoms were observed on the three local tomato accessions approximately 3 weeks after inoculation. However, 7 to 8 weeks after inoculation, many plants showed yellowing symptoms on the lower leaves that were not observed in previous experiments. Infections by Tomato chlorosis virus (ToCV) and/or Tomato infectious chlorosis virus (TICV), two criniviruses belonging to the family Closteroviridae, were suspected. Diagnostic tests using PCR for TYLCV detection (1) and reverse transcription (RT)-PCR for detection of ToCV (2) or TICV (3) showed that some tomato plants had a mixed infection with TYLCV and ToCV. None of the tested samples was positive for TICV. The RT-PCR amplicons (434 nt) obtained with the ToCV specific primers were cloned into pGEM-T easy vector. Sequence analysis of one clone revealed more than 99% nucleotide identity with the heat shock protein homologue (HSP70h) of ToCV isolates from the United States (GenBank Accession Nos. AY903448, AF024630, and AY444872) and 100% amino acid identity to ToCV isolates from Italy and Portugal (GenBank Accession Nos. AY048854.1 and AF234029.1). The sequence was submitted to GenBank (Accession No. DQ234079). Twenty-two tomato samples were then collected from plants showing yellowing symptoms on their lower leaves. The samples were taken from two greenhouses at the same farm in the Damour area. Six samples tested positive for ToCV using RT-PCR. To our knowledge, this is the first report of ToCV in Lebanon, but its incidence and distribution was not monitored. However, on the basis of symptoms and preliminary RT-PCR results, the disease does not appear to be widely spread in the country. References: (1) G. H. Anfoka et al. J. Plant Pathol. 87:65, 2005. (2) D. Louro et al. Eur. J. Plant Pathol. 106:589, 2000. (3) A. M. Vaira et al. Phytoparasitica 30:290, 2002.

Download Full-text

First Report of Tomato infectious chlorosis virus in Spain

Plant Disease ◽

10.1094/pdis.2002.86.6.696a ◽

2002 ◽

Vol 86 (6) ◽

pp. 696-696 ◽

Cited By ~ 12

Author(s):

M. I. Font ◽

P. Martínez-Culebras ◽

M. C. Jorda ◽

D. Louro ◽

A. M. Vaira ◽

...

Keyword(s):

Polymerase Chain Reaction ◽

The United States ◽

Mixed Infections ◽

Chain Reaction ◽

First Report ◽

Dna Fragment ◽

Polymerase Chain ◽

Plant Pathol ◽

Tomato Chlorosis Virus ◽

Tomato Infectious Chlorosis Virus

During the summer and autumn of 2001, symptoms of interveinal yellowing, bronzing, brittleness, and rolling of lower leaves were observed in greenhouse- and field-grown tomato (Lycopersicon esculentum) plants in Castellon Province in eastern Spain. Symptoms resembled those caused by the whitefly-transmitted criniviruses (1,2). Total RNA was extracted from 28 samples of symptomatic leaves collected in three greenhouses and one field and analyzed by reverse transcription-polymerase chain reaction using primers specific for Tomato chlorosis virus (ToCV) (1) and Tomato infectious chlorosis virus (TICV) (2). The 501-bp TICV-specific DNA fragment was amplified in four samples collected during the summer in three greenhouses and one field, and the 439-bp ToCV-specific DNA fragment was amplified in 15 samples collected during the autumn in the same three greenhouses; no mixed infections were found. The DNA fragments amplified from TICV were sequenced and showed 99 to 100% identity with the TICV isolates (GenBank Accession Nos. U67449 and AY048855) from the United States and Italy, respectively, confirming the diagnosis. One sequence was deposited as GenBank Accession No. AF479662. To our knowledge, this is the first report of TICV in Spain and the second in Europe. References: (1) D. Louro et al. Eur. J. Plant Pathol. 106:539, 2000. (2) A. M. Vaira et al. Phytoparasitica. In Press.

Download Full-text

First Report of Tomato chlorosis virus in Italy

Plant Disease ◽

10.1094/pdis.2001.85.11.1208c ◽

2001 ◽

Vol 85 (11) ◽

pp. 1208-1208 ◽

Cited By ~ 27

Author(s):

G. P. Accotto ◽

A. M. Vaira ◽

M. Vecchiati ◽

M. M. Finetti Sialer ◽

D. Gallitelli ◽

...

Keyword(s):

The United States ◽

Trialeurodes Vaporariorum ◽

Physiological Disorder ◽

First Report ◽

Leaf Tissues ◽

Symptomatic Leaf ◽

Dna Fragment ◽

Polymerase Chain ◽

Tomato Chlorosis Virus ◽

Tomato Infectious Chlorosis Virus

During winter 2000-2001, an unusual disease of tomato was observed in some greenhouses in Sardinia, Sicily, and Apulia, in southern Italy. Plants were chlorotic and reduced in size, expanded leaves showed interveinal yellowing, and older leaves developed interveinal reddish-bronze necrosis and downward rolling. The symptoms resembled those recently reported from Portugal (1) as induced by Tomato chlorosis virus (ToCV) (family Closteroviridae, genus Crinivirus), a whitefly-transmitted virus new to Europe. Symptomatic leaf tissues were extracted and analyzed by reverse transcription-polymerase chain reaction as described by Louro et al.(1). The 439-bp ToCV-specific DNA fragment was amplified in samples collected from 6 of 14 greenhouses in Sardinia, 2 of 5 greenhouses in Sicily, and 1 of 1 greenhouse in Apulia. The sequence of the fragment obtained from a Sicilian isolate (GenBank Accession No. AY048854) showed more than 99% identity to ToCV isolates (Accession Nos. AF024630 and AF234029) from the United States and Portugal, respectively. Infestations of Trialeurodes vaporariorum and Bemisia tabaci have been reported in autumn. To our knowledge, this is the first report of ToCV in Italy. Although we found the virus in three regions of the country, its distribution is likely to be wider, since the symptoms can be mistaken for those of a physiological disorder or of Tomato infectious chlorosis virus, another crinivirus infecting tomato. Reference: (1) Louro et al. Eur. J. Plant Pathol. 106:589, 2000.

Download Full-text

First Report of Tomato chlorosis virus and Tomato infectious chlorosis virus in Tomato Crops in France

Plant Disease ◽

10.1094/pd-89-1243c ◽

2005 ◽

Vol 89 (11) ◽

pp. 1243-1243 ◽

Cited By ~ 24

Author(s):

A. Dalmon ◽

S. Bouyer ◽

M. Cailly ◽

M. Girard ◽

H. Lecoq ◽

...

Keyword(s):

Protein Gene ◽

The United States ◽

Rt Pcr ◽

Specific Primers ◽

Southern France ◽

Sequence Identity ◽

Two Samples ◽

Dna Fragment ◽

Tomato Chlorosis Virus ◽

Tomato Infectious Chlorosis Virus

Since 2002, yellowing symptoms associated with high levels of white-fly populations have been observed in plants of protected tomato crops in France. Symptomatic plants exhibited interveinal yellowing areas in older leaves, followed by generalized yellowing. Symptoms were not observed in young plants or fruits. Trialeurodes vaporariorum populations were generally abundant in spring, and Bemisia tabaci (established in France for approximately 10 years) became predominant in summer and fall. To check for the presence of Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV), two whitefly-transmitted criniviruses known to induce yellowing symptoms, 696 samples were collected in the major tomato-growing areas; 573 samples from southern France and 123 samples from northern France. Total RNA was extracted from each sample and analyzed using reverse transcription-polymerase chain reaction (RT-PCR). Primers specific to ToCV (2) and TICV (1,3) were used to amplify either part of the heat-shock-like protein gene HSP70h (both viruses) or part of the diverged coat protein gene (CPd), (TICV only). A 439-bp DNA fragment was obtained with ToCV primers in 178 samples from southern France collected mainly from mid-spring to early fall from 2002 to 2004. Three RT-PCR products amplified from samples collected from diverse growing areas were sequenced and showed 99 to 100% sequence identity with published ToCV sequences from Spain (GenBank Accession Nos. AF215818, AF233435, and AF215817), Portugal (GenBank Accession No. AF234029), Sicily (GenBank Accession No. AY048854), and the United States (GenBank Accession No. AF024630). Considering the high frequency of ToCV-infected samples (41 positive samples of 112 samples collected in 2002, 71 of 295 collected in 2003, and 66 of 166 collected in 2004), this virus appears to be well established in southern France but remains absent in the northern regions. The presence of TICV was tested in 485 samples using the CPd-specific primers or the HSP70h-specific primers. The virus was detected in only two samples from Nice (southeastern France) in 2003 with both primer pairs. The CPd DNA fragment (700 bp) from one of these samples was sequenced, showing 98.9% sequence identity with a TICV Japanese isolate (AB085603). Results of these assays suggest that in contrast to ToCV, TICV is not yet broadly established in France. This difference could be associated with the specificity of the vectors, since ToCV is transmitted by B. tabaci and T. vaporariorum, while TICV is transmitted only by T. vaporariorum (4). References: (1) R. H. Li et al. Plant Dis. 82:84, 1998. (2) D. Louro et al. Eur. J. Plant Pathol. 1065:589, 2000. (3) A. M. Vaira et al. Phytoparasitica 30:290, 2002. (4) G. C. Wisler et al. Plant Dis. 82:271, 1998.

Download Full-text

First Report of Tomato chlorosis virus Infecting Tomato Crops in Brazil

Plant Disease ◽

10.1094/pdis-92-12-1709c ◽

2008 ◽

Vol 92 (12) ◽

pp. 1709-1709 ◽

Cited By ~ 25

Author(s):

J. C. Barbosa ◽

A. P. M. Teixeira ◽

A. G. Moreira ◽

L. E. A. Camargo ◽

A. Bergamin Filho ◽

...

Keyword(s):

Consensus Sequence ◽

The United States ◽

Sao Paulo ◽

São Paulo ◽

Rt Pcr ◽

Greenhouse Whitefly ◽

Thin Sections ◽

First Report ◽

Tomato Chlorosis Virus ◽

Biotype B

During 2006 and 2007 in the region of Sumaré, state of São Paulo, Brazil, surveys were done on tomato (Solanum lycopersicum L.) virus diseases in three open field-grown crops. The data revealed low incidence (0.25 to 3.42%) of randomly distributed plants exhibiting interveinal chlorosis and some necrosis on the basal leaves. Symptoms were only observed on old fruit-bearing plants. Preliminary analysis of thin sections of symptomatic leaves from one plant by transmission electron microscopy revealed the presence of aggregates of thin, flexible, and elongated particles in some phloem vessels, suggesting infection with a member of the genus Crinivirus, family Closteroviridae. Total RNA was extracted separately from leaves of 10 symptomatic plants and used for one-step reverse transcription (RT)-PCR using the HS-11/HS-12 primer pair, which amplifies a fragment of 587 bp from the highly conserved region of the heat shock protein (HSP-70) homolog gene reported for Tomato infectious chlorosis virus (TICV) and Tomato chlorosis virus (ToCV) (1). The RT-PCR product was subsequently tested by nested-PCR for single detection of TICV and ToCV using primer pairs TIC-3/TIC-4 and ToC-5/ToC-6, respectively (1). Only one fragment of approximately 463 bp was amplified from 7 of the 10 plants with the primer pair specific for ToCV. No amplification was obtained with the primers specific for TICV. Two amplicons of 463 bp were purified and directly sequenced in both directions. Sequence comparisons of the 463-bp consensus sequence (GenBank Accession No. EU868927) revealed 99% identity with the reported sequence of ToCV from the United States (GenBank Accession No. AY903448) (3). Virus-free adults of Bemisia tabaci biotype B confined on symptomatic tomato leaves for a 24-h acquisition access period were able to transmit the virus to healthy tomato plants, which reproduced the original symptoms on the bottom leaves 65 days after inoculation under greenhouse conditions. Infection from transmission was confirmed by RT-PCR using the HS-11/HS-12 primer pair. In addition to B. tabaci biotype B, the greenhouse whitefly, Trialeurodes vaporariorum, has also been reported as a vector of ToCV, although it is less efficient than the B. tabaci biotype B in transmission of this virus (4). T. vaporariorum, which was previously considered limited to greenhouses, was recently reported in tomato and green bean (Phaseolus vulgaris L.) crops under field conditions in São Paulo State (2). Therefore, it might also contribute to the spread of ToCV in tomato crops in São Paulo. To our knowledge, this is the first report of ToCV in Brazil and South America. References: (1) C. I. Dovas et al. Plant Dis.86:1345, 2002. (2) A. L. Lourenção et al. Neotrop. Entomol. 37:89, 2008. (3) W. M. Wintermantel et al. Arch. Virol. 15:2287, 2005. (4) W. M. Wintermantel and G. C. Wisler. Plant Dis. 90:814, 2006.

Download Full-text

DETEKSI MOLEKULER PENYEBAB PENYAKIT KUNING (Tomato chlorosis virus DAN Tomato infectious chlorosis virus) PADA TANAMAN TOMAT (MOLECULAR DETECTION CAUSED YELLOWING DISEASE (Tomato chlorosis virus AND Tomato infectious chlorosis virus) ON TOMATOES)

Jurnal Perlindungan Tanaman Indonesia ◽

10.22146/jpti.17250 ◽

2017 ◽

Vol 19 (2) ◽

pp. 80

Author(s):

Resti Fajarfika ◽

Sedyo Hartono ◽

Sri Sulandari ◽

Susamto Somowiyarjo

Keyword(s):

Molecular Detection ◽

Nucleotide Sequence Analysis ◽

Rt Pcr ◽

Chain Reactions ◽

Polymerase Chain Reactions ◽

Pcr Product ◽

Yellowing Disease ◽

Polymerase Chain ◽

Tomato Chlorosis Virus ◽

Tomato Infectious Chlorosis Virus

ABSTRACTThis research was aimed to detect the ToCV and TICV caused yellowing disease on tomatoes by molecular detection. Leaf samples of symptomatic plants were taken from Ketep (Magelang), then the leaves were identified by reversetranscription-polymerase chain reactions (RT-PCR) using specific primer ToCV-CF/ToCV-CR (360 bp) and TICVCF/TICV-CR (416 bp). The result of nucleotide sequence analysis, amino acid and PCR product phylogenetic sequences were verified as TICV, it showed that TICV from Magelang belongs to the same group with TICV from Japan, North America and Europe, France, Italy, and USA.Keywords: molecular detection, ToCV, TICVINTISARIPenelitian ini bertujuan untuk mendeteksi keberadaan ToCV dan TICV penyebab penyakit kuning pada tanaman tomat. Daun bergejala diambil dari Desa Ketep (Magelang), selanjutnya diuji denganreverse transcription-polymerasechain reactions(RT-PCR) menggunakan primer spesifik ToCV-CF/ToCV-CR (360 bp) dan TICV-CF/TICV-CR (416 bp). Hasil analisis sekuen nukleotida, asam amino, dan filogenetik produk PCR teridentifikasi sebagai TICV yang menunjukkan bahwa TICV isolat Magelang berada dalam satu kelompok dengan isolat TICV asal Jepang, Amerika Utara dan Eropa,Perancis, Italia, dan USA.Kata kunci: deteksi molekuler, ToCV, TICV

Download Full-text

First Report of Strawberry latent ringspot virus in Strawberry in the United States and Canada

Plant Disease ◽

10.1094/pdis.2004.88.5.575a ◽

2004 ◽

Vol 88 (5) ◽

pp. 575-575 ◽

Cited By ~ 12

Author(s):

R. R. Martin ◽

I. E. Tzanetakis ◽

J. E. Barnes ◽

J. F. Elmhirst

Keyword(s):

British Columbia ◽

Chenopodium Quinoa ◽

The United States ◽

Ringspot Virus ◽

Broad Host Range ◽

Rt Pcr ◽

Cherry Tree ◽

First Report ◽

The Family ◽

Polymerase Chain

Strawberries in southern California have shown decline symptoms during the last 2 years. More than 70% of plants tested in California were infected with two newly identified criniviruses that infect strawberry (Strawberry pallidosis and Beet pseudo-yellows). Strawberry cultivars are usually symptomless when infected with one virus, and testing for other strawberry viruses is performed to identify any other viruses that may be involved in the symptomatology. Primers SLRSV F (5′ CCTCTCCAACC-TGCTAGACT 3′) and SLRSV R (5′ AAGCGCATGAAGGTGTAACT 3′) that amplify a 497-bp fragment of RNA 2 of Strawberry latent ringspot virus (SLRSV) were developed and utilized for reverse transcription-polymerase chain reaction (RT-PCR) detection. SLRSV belongs to the family Sequiviridae and is transmitted by nematodes of the genus Xiphinema. The virus has a broad host range (4) and is usually symptomless in strawberries. Strawberry plants from commercial fields in California, Oregon, Washington, and British Columbia, Canada were tested. SLRSV was identified in 17% of plants tested from California and 4% of plants tested from British Columbia, while all samples from Oregon and Washington tested negative. The fragment amplified (GenBank Accession No. AY461735, isolate from British Columbia, Canada) shares 84% nucleotide and 94% amino acid sequence identity with the previously published sequence of SLRSV from strawberry (GenBank Accession No. X77466) (3). The virus was transmitted mechanically from strawberry samples from Canada to Chenopodium quinoa, and the infected C. quinoa plants tested positive for SLRSV with RT-PCR, while no amplicons were obtained from noninoculated control plants. To our knowledge, this is the first report of SLRSV in strawberry in North America, although it has been previously reported in a single cherry tree in Ontario, Canada (1) and in an imported seed lot of parsley in California (2). The number of plants that tested positive as well as the geographic distribution of the virus indicates that the virus is widespread in California, but further testing is needed to identify its distribution in other states. References: (1) W. R. Allen et al. Phytopathology 60:1262, 1970. (2) C. M. Hanson and R. N. Campbell. Plant Dis. Rep. 63:142, 1979. (3) S. Kreiah et al. J. Gen. Virol. 75:2527, 1994. (4) K. Schmelzer. Phytopath. Z. 66:1, 1969.

Download Full-text

First Report of Natural Infection of Penstemon acuminatus with Cucumber mosaic virus in the Treasure Valley Region of Idaho and Oregon

Plant Disease ◽

10.1094/pdis-93-7-0762a ◽

2009 ◽

Vol 93 (7) ◽

pp. 762-762 ◽

Cited By ~ 1

Author(s):

R. K. Sampangi ◽

C. Almeyda ◽

K. L. Druffel ◽

S. Krishna Mohan ◽

C. C. Shock ◽

...

Keyword(s):

Cucumber Mosaic Virus ◽

Mosaic Virus ◽

Great Basin ◽

Natural Infection ◽

The United States ◽

Native Plant ◽

Rt Pcr ◽

Cmv Infection ◽

Spot Virus ◽

First Report

Penstemons are perennials that are grown for their attractive flowers in the United States. Penstemon species (P. acuminatus, P. deustus, and P. speciosus) are among the native forbs considered as a high priority for restoration of great basin rangelands. During the summer of 2008, symptoms of red spots and rings were observed on leaves of P. acuminatus (family Scrophulariaceae) in an experimental trial in Malheur County, Oregon where the seeds from several native forbs were multiplied for restoration of range plants in intermountain areas. These plants were cultivated as part of the Great Basin Native Plant Selection and Increase Project. Several native wildflower species are grown for seed production in these experimental plots. Plants showed red foliar ringspots and streaks late in the season. Fungal or bacterial infection was ruled out. Two tospoviruses, Impatiens necrotic spot virus and Tomato spotted wilt virus, and one nepovirus, Tomato ring spot virus, are known to infect penstemon (2,3). Recently, a strain of Turnip vein-clearing virus, referred to as Penstemon ringspot virus, was reported in penstemon from Minnesota (1). Symptomatic leaves from the penstemon plants were negative for these viruses when tested by ELISA or reverse transcription (RT)-PCR. However, samples were found to be positive for Cucumber mosaic virus (CMV) when tested by a commercially available kit (Agdia Inc., Elkhart, IN). To verify CMV infection, total nucleic acid extracts from the symptomatic areas of the leaves were prepared and used in RT-PCR. Primers specific to the RNA-3 of CMV were designed on the basis of CMV sequences available in GenBank. The primer pair consisted of CMV V166: 5′ CCA ACC TTT GTA GGG AGT GA 3′ and CMV C563: 5′ TAC ACG AGG ACG GCG TAC TT 3′. An amplicon of the expected size (400 bp) was obtained and cloned and sequenced. BLAST search of the GenBank for related sequences showed that the sequence obtained from penstemon was highly identical to several CMV sequences, with the highest identity (98%) with that of a sequence from Taiwan (GenBank No. D49496). CMV from infected penstemon was successfully transmitted by mechanical inoculation to cucumber seedlings. Infection of cucumber plants was confirmed by ELISA and RT-PCR. To our knowledge, this is the first report of CMV infection of P. acuminatus. With the ongoing efforts to revegetate the intermountain west with native forbs, there is a need for a comprehensive survey of pests and diseases affecting these plants. References: (1) B. E. Lockhart et al. Plant Dis. 92:725, 2008. (2) D. Louro. Acta Hortic. 431:99, 1996. (3) M. Navalinskiene et al. Trans. Estonian Agric. Univ. 209:140, 2000.

Download Full-text

First Report of Leaf Blight and Stem Canker of Pachysandra terminalis Caused by Pseudonectria pachysandricola in Korea

Plant Disease ◽

10.1094/pdis-09-11-0813 ◽

2012 ◽

Vol 96 (2) ◽

pp. 287-287

Author(s):

K. S. Han ◽

J. H. Park ◽

S. E. Cho ◽

H. D. Shin

Keyword(s):

United States ◽

Its Region ◽

Stem Canker ◽

The United States ◽

Culture Collection ◽

Leaf Blight ◽

First Report ◽

Cornell University ◽

Plastic Bags ◽

Young Leaves

Pachysandra terminalis Siebold & Zucc., known as Japanese pachysandra, is a creeping evergreen perennial belonging to the family Buxaceae. In April 2011, hundreds of plants showing symptoms of leaf blight and stem canker with nearly 100% incidence were found in a private garden in Suwon, Korea. Plants with the same symptoms were found in Seoul in May and Hongcheon in August. Affected leaves contained tan-to-yellow brown blotches. Stem and stolon cankers first appeared as water soaked and developed into necrotic lesions. Sporodochia were solitary, erumpent, circular, 50 to 150 μm in diameter, salmon-colored, pink-orange when wet, and with or without setae. Setae were hyaline, acicular, 60 to 100 μm long, and had a base that was 4 to 6 μm wide. Conidiophores were in a dense fascicle, not branched, hyaline, aseptate or uniseptate, and 8 to 20 × 2 to 3.5 μm. Conidia were long, ellipsoid to cylindric, fusiform, rounded at the apex, subtruncate at the base, straight to slightly bent, guttulate, hyaline, aseptate, 11 to 26 × 2.5 to 4.0 μm. A single-conidial isolate formed cream-colored colonies that turned into salmon-colored colonies on potato dextrose agar (PDA). Morphological and cultural characteristics of the fungus were consistent with previous reports of Pseudonectria pachysandricola B.O. Dodge (1,3,4). Voucher specimens were housed at Korea University (KUS). Two isolates, KACC46110 (ex KUS-F25663) and KACC46111 (ex KUS-F25683), were accessioned in the Korean Agricultural Culture Collection. Fungal DNA was extracted with DNeasy Plant Mini DNA Extraction Kits (Qiagen Inc., Valencia, CA). The complete internal transcribed spacer (ITS) region of rDNA was amplified with the primers ITS1/ITS4 and sequenced using ABI Prism 337 automatic DNA sequencer (Applied Biosystems, Foster, CA). The resulting sequence of 487 bp was deposited in GenBank (Accession No. JN797821). This showed 100% similarity with a sequence of P. pachysandricola from the United States (HQ897807). Isolate KACC46110 was used in pathogenicity tests. Inoculum was prepared by harvesting conidia from 2-week-old cultures on PDA. Ten young leaves wounded with needles were sprayed with conidial suspensions (~1 × 106 conidia/ml). Ten young leaves that served as the control were treated with sterile distilled water. Plants were covered with plastic bags to maintain a relative humidity of 100% at 25 ± 2°C for 24 h. Typical symptoms of brown spots appeared on the inoculated leaves 4 days after inoculation and were identical to the ones observed in the field. P. pachysandricola was reisolated from 10 symptomatic leaf tissues, confirming Koch's postulates. No symptoms were observed on control plants. Previously, the disease was reported in the United States, Britain, Japan, and the Czech Republic (2,3), but not in Korea. To our knowledge, this is the first report of P. pachysandricola on Pachysandra terminalis in Korea. Since this plant is popular and widely planted in Korea, this disease could cause significant damage to nurseries and the landscape. References: (1) B. O. Dodge. Mycologia 36:532, 1944. (2) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , September 24, 2011. (3) I. Safrankova. Plant Prot. Sci. 43:10, 2007. (4) W. A. Sinclair and H. H. Lyon. Disease of Trees and Shrubs. 2nd ed. Cornell University Press, Ithaca, NY, 2005.

Download Full-text

First Report of Grapevine leafroll associated virus-3 in American Vitis spp. Grapevines in Washington State

Plant Disease ◽

10.1094/pd-90-1461a ◽

2006 ◽

Vol 90 (11) ◽

pp. 1461-1461 ◽

Cited By ~ 8

Author(s):

M. J. Soule ◽

K. C. Eastwell ◽

R. A. Naidu

Keyword(s):

New York ◽

Economic Impact ◽

Virus Disease ◽

The United States ◽

Washington State ◽

The State ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

First Report ◽

Table Grapes

Washington State is the largest producer of juice grapes (Vitis labruscana ‘Concord’ and Vitis labrusca ‘Niagara’) and ranks second in wine grape production in the United States. Grapevine leafroll disease (GLD) is the most wide spread and economically significant virus disease in wine grapes in the state. Previous studies (2) have shown that Grapevine leafroll associated virus-3 (GLRaV-3) is the predominant virus associated with GLD. However, little is known about the incidence and economic impact of GLD on juice and table grapes. Because typical GLD symptoms may not be obvious among these cultivars, the prevalence and economic impact of GLD in Concord and Niagara, the most widely planted cultivars in Washington State, has received little attention from the grape and nursery industries. During the 2005 growing season, 32 samples from three vineyards and one nursery of ‘Concord’ and three samples from one nursery of ‘Niagara’ were collected randomly. Petiole extracts were tested by single-tube reverse transcription-polymerase chain reaction (RT-PCR; 3) with primers LC 1 (5′-CGC TAG GGC TGT GGA AGT ATT-3′) and LC 2 (5′-GTT GTC CCG GGT ACC AGA TAT-3′), specific for the heat shock protein 70 homologue (Hsp70h gene) of GLRaV-3 (GenBank Accession No. AF037268). One ‘Niagara’ nursery sample and eleven ‘Concord’ samples from the three vineyards tested positive for GLRaV-3, producing a single band of the expected size of 546 bp. The ‘Niagara’ and six of the ‘Concord’ RT-PCR products were cloned in pCR2.1 (Invitrogen Corp, Carlsbad, CA) and the sequences (GenBank Accession Nos. DQ780885, DQ780886, DQ780887, DQ780888, DQ780889, DQ780890, and DQ780891) compared with the respective sequence of a New York isolate of GLRaV-3 (GenBank Accession No. AF037268). The analysis revealed that GLRaV-3 isolates from ‘Concord’ and ‘Niagara’ share nucleotide identities of 94 to 98% and amino acid identities and similarities of 97 to 98% with the Hsp70h gene homologue of the New York isolate of GLRaV-3. Additional testing by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) using antibodies specific to GLRaV-3 (BIOREBA AG, Reinach, Switzerland) further confirmed these results in the ‘Niagara’ and two of the ‘Concord’ isolates. GLRaV-3 has previously been reported in labrusca cvs. Concord and Niagara in western New York (4) and Canada (1), but to our knowledge, this is the first report of GLRaV-3 in American grapevine species in the Pacific Northwest. Because wine and juice grapes are widely grown in proximity to each other in Washington State and grape mealybug (Pseudococcus maritimus), the putative vector of GLRaV-3, is present in the state vineyards, further studies will focus on the role of American grapevine species in the epidemiology of GLD. References: (1) D. J. MacKenzie et al. Plant Dis. 80:955, 1996. (2) R. R. Martin et al. Plant Dis. 89:763, 2005. (3) A. Rowhani et al. ICGV, Extended Abstracts, 13:148, 2000. (4) W. F. Wilcox et al. Plant Dis. 82:1062, 1998.

Download Full-text