scholarly journals First Report of Pink Seed of Pea Caused by Erwinia rhapontici in North Dakota

Plant Disease ◽  
2008 ◽  
Vol 92 (2) ◽  
pp. 315-315 ◽  
Author(s):  
K. A. Wise ◽  
Y. F. Zhao ◽  
C. A. Bradley
Keyword(s):  
Fatty Acid ◽  
North Dakota ◽  
The United States ◽  
Fatty Acid Analysis ◽  
Distilled Water ◽  
Normal Appearance ◽  
Bacterial Colony ◽  
First Report ◽  
Erwinia Rhapontici ◽  
The University

In 2006, a seed lot of dry pea cv. DS Admiral obtained from Bowman County, North Dakota contained seed with bright-to-pale pink discoloration on the seed coat. Five discolored seeds and five seeds with normal appearance were surface disinfected in a 0.5% NaOCl solution for 1 min and rinsed with sterilized distilled water for 1 min. Seeds were placed onto potato dextrose agar (PDA) and incubated at 22°C. Three days later, the discolored seeds produced pink bacterial colonies and a pink pigment that diffused throughout the PDA. The pink bacterial colonies were tentatively identified as Erwinia rhapontici on the basis of colony and pigment color (2,3). No fungi or bacteria grew from the seed with normal appearance. A pink bacterial colony growing from one of the discolored seeds was streaked onto PDA and a single colony was obtained. A streaked plate incubated at 37°C showed no growth, which distinguishes E. rhapontici from Brenneria rubrifaciens (formerly E. rubrifaciens) (1–3). To confirm the identity, the isolate was sent to the Bacterial Identification and Fatty Acid Analysis Laboratory at the University of Florida, Gainesville. Fatty acid analysis indicated a similarity index of 0.515 for E. rhapontici. For an additional confirmation of identity, the 16S ribosomal DNA (rDNA) gene was amplified from the E. rhapontici isolate with universal primers fD1 and rP1 (4). The PCR product was cloned into pGEM-T easy vector (Promega, Madison, WI) and sequenced with primers SP6 and T7 at the Keck Biotechnology Center at the University of Illinois, Urbana. The resulting nucleotide sequence was compared with 16S rDNA sequences deposited in the ribosomal database ( http://rdp.cme.msu.edu/seqmatch/seqmatch_intro.jsp ) and showed highest identity to sequences of E. rhapontici or E. persicinus strains. To confirm pathogenicity, the basal ends of five pods on each of six pea plants (cv. Carneval) were syringe injected with 0.1 ml of suspension containing the obtained E. rhapontici isolate in the greenhouse by the methods as previously described (2). As a control, five pods on each of two plants were injected with 0.1 ml of sterile distilled water. Twenty-eight of the 51 seeds obtained from the bacteria-inoculated pods had pink seed symptoms, while seeds from the control pods appeared normal. Isolations from symptomatic and asymptomatic seed were performed as described above, and E. rhapontici was obtained from symptomatic seed. To our knowledge, this is the first report of pink seed of pea caused by E. rhapontici in North Dakota. The first report of this disease on pea in the United States was from Montana (3). References: (1) L. Hauben et al. Syst. Appl. Microbiol. 21:384, 1998. (2) H. C. Huang et al. Can. J. Plant Pathol. 12:445, 1990. (3) B. K. Schroeder et al. Plant Dis. 86:188, 2002. (4) W. G. Weisburg et al. J. Bacteriol. 173:697, 1991.

scholarly journals First Report of Seedborne Fusarium thapsinum and its Pathogenicity on Soybean (Glycine max) in the United States

Plant Disease ◽  
2014 ◽  
Vol 98 (12) ◽  
pp. 1745-1745 ◽  
Author(s):  
R. Pedrozo ◽  
C. R. Little
Keyword(s):  
United States ◽  
The United States ◽  
Soybean Plant ◽  
Sodium Hypochlorite Solution ◽  
Distilled Water ◽  
Seedling Mortality ◽  
Beta Tubulin ◽  
First Report ◽  
Significant Difference ◽  
Germinated Seeds

A three-year survey from 2010 to 2012 was conducted in Kansas to investigate the identity and diversity of seedborne Fusarium spp. in soybean. A total of 408 soybean seed samples from 10 counties were tested. One hundred arbitrarily selected seeds from each sample were surface-sterilized for 10 min in a 1% sodium hypochlorite solution to avoid contaminants and promote the isolation of internal fusaria. Seeds were rinsed with sterile distilled water and dried overnight at room temperature (RT). Surface-sterilized seeds were plated on modified Nash-Snyder medium and incubated at 23 ± 2°C for 7 days. Fusarium isolates were single-spored and identified by morphological characteristics on carnation leaf agar (CLA) and potato dextrose agar (PDA) (3). From 276 seedborne Fusarium isolates, six were identified as F. thapsinum (2). On CLA, F. thapsinum isolates produced abundant mycelium and numerous chains of non-septate microconidia produced from monophialides. Microconidia were club-shaped and some were napiform. No chlamysdospores were found. On PDA, three of the isolates presented characteristic dark yellow pigmentation and three were light violet. Confirmation of the isolates to species was based on sequencing of an elongation factor gene (EF1-α) segment using primers EF1 and EF2 and the beta-tubulin gene using primers Beta1 and Beta2 (1). Sequence results (~680 bp, EF primers; ~600 bp, beta-tubulin primers) were confirmed by using the FUSARIUM-ID database (1). All isolates matched F. thapsinum for both genes sequenced (Accession No. FD01177) at 99% identity. Koch's postulates were completed for two isolates of F. thapsinum under greenhouse conditions. Soybean seeds (Asgrow AG3039) were imbibed with 2.5 × 105 conidia ml−1 for 48 h. After inoculation, seeds were dried for 48 h at RT. One isolate each of F. equiseti and F. oxysporum were used as the non-pathogenic and pathogenic inoculation controls, respectively. In addition, non-inoculated seeds and seeds imbibed in sterile distilled water (mock) were also used. Twenty-five seeds from each treatment were planted in pots (500 ml) with autoclaved soil and vermiculite (1:1). The experiment was a completely randomized design with three replicates (pots) per isolate. The entire experiment was repeated three times. After 21 days, aggressiveness of both F. thapsinum isolates was assessed using initial stand (%), final stand (%), and seed mortality (% of non-germinated seeds). Both seedborne F. thapsinum isolates caused reduced emergence and final stand, and increased seedling mortality when compared to the non-inoculated and F. equiseti controls (P< 0.0001). No significant difference was observed between F. thapsinum isolates and F. oxysporum. F. thapsinum isolates were re-isolated from wilted seedlings and non-germinated seeds, but not from the control treatments. Typically, F. thapsinum is considered a pathogen of sorghum, but it has also been recovered from bananas, peanuts, maize, and native grasses (3). However, its presence on soybean plant tissues and its pathogenicity has never been reported. To our knowledge, this is the first report of seedborne F. thapsinum and its pathogenicity on soybean in the United States. References: (1) D. M. Geiser et al. Eur. J. Plant Pathol. 110:473, 2004. (2) C. J. R. Klittich et al. Mycologia 89:644, 1997. (3) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Oxford, UK, 2006.

scholarly journals First Report of Powdery Mildew Caused by Erysiphe aquilegiae var. aquilegiae on Aquilegia flabellata in Italy

Plant Disease ◽  
2004 ◽  
Vol 88 (6) ◽  
pp. 681-681
Author(s):  
A. Garibaldi ◽  
D. Bertetti ◽  
M. L. Gullino
Keyword(s):  
United States ◽  
Powdery Mildew ◽  
The United States ◽  
Northern Italy ◽  
American Phytopathological Society ◽  
First Report ◽  
Powdery Mildews ◽  
The Family ◽  
White Mycelium ◽  
The University

Aquilegia flabellata Sieb. and Zucc. (columbine) is a perennial garden species belonging to the family Ranunculaceae. During the summer of 2003, a severe outbreak of a previously unknown powdery mildew was observed in several gardens near Biella (northern Italy). Upper surfaces of leaves were covered with a white mycelium and conidia, and as the disease progressed infected leaves turned yellow and died. Foot cell was cylindric and appressorium lobed. Conidia were hyaline, ellipsoid, and measured 31.2 to 47.5 × 14.4 to 33 μm (average 38.6 × 21.6 μm). Fibrosin bodies were not present. Cleistothecia were globose, brown, had simple appendages, ranged from 82 to 127 (average 105) μm in diameter, and contained one to two asci. Ascocarp appendages measured five to eight times the ascocarp diameter. Asci were cylindrical (ovoidal) and measured 45.3 to 58.2 × 30.4 to 40.2 μm. Ascospores (three to four per ascus) were ellipsoid or cylindrical and measured 28.3 to 31.0 × 14.0 to 15.0 μ;m. On the basis of its morphology, the pathogen was identified as Erysiphe aquilegiae var. aquilegiae (1). Pathogenicity was confirmed by gently pressing diseased leaves onto leaves of five, healthy A. flabellata plants. Five noninoculated plants served as controls. Inoculated and noninoculated plants were maintained in a garden where temperatures ranged between 20 and 30°C. After 10 days, typical powdery mildew symptoms developed on inoculated plants. Noninoculated plants did not show symptoms. To our knowledge, this is the first report of the presence of powdery mildew on Aquilegia flabellata in Italy. E. communis (Wallr.) Link and E. polygoni DC. were reported on several species of Aquilegia in the United States (2), while E. aquilegiae var. aquilegiae was previously observed on A. flabellata in Japan and the former Union of Soviet Socialist Republics (3). Specimens of this disease are available at the DIVAPRA Collection at the University of Torino. References: (1) U. Braun. Nova Hedwigia, 89:700, 1987. (2) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St Paul, MN, 1989. (3) K. Hirata. Host Range and Geographical Distribution of the Powdery Mildews. Faculty of Agriculture, Niigata University, 1966.

scholarly journals Investigating Intraspecific Variation of Acidovorax avenae subsp. citrulli Using DNA Fingerprinting and Whole Cell Fatty Acid Analysis

2000 ◽  
Vol 90 (2) ◽  
pp. 191-196 ◽  
Author(s):  
R. R. Walcott ◽  
D. B. Langston ◽  
F. H. Sanders ◽  
R. D. Gitaitis
Keyword(s):  
United States ◽  
Fatty Acid ◽  
Fatty Acid Methyl Esters ◽  
Methyl Esters ◽  
The United States ◽  
Cellular Fatty Acid ◽  
Fatty Acid Analysis ◽  
Pulse Field ◽  
Pulse Field Gel Electrophoresis ◽  
Group I

To assess the diversity of Acidovorax avenae subsp. citrulli, 121 strains from watermelon, cantaloupe, and pumpkin were compared using pulse field gel electrophoresis of SpeI-digested DNA and gas chromatographic analysis of fatty acid methyl esters. Twenty-nine unique DNA fragments resulted from DNA digestion, and 14 distinct haplotypes were observed. Based on cluster analysis, two subgroups, I and II, were recognized, which accounted for 84.8% (eight haplotypes) and 15.2% (six haplotypes) of the strains, respectively. Results of cellular fatty acid analysis varied quantitatively and qualitatively for the A. avenae subsp. citrulli strains and supported the existence of the two subgroups. Group I includes strains from cantaloupe and pumpkin as well as the ATCC type strain, which was first described in the United States in 1978, whereas group II represents the typical watermelon fruit blotch-causing strains that appeared in the mainland United States in 1989. Knowledge of the two A. avenae subsp. citrulli groups may be useful in screening for watermelon fruit blotch resistance.

scholarly journals Bringing Microphysics to the Masses: The Blowing Snow Observations at the University of North Dakota: Education through Research (BLOWN-UNDER) Campaign

2021 ◽  
pp. 1-41
Author(s):  
Aaron Kennedy ◽  
Aaron Scott ◽  
Nicole Loeb ◽  
Alec Sczepanski ◽  
Kaela Lucke ◽  
...  
Keyword(s):  
Remote Sensing ◽  
North Dakota ◽  
Indigenous Communities ◽  
The United States ◽  
Outreach Program ◽  
Blowing Snow ◽  
Cold Temperatures ◽  
University Of North Dakota ◽  
K 12 ◽  
The University

AbstractHarsh winters and hazards such as blizzards are synonymous with the northern Great Plains of the United States. Studying these events is difficult; the juxtaposition of cold temperatures and high winds makes microphysical observations of both blowing and falling snow challenging. Historically, these observations have been provided by costly hydrometeor imagers that have been deployed for field campaigns or at select observation sites. This has slowed the development and validation of microphysics parameterizations and remote-sensing retrievals of various properties. If cheaper, more mobile instrumentation can be developed, this progress can be accelerated. Further, lowering price barriers can make deployment of instrumentation feasible for education and outreach purposes.The Blowing Snow Observations at the University of North Dakota: Education through Research (BLOWN-UNDER) Campaign took place during the winter of 2019-2020 to investigate strategies for obtaining microphysical measurements in the harsh North Dakota winter. Student led, the project blended education, outreach, and scientific objectives. While a variety of in-situ and remote-sensing instruments were deployed for the campaign, the most novel aspect of the project was the development and deployment of OSCRE, the Open Snowflake Camera for Research and Education. Images from this instrument were combined with winter weather educational modules to describe properties of snow to the public, K-12 students, and members of indigenous communities through a tribal outreach program. Along with an educational deployment of a Doppler on Wheels mobile radar, nearly 1000 individuals were reached during the project.

scholarly journals Engineers in the Distance

2014 ◽  
Vol 136 (04) ◽  
pp. 38-43
Author(s):  
Tom Gibson
Keyword(s):  
North Dakota ◽  
The United States ◽  
Petroleum Engineering ◽  
Engineering Programs ◽  
University Of North Dakota ◽  
Bachelor Of Science ◽  
Face To Face ◽  
Learning Programs ◽  
The Face ◽  
The University

This article presents views of Todd Torrence on introduction of online learning programs that can open paths from technical to technological. The University of North Dakota, which offers the only accredited online BSME program in the United States, is in a state where hydraulic fracturing has sharply increased oil production. The university has applied for accreditation of an online program offering a Bachelor of Science in Petroleum Engineering. The UND online BSME program covers the same material as its on-campus counterpart. North Carolina State has a 2+2 program where a student can go to a partnering university at the east and west ends of the state for the first two years of their undergraduate work. The University of North Dakota online BSME program covers the same material as its on-campus counterpart. Part of the accreditation process is assuring that the online degree is equivalent to the face-to-face degree. The challenge with undergrad online engineering programs is their sheer size and the time it takes to complete them, as compared with graduate programs.

scholarly journals First Report of Clubroot on Canola Caused by Plasmodiophora brassicae in North Dakota

Plant Disease ◽  
2014 ◽  
Vol 98 (10) ◽  
pp. 1438-1438 ◽  
Author(s):  
K. Chittem ◽  
S. M. Mansouripour ◽  
L. E. del Río Mendoza
Keyword(s):  
United States ◽  
North Dakota ◽  
Plasmodiophora Brassicae ◽  
The United States ◽  
Soil Samples ◽  
Pcr Analysis ◽  
Infested Soil ◽  
First Report ◽  
Resting Spores ◽  
Pathogenicity Tests

North Dakota leads the United States in canola (Brassica napus L.) production (4). A canola field with a distinct patch of dead plants spreading over an area of approximately 0.4 ha was detected in Cavalier County, North Dakota, in early September 2013. Numerous spots within the patch had plant mortalities >80%. Dead plants pulled from the soil had roots with severe galling and clubbing. Clubbed roots were brittle and disintegrated easily when pressed between fingers. Root and soil samples collected at several locations within and outside the affected patch were pooled in separate groups. All plants collected in the patch were symptomatic but those collected outside were not. In the lab, total genomic DNA from three symptomatic and two healthy root samples was extracted using standard procedures and freehand slices were prepared for observation with a compound microscope. Also, DNA from pooled soil samples was extracted using FastDNA Spin Kit for Soil (MP Biomedicals, Solon, OH). Round resting structures ranging from 2.2 to 4.2 μm in diameter were observed by microscopic examination of symptomatic root tissues. These structures resembled those typically produced by Plasmodiophora brassicae Woronin. This initial identification was later confirmed through PCR analysis using the species specific primers TC1F/R and TC2F/R (1). PCR products of 548 bp (TC1F/R) and 519 bp (TC2F/R) were produced in the three symptomatic and two infested soil samples, confirming the presence of P. brassicae. PCR amplicons were not detected in healthy root and soil samples. Pathogenicity tests were conducted in greenhouse to fulfill Koch's postulates. Briefly, five square plastic pots (10 × 10 × 13 cm) were filled with a 10-cm layer of Sunshine Mix #1 potting mix (Fison Horticulture, Vancouver, BC, Canada) and then 1 g of ground root galls (approximately 5 × 105 resting spores) was spread evenly on its surface and covered with 2 cm of soilless mix. A similar number of pots were filled only with soilless mix and used as controls. All pots were planted with two seeds of canola cv. Westar and incubated in greenhouse conditions at 21°C and 16 h light daily. The experiment was conducted twice. Four weeks after planting, all plants in the inoculated pots had developed galls while plants in control pots were symptomless. Presence of P. brassicae resting spores in the newly developed galls was confirmed by microscopic observations and PCR. Based on the symptoms, morphology of resting spores, PCR reactions, and pathogenicity tests, we confirm the presence of P. brassicae on canola. While P. brassicae has been reported as widespread in North America (2), to our knowledge, this is the first report of clubroot on canola in North Dakota and the United States. Clubroot became the most important disease affecting canola production in central Alberta, Canada, within 5 years of its discovery in 2003 (3); since then, the disease has been detected in Saskatchewan and Manitoba (3), Canadian provinces that share borders with North Dakota. Considering the difficulties in management of clubroot, measures should be initiated to limit the spread of the disease before it could pose a threat to United States canola production. References: (1) T. Cao et al. Plant Dis. 91:80, 2007. (2) G. Dixon J. Plant Growth Regul. 28:194, 2009. (3) S. Strelkov and S. Hwang. Can. J. Plant Pathol. 36(S1):27, 2014. (4) USDA-NASS, Ag. Statistics No. 81, 2012.

scholarly journals First Report of Impatiens Downy Mildew Caused by Plasmopara obducens in Kentucky

Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 428-428 ◽  
Author(s):  
N. A. Ward ◽  
E. Dixon ◽  
B. Amsden
Keyword(s):  
Downy Mildew ◽  
Ribosomal Subunit ◽  
Fungal Growth ◽  
The United States ◽  
Diseased Plant ◽  
Distilled Water ◽  
First Report ◽  
Plastic Bags ◽  
Impatiens Walleriana ◽  
Black Plastic

Impatiens downy mildew (Plasmopara obducens (J. Schröt.) J. Schröt. (syn Peronospora obducens) was first reported in the United States in 2004, but widespread outbreaks were observed throughout North America in 2011 (5). In June 2012, symptoms, including severe defoliation while plants retained upright stems, were observed on approximately 100 landscape impatiens (Impatiens walleriana Hook.f.) in Franklin County in central Kentucky. All plants in the landscape were affected. Plants were primarily defoliated and remaining leaves were stunted, mottled, and chlorotic with edges curled downward; no flowers were present. Under examination with a dissecting microscope, white downy fungal growth was observed. Closer examination confirmed that the growth consisted of colorless sporangiophores that were mainly unbranched, straight, and rigid (1,3). Sporangiophores consisted of apical branches attached at right angles to main axes, ranging from 67.2 to 89.9 μm long (1). Sporangia were ovoid and hyaline, measuring 11.2 to 13.3 μm × 8.2 to 10.7 μm (3). No oospores were observed. Pathogenicity tests were performed by inoculating 20 to 40 leaves on three plants each of the cvs. Dazzler and Super Elfin with suspensions of 1 × 105 sporangiophores per ml in sterile distilled water. Sporangia were obtained by washing infected leaves with sterile distilled water, and inoculations were completed by spraying leaves until runoff. Plants sprayed with sterile water served as controls. Plants were covered with black plastic bags for 48 h and then maintained under fluorescent lights for 10 days at room temperature (22 to 25°C). Sporangiophores were recovered from inoculated plants after 10 days, and morphology matched original inoculum; symptoms included chlorotic, downward curling leaves with sporulation on the undersides. Non-inoculated plants did not develop symptoms after 21 days. Molecular identification of the pathogen was conducted using three leaves from one plant from each cultivar. PCR was conducted by amplifying the large ribosomal subunit DNA using primers NL-1 and NL-4 (2). Amplicons of 762 to 691 bp were produced from diseased plant tissue that contained visible sporangiophores, and the bands were extracted from the gel and purified. Sequence results confirmed 100% similarity to accessions from Florida (GenBank Accession No. JX217746.1) and Ohio (JX142134.1) and 99% similarity to amplicons reported from Serbia (HQ246451.1) and UK (AY587558.1). This is believed to be the first report of downy mildew infecting impatiens in Kentucky. References: (1) O. Constantinescu. Mycologia 83:473, 1991. (2) W. Maier et al. Can. J. Bot 81:12, 2003. (3) P. A. Saccardo. Syllogue Fungorum 7:242, 1888. (4) S. N. Wegulo et al. Plant Dis. 88:909, 2004.

scholarly journals First Report of Anthracnose Caused by Elsinoe ampelina on Muscadine Grapes (Vitis rotundifolia) in Northern Florida

Plant Disease ◽  
2007 ◽  
Vol 91 (7) ◽  
pp. 905-905 ◽  
Author(s):  
H. K. Yun ◽  
C. Louime ◽  
J. Lu
Keyword(s):  
United States ◽  
Pcr Primers ◽  
The United States ◽  
Causal Agent ◽  
Distilled Water ◽  
Conidial Suspension ◽  
Single Spore ◽  
First Report ◽  
Elsinoe Ampelina ◽  
Muscadine Grapes

Anthracnose of grapes is an economically devastating disease caused by Elsinoe ampelina (2). Warm, humid weather favors disease development, and therefore in the United States, it is generally restricted to grape-growing areas east of the Rocky Mountains. Vitis vinifera is highly susceptible to the disease, which is one of the principal factors preventing the development of an industry with this high-quality grape in the southeastern United States. Growers in this area produce local species-such as muscadine grapes (V. rotundifolia Michx.) and hybrids. Muscadine grapes are known for their resistance or “immunity” to many diseases found in bunch (Euvitis spp. Planch.) grape species (1). As yet, there has been no formal report of anthracnose or its causal agent on muscadine grapes. E. ampelina was detected on muscadine leaves for the first time in the experimental vineyard at the Center for Viticulture and Small Fruit Research during the summer of 2006. Approximately 40% of the 52 muscadine cultivars in the collection showed circular or irregular black spots typical of anthracnose mainly on young leaves and tendrils. However, no symptoms were observed on fruits, shoot tips, or any other plant part. To confirm the causal agent, infected leaves were surface sterilized with 75% ethanol, dipped in 2% sodium hypochlorite for 15 s, rinsed in distilled water, dissected into small 0.5-cm leaf discs, and plated on potato dextrose agar (PDA) and incubated at 28°C. Single-spore isolates were grown on PDA. Colonies were slow growing and appeared as dark red mounds with some mycelia. Conidia were cylindrical and hyaline with pointed ends consistent with previous reports for E. ampelina (2). The identity was also confirmed by using the following PCR primers to the 18S RNA: left primer; TCCGTAGGTGAACCTGCGGA and right primer; TCCTACCTGAT CCGAGGTCA designed on the basis of the alignment of E. ampelina sequences deposited in NCBI database. To fulfill Koch's postulates, symptoms were reproduced by artificial inoculation onto young muscadines (cv. Carlos) and bunch (cv. Cabernet Sauvignon) grapevines. A conidial suspension was prepared from single-conidial cultures, and three experimental vines of each species were sprayed with 0.5 ml of suspension (2 × 105 conidia per ml), whereas three control plants were sprayed with distilled water. The plants were incubated in a moist chamber at 28°C with 16 h of light. The first typical symptoms appeared on V. vinifera 4 days postinoculation and on the muscadines 6 days postinoculation. To our knowledge, this is the first report confirming anthracnose disease on muscadine grapes. References: (1) J. Lu et al. Acta Hortic. 528:479, 2000. (2) R. C. Pearson and A. C. Gohen. Anthracnose. Pages 18–19 in: Compendium of Grape Diseases. The American Phytopathological Society. St. Paul, MN, 1994.

scholarly journals First Report of Anthracnose of Sunflower Sprouts Caused by Colletotrichum acutatum in New Mexico

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 838-838
Author(s):  
J. M. French ◽  
J. J. Randall ◽  
R. A. Stamler ◽  
A. C. Segura ◽  
N. P. Goldberg
Keyword(s):  
New Mexico ◽  
Sequence Analysis ◽  
The United States ◽  
Disease Diagnosis ◽  
Colletotrichum Acutatum ◽  
Economic Losses ◽  
Distilled Water ◽  
Koch’S Postulates ◽  
First Report ◽  
Koch's Postulates

In December 2011, edible sunflower sprouts (Helianthus annus) of two different commercially grown cultivars (Sungrown and Tiensvold) exhibiting stem and cotyledon lesions were submitted to the New Mexico State University Plant Clinic for disease diagnosis. The sample originated from an organic farm in Santa Fe County where the grower utilizes a small indoor growing facility. Stem lesions were elongate, reddish brown, and often constricted, resulting in stem girdling. Lesions on the cotyledons were dark brown with tan centers and round to irregular in shape. In some cases, the entire cotyledon was blighted. Fungal hyphae were observed on some lesions using a dissecting microscope. Colletotrichum acutatum was isolated from stem and cotyledon lesions when symptomatic tissue was plated on water agar. Conidia were fusiform ranging from 6.4 to 18.4 μm long and 2.1 to 5.1 μm wide and averaged 11.9 μm × 3.4 μm. Spores were measured from cream-colored colonies produced on acidified potato dextrose agar. PCR amplification and sequence analysis of 5.8S ribosomal DNA and internal transcribed spacers I and II was performed using primers ITS4 and ITS6 (2). An amplification product of approximately 600 base pairs in size was directly sequenced (GenBank Accession No. JX444690). A BLAST search of the NCBI total nucleotide collection revealed a 99% identity to multiple C. acutatum (syn: C. simmondsii) isolates. Four isolates were identified as C. acutatum based on morphological characteristics and DNA analysis. Koch's postulates were performed using four isolates of the pathogen and the two commercial sunflower cultivars (Sungrown and Tiensvold) originally submitted for disease analysis. Sunflower seeds were imbibed in distilled water for 24 h then sewn into peat plugs. Prior to seed germination, 5 ml of a C. acutatum spore solution (1 × 106/ml) from each isolate was applied to five peat plugs using an atomizer. Control plants were inoculated with distilled water and otherwise treated identically. Both sunflower cultivars were inoculated with each isolate of the pathogen and the test was replicated twice. The sewn peat plugs were incubated for 5 days at 21°C and 50% relative humidity. Symptoms similar to the original samples were present on 100% of the sprouts after 5 days. PCR and sequence analysis performed on cultures obtained from lesions showed a 100% match to the original New Mexico isolates fulfilling Koch's postulates. In an indoor organic facility, such as the one in NM, this disease has the potential to be very difficult to manage and the potential to infect a high percentage of the crop resulting in significant economic losses. To our knowledge, this is the second report of C. acutatum on sunflower sprouts in the United States (1) and the first report in New Mexico. References: (1) S. T. Koike et al. Plant Dis. 93:1351, 2009. (2) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, San Diego, 1990.

scholarly journals First Report of Potato mop top virus Causing Potato Tuber Necrosis in Colorado and New Mexico

Plant Disease ◽  
2015 ◽  
Vol 99 (1) ◽  
pp. 164-164 ◽  
Author(s):  
I. Mallik ◽  
N. C. Gudmestad
Keyword(s):  
New Mexico ◽  
North Dakota ◽  
Consensus Sequence ◽  
The United States ◽  
Economic Losses ◽  
Acid Extraction ◽  
Rt Pcr ◽  
First Report ◽  
Tuber Necrosis ◽  
Potato Mop Top Virus

Potato mop top virus (PMTV) is considered the type member of the genus Pomovirus. PMTV is an important pathogen of potato vectored by the plasmodiophorid Spongospora subterranea f. sp. subterranea (Sss), which causes powdery scab of potato (1). Sss and PMTV are usually associated with cool and humid environments. PMTV-infected potato tubers generally exhibit internal hollow necrotic spots or concentric rings, and the virus is known to cause significant economic losses in Northern Europe, North and South America, and Asia (4). PMTV in the United States was first reported in Maine (2). Potato (Solanum tuberosum L.) tubers cv. FL2048 and cv. Atlantic were sent to our laboratory from fields in Saguache County in Colorado and in San Juan County in New Mexico, respectively, during the spring of 2013. The tubers from both locations had multiple, internal, concentric, necrotic arcs and circles. Internal tissue with necrotic lesion from six symptomatic tubers from each location were crushed in liquid nitrogen followed by ribonucleic acid extraction using a Total RNA Isolation kit (Promega Corp., Madison, WI). These extracts were tested by reverse transcription (RT)-PCR using three different sets of previously published primers for molecular detection of PMTV. The primer set H360/C819 targeting the coat protein (CP) on RNA 3 of PMTV yielded an amplicon (H360-CO and H360-NM) of 460 bp (4). The second set of primers, pmtF4/pmtR4 (5), amplified a 417-bp product (PMTF-CO and PMTF-NM) in RNA 2, and the third set, PMTV-P9/PMTV-M9 (3), designed to amplify the region encoding an 8-KD cysteine-rich protein in RNA 3 of PMTV, yielded a 507-bp amplicon (PMTV9-CO and PMTV9-NM). The amplicons generated from RT-PCR using all three sets were cloned (PGEMT-easy) and sequenced. Since the sequences from symptomatic tuber extracts from each location were identical to their respective primer sets, a consensus sequence from each primer set was submitted to National Center for Biotechnology Information (NCBI) GenBank. Sequences obtained from the H360/C819 primer set (GenBank Accession Nos. KM207013 and KM207014 for H360-CO and H360-NM, respectively) were 100% identical to the corresponding CP regions of PMTV isolates from North Dakota (HM776172). Sequences from the pmtF4/pmtR4 primer set (KM207015 and KM207016 for PMTF-CO and PMTF-NM, respectively) were 100% identical to the corresponding protein in RNA2 of PMTV isolates from North Dakota (GenBank HM776171), and sequences from the PMTV-P9/PMTV-M9 primer set (KM207017 and KM207018 for PMTV9-CO and PMTV9-NM respectively) were 99% identical to the corresponding protein in RNA3 of PMTV isolates (AY187010). The 100-99% homology of the sequences from this study to the corresponding PMTV sequences published in NCBI confirmed the occurrence of symptoms in the tubers from both Colorado and New Mexico due to PMTV. None of the symptomatic tubers tested positive for Tobacco rattle virus, Tomato spotted wilt virus, Alfalfa mosaic virus, Potato leafroll virus, or the necrotic strains of Potato virus Y by RT-PCR. To our knowledge, this is the first report of PMTV in potato in states of Colorado and New Mexico. References: (1) R. A. C. Jones and B. D. Harrsion. Ann. Appl. Biol. 63:1, 1969. (2) D. H. Lambert et al. Plant Dis. 87:872, 2003. (3) T. Nakayama et al. Am. J. Pot. Res. 87:218, 2010. (4) J. Santala et al. Ann. Appl. Biol. Online publication. DOI: 10.1111/j.1744-7348.2010.00423.x (5) H. Xu et al. Plant Dis. 88:363, 2004.

Sign in / Sign up

Export Citation Format

Share Document