scholarly journals First Report of Downy Mildew Caused by Peronospora trigonellae on Fenugreek in the United States

Plant Disease ◽  
2009 ◽  
Vol 93 (12) ◽  
pp. 1349-1349 ◽  
Author(s):  
S. Rooney-Latham ◽  
C. L. Blomquist ◽  
J. Turney
Keyword(s):  
United States ◽  
Los Angeles ◽  
Sequence Data ◽  
Leaf Tissue ◽  
The United States ◽  
Grocery Store ◽  
Diagnostic Laboratory ◽  
First Report ◽  
Severe Stunting ◽  
The United Kingdom

Fenugreek (Trigonella foenum-graecum) is a member of the Fabaceae family and is grown worldwide for culinary and medicinal purposes. The leaves are used as an herb while the seeds are used whole, ground as a spice, or germinated and used as sprouts. In November 2008, a fenugreek plant exhibiting leaf spotting and severe stunting was submitted to the CDFA Plant Pest Diagnostics Laboratory from the Los Angeles County Plant Diagnostic Laboratory. The county had received the sample from a homeowner who reported severe dieback of the fenugreek in his backyard planting. The fenugreek is grown by the resident as an annual and is propagated each year from the previous crop's seed. The seed was originally obtained from a local ethnic grocery store in Lakewood, CA. The homeowner stated that he had noticed symptoms for a number of years and that they seemed especially severe during the winter months. The adaxial surfaces of the leaves exhibited small chlorotic spots often at the leaf margins, while the abaxial surfaces exhibited a grayish violet, felty growth. Conidiophores found on the underside of the leaves branched dichotomously 6 to 10 times and were terminally forked. Conidiophores measured 280 to 525 μm (average 420 μm) with slightly swollen bases (7.5 to 10 μm broad). Conidia were slightly pigmented, oblong to ellipsoid, and measured 23 to 33 × 18 to 23 μm (average 27.8 × 20.3 μm). Globose oospores with verruculose walls measured 30 to 40 μm in diameter (average 36.1 μm) and were found embedded in the leaf tissue of older lesions. The pathogen was identified morphologically as Peronospora trigonellae Gaum. (3). Sequences of a portion of the rDNA, including the internal transcribed spacer regions, were obtained using primers DC6 and ITS6 (1). Sequence data for P. trigonellae had not previously been entered into GenBank and no identity was obtained. Pathogenicity experiments attempted by spraying healthy fenugreek seedlings with conidial suspensions were unsuccessful, presumably because of the age of the inoculum. Since fenugreek is not commercially grown in California, the economic importance of this disease is limited. Although P. trigonellae has been reported on fenugreek in Algeria, India, Pakistan, and the United Kingdom (2–4), to our knowledge, this is the first report of its occurrence in California and the United States. A specimen of P. trigonellae has been deposited in the U.S. National Fungus Collection (BPI 879153). References: (1) D. E. L. Cooke et al. Fungal Genet. Biol. 30:17, 2000. (2) D. F. Farr et al. Fungal Databases. Systematic Mycology and Microbiology Laboratory. Online publication. ARS, USDA, 2009, (3) E. A. Gaumann. Beitr. Kryptogamenflora Schweiz 5:216, 1923. (4) D. R. Jones et al. Plant Pathol. 56:891, 2007.

scholarly journals First Report of Anthracnose Caused by Colletotrichum acutatum on Persimmon Fruit in the United States

Plant Disease ◽  
2010 ◽  
Vol 94 (5) ◽  
pp. 634-634 ◽  
Author(s):  
S. M. Williamson ◽  
T. B. Sutton
Keyword(s):  
United States ◽  
Filter Paper ◽  
The United States ◽  
Grocery Store ◽  
Fruit Rot ◽  
Colletotrichum Acutatum ◽  
Diospyros Kaki ◽  
Japanese Persimmon ◽  
First Report ◽  
Persimmon Fruit

Persimmon trees are important for their fruit as well as their colorful fruit and foliage in the fall. Persimmon fruit (Japanese persimmon, Diospyros kaki cv. Fuyu) were collected in November 2008 from a tree in Windsor, NC, located in the Coastal Plain. Fruit were not symptomatic on the tree but developed dark lesions after harvest. Isolations from six fruit yielded seven isolates of Colletotrichum acutatum J. H. Simmonds. After incubation at 25°C under continuous light for 15 days on potato dextrose agar (PDA), all isolates had gray aerial mycelium, but the inverse sides of the plates of six isolates were maroon and one was beige. Masses of salmon-colored conidia were formed first in the center of the colonies, then were observed scattered across the colonies in older cultures. Conidia were hyaline, one-celled, elliptic with one or both ends pointed, and measured 8.1 to 16.3 × 3.1 to 5 μm. Setae and sclerotia were not observed. There were also dark structures measuring 1 to 10 mm that were partially embedded in the agar that contained conidia. Cultural and conidial characteristics of the isolates were similar to those of C. acutatum (3). PCR amplification was performed with the species-specific primer pair CaInt2/ITS4 (2) and genomic DNA from the original isolates and isolates obtained from inoculated fruit. An amplification product of approximately 490 bp, which is specific for C. acutatum, was observed. To fulfill Koch's postulates, persimmon fruit obtained from the grocery store were surface disinfested with 0.5% sodium hypochlorite and sterile filter paper disks dipped in conidial suspensions (1 × 105 conidia/ml) of two C. acutatum isolates (maroon and beige reverse) or sterile, deionized water were placed on the fruit. Three fruit were inoculated per treatment and the disks were placed on four locations on each fruit. Parafilm was wrapped around the diameter of the fruit to keep the filter paper disks moist and in place. Fruit were placed in moist chambers and incubated at 25°C. After 3 days, the Parafilm was removed and the fruit returned to the moist chambers. Small, dark lesions were observed on fruit inoculated with each isolate of C. acutatum when the filter paper disks were removed. Ten days after inoculation, dark lesions and acervuli with salmon-colored masses of conidia were observed on fruit inoculated with both isolates of C. acutatum and the fruit were soft. After 12 days, there were abundant masses of conidia and the inoculated areas were decayed. Control fruit remained firm and did not develop symptoms. Cultures obtained from the fruit and the conidia produced were typical of the isolates used to inoculate the fruit. C. acutatum has been reported to cause fruit rot on persimmon fruit in New Zealand (1). To our knowledge, this is the first report of C. acutatum on persimmon fruit in the United States. References: (1) R. Lardner et al. Mycol. Res. 103:275, 1999. (2) S. Sreenivasaprasad et al. Plant Pathol. 45:650, 1996. (3) B. C. Sutton. Page 523 in: Coelomycetes. Commonwealth Agricultural Bureaux, Great Britain. 1980.

scholarly journals First report of Coleus blumei viroid 1 in commercial Coleus blumei in the United States

Plant Disease ◽  
2021 ◽  
Author(s):  
Gardenia Orellana ◽  
Alexander V Karasev
Keyword(s):  
United States ◽  
Leaf Tissue ◽  
The United States ◽  
Universal Primers ◽  
Rt Pcr ◽  
Universal Primer ◽  
Tissue Samples ◽  
First Report ◽  
Specific Pcr ◽  
Coleus Blumei

Coleus scutellarioides (syn. Coleus blumei) is a widely grown evergreen ornamental plant valued for its highly decorative variegated leaves. Six viroids, named Coleus blumei viroid 1 to 6 (CbVd-1 to -6) have been identified in coleus plants in many countries of the world (Nie and Singh 2017), including Canada (Smith et al. 2018). However there have been no reports of Coleus blumei viroids occurring in the U.S.A. (Nie and Singh 2017). In April 2021, leaf tissue samples from 27 cultivars of C. blumei, one plant of each, were submitted to the University of Idaho laboratory from a commercial nursery located in Oregon to screen for the presence of viroids. The sampled plants were selected randomly and no symptoms were apparent in any of the samples. Total nucleic acids were extracted from each sample (Dellaporta et al. 1983) and used in reverse-transcription (RT)-PCR tests (Jiang et al. 2011) for the CbVd-1 and CbVd-5 with the universal primer pair CbVds-P1/P2, which amplifies the complete genome of all members in the genus Coleviroid (Jiang et al. 2011), and two additional primer pairs, CbVd1-F1/R1 and CbVd5-F1/R1, specific for CbVd-1 and CbVd-5, respectively (Smith et al. 2018). Five C. blumei plants (cvs Fire Mountain, Lovebird, Smokey Rose, Marrakesh, and Nutmeg) were positive for a coleviroid based on the observation of the single 250-nt band in the RT-PCR test with CbVds-P1/P2 primers. Two of these CbVd-1 positive plants (cvs Lovebird and Nutmeg) were also positive for CbVd-1 based on the presence of a single 150-nt band in the RT-PCR assay with CbVd1-F1/R1 primers. One plant (cv Jigsaw) was positive for CbVd-1, i.e. showing the 150-nt band in RT-PCR with CbVd1-F1/R1 primers, but did not show the ca. 250-bp band in RT-PCR with primers CbVds-P1/P2. None of the tested plants were positive for CbVd-5, either with the specific, or universal primers. All coleviroid- and CbVd-1-specific PCR products were sequenced directly using the Sanger methodology, and revealed whole genomes for five isolates of CbVd-1 from Oregon, U.S.A. The genomes of the five CbVd-1 isolates displayed 96.9-100% identity among each other and 96.0-100% identity to the CbVd-1 sequences available in GenBank. Because the sequences from cvs Lovebird, Marrakesh, and Nutmeg, were found 100% identical, one sequence was deposited in GenBank (MZ326145). Two other sequences, from cvs Fire Mountain and Smokey Rose, were deposited in the GenBank under accession numbers MZ326144 and MZ326146, respectively. To the best of our knowledge, this is the first report of CbVd-1 in the United States.

scholarly journals First Report of Downy Mildew Caused by Plasmopara obducens on Impatiens in California

Plant Disease ◽  
2004 ◽  
Vol 88 (8) ◽  
pp. 909-909 ◽  
Author(s):  
S. N. Wegulo ◽  
S. T. Koike ◽  
M. Vilchez ◽  
P. Santos
Keyword(s):  
United States ◽  
Downy Mildew ◽  
Disease Incidence ◽  
Leaf Tissue ◽  
The United States ◽  
Plant Diseases ◽  
Single Type ◽  
First Report ◽  
Commercial Grower ◽  
Impatiens Walleriana

During February 2004, diseased double impatiens (Impatiens walleriana) plants were received from a commercial grower in southern California. The upper surfaces of symptomatic leaves were pale yellow with no distinct lesions. Diseased leaves later wilted, and severely affected leaves abscised from the stem. At the nursery, only double impatiens plants in the Fiesta series were infected, and some cultivars were more heavily infected than others. Disease incidence in cv. Sparkler Hot pink was nearly 100%. The interior of infected leaves was colonized by coenocytic mycelium. A conspicuous white growth was observed only on the underside of leaves. Sporangiophores were hyaline, thin walled, emergent from stomata, and had slightly swollen bases. Sporangiophore branching was distinctly monopodial. Smaller sporangiophore branches were arranged at right angles to the supporting branches, and tips of branches measured 8 to 14 μm long. Sporangia were ovoid and hyaline with a single pore on the distal ends. Distal ends of sporangia were predominantly flat but occasionally had a slight papilla. Short pedicels were present on the attached ends. Sporangia measured 19.4 to 22.2 (-25.0) μm × 13.9 to 16.7 (-19.4) μm. Oospores were not observed in leaf tissue. On the basis of symptoms and morphology of the organism, the pathogen was identified as Plasmopara obducens J. Schröt. Pathogenicity tests were done on double type cvs. Fiesta, Tioga Red, and Tioga Cherry Red and on single type cvs. Cajun Watermelon and Accent Lilac. Plants were spray inoculated with sporangiospore suspensions (1 × 104 sporangiospores per milliliter), incubated for 24 h in a dew chamber (18 to 20°C), and then maintained in a greenhouse (22 to 24°C). Symptoms and signs of downy mildew developed after 12 days only on inoculated cv. Fiesta plants, and the pathogen morphology matched that of the originally observed pathogen. Nontreated control plants did not develop downy mildew. To our knowledge, this is the first report of downy mildew on impatiens in California. P. obducens is one of two causal agents of downy mildew of impatiens (2,4). The other pathogen, Bremiella sphaerosperma, has dichotomous sporangiophore branching and causes lesions with well-defined margins (2,4). In the United States, the disease has been recorded in the eastern and northeastern states and in Indiana, Minnesota, Mississippi, Montana, and Wisconsin (3). In Canada, the disease has been recorded in Manitoba and Quebec (1). References: (1) I. L. Conners. An Annotated Index of Plant Diseases in Canada and Fungi Recorded on Plants in Alaska, Canada, and Greenland. Research Branch, Canada Department of Agriculture, Publication 1251, 1967. (2) O. Constantinescu. Mycologia 83:473, 1991. (3) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, 1989. (4) G. W. Wilson. Bull. Torrey Bot. Club 34:387, 1907.

Morrissey as Latina/o Literary and Cultural Icon

2018 ◽  
Author(s):  
Melissa M. Hidalgo
Keyword(s):  
United States ◽  
Los Angeles ◽  
Cultural Production ◽  
The United States ◽  
The Body ◽  
The United Kingdom ◽  
Fourth Decade ◽  
The World ◽  
United States Mexico ◽  
North And South America

Morrissey is a singer and songwriter from Manchester, England. He rose to prominence as a popular-music icon as the lead singer for the Manchester band The Smiths (1982–1987). After the breakup of The Smiths, Morrissey launched his solo career in 1988. In his fourth decade as a popular singer, Morrissey continues to tour the world and sell out shows in venues throughout Europe and the United Kingdom, Asia and Australia, and across North and South America. Although Morrissey enjoys a fiercely loyal global fan base and inspires fans all over the world, his largest and most creatively expressive fans, arguably, are Latinas/os in the United States and Latin America. He is especially popular in Mexico and with Chicanas/os from Los Angeles, California, to San Antonio, Texas. How does a white singer and pop icon from England become an important cultural figure for Latinas/os? This entry provides an overview of Morrissey’s musical and cultural importance to fans in the United States–Mexico borderlands. It introduces Morrissey, examines the rise of Latina/o Morrissey and Smiths fandom starting in the 1980s and 1990s, and offers a survey of the fan-produced literature and other cultural production that pay tribute to the indie-music star. The body of fiction, films, plays, poetry, and fans’ cultural production at the center of this entry collectively represent of Morrissey’s significance as a dynamic and iconic cultural figure for Latinas/os.

scholarly journals First Report of Powdery Mildew Caused by Erysiphe platani on Sycamore (Platanus occidentalis) in South Korea

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 841-841
Author(s):  
H. B. Lee ◽  
H. W. Lee ◽  
H. Y. Mun
Keyword(s):  
United States ◽  
Powdery Mildew ◽  
South Korea ◽  
Sequence Data ◽  
Average Rate ◽  
Nationwide Survey ◽  
The United States ◽  
High Sequence Identity ◽  
First Report ◽  
Platanus Occidentalis

Platanus occidentalis L. (sycamore) is an important shade tree distributed throughout the Northern Hemisphere and in South Korea. It has been widely used as an ornamental tree, especially in urban regions and by roadsides. The average rate of roadside planting throughout South Korea covers about 5.7% (up to 38% in Seoul), equivalent to 0.36 million trees. In early July 2012, after a rainy spell in summer, an outbreak of powdery mildew on sycamore was first observed on roadside trees in Gwangju, a southern province of South Korea. A more extensive nationwide survey revealed no powdery mildew in northern or central regions of South Korea. The disease has spread rapidly within Gwangju, even though fungicide applications were carried out after the rainy spell. Major symptoms included white, superficial mycelia, grey to brown lesions on the surface of the leaves due to the presence of a hyperparasite (tentatively identified as Ampelomyces sp.), a slight chlorosis, and severe leaf distortion followed by defoliation. Conidiophores were produced singly, straight, and unbranched, with lengths of 35.2 to 315.2 μm (average 170.4 μm). Conidia were ellipsoid or doliiform, ranging in size from 34.9 to 47.4 μm (average 38.2 μm) long × 16.5 to 26.8 μm (average 23.9 μm) wide. Primary conidia had a truncate base and rounded apex; secondary conidia had both a truncate base and apex. The conidial outer surface had a reticulated wrinkling. Cleistothecia (i.e., sexual spore structures) were not found during the survey, which extended from July to October. These characteristics and the host species match those of Microsphaera platani (syn. Erysiphe platani), which was described on P. occidentalis in Washington State (2). Fungal rDNA was amplified using primers ITS1 and LR5F (4) for one sample (EML-PLA1, GenBank JX485651). BLASTn searches of GenBank revealed high sequence identity to E. platani (99.5% to JQ365943 and 99.3% to JQ365940). Recently, Liang et al. (3) reported the first occurrence of powdery mildew by E. platani on P. orientalis in China based only on its morphology. Thus, in this study, author could only use ITS sequence data from the United States and Europe to characterize the isolate. To date, nine records of powdery mildews of Platanus spp. have been reported worldwide: on P. hispanica from Brazil, Japan, Hungary, and Slovakia; P. orientalis from Israel; P. racemosa from the United States; P. × acerifolia from the United Kingdom and Germany; and Platanus sp. from Argentina and Australia (1). Interestingly, the hyperparasite, Ampelomyces sp., was found with E. platani, suggesting that there may be some level of biocontrol in nature. Pathogenicity was confirmed by gently pressing diseased leaves onto six leaves of healthy sycamore plants in the field in September. The treated leaves were sealed in sterilized vinyl pack to maintain humid condition for 2 days. Similar symptoms were observed on the inoculated leaves 10 days after inoculation. Koch's postulates were fulfilled by re-observing the fungal pathogen. To our knowledge, this is the first report of powdery mildew caused by E. platani on sycamore in South Korea. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases, Systematic Mycology and Microbiology Laboratory, ARS, USDA. http://nt.ars-grin.gov/fungaldatabases/ , 2012. (2) D. A. Glawe. Plant Health Progress, doi:10.1094/PHP-2003-0818-01-HN, 2003. (3) C. Liang et al. Plant Pathol. 57:375, 2008. (4) T. J White et al., pp. 315-322 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., ed. Academic Press, New York, 1990.

scholarly journals First Report of Alternanthera mosaic virus Infection in Angelonia in the United States

Plant Disease ◽  
2008 ◽  
Vol 92 (10) ◽  
pp. 1473-1473 ◽  
Author(s):  
B. E. Lockhart ◽  
M. L. Daughtrey
Keyword(s):  
United States ◽  
Nucleotide Sequence ◽  
Mosaic Virus ◽  
Genomic Sequence ◽  
Nutrient Deficiency ◽  
Leaf Tissue ◽  
The United States ◽  
Nucleotide Sequence Analysis ◽  
Degenerate Primers ◽  
First Report

Stunting, chlorosis, and light yellow mottling resembling symptoms of nutrient deficiency were observed in angelonia (Angelonia angustifolia) in commercial production in New York. Numerous, filamentous particles 520 to 540 nm long and spherical virus particles 30 nm in diameter were observed by transmission electron microscopy (TEM) in negatively stained partially purified extracts of symptomatic Angelonia leaf tissue. Two viruses, the filamentous potexvirus Alternanthera mosaic virus (AltMV) and the spherical carmovirus Angelonia flower break virus (AnFBV) were subsequently identified on the basis of nucleotide sequence analysis of amplicons generated by reverse transcription (RT)-PCR using total RNA isolated from infected leaf tissue. A 584-bp portion of the replicase-encoding region of the AltMV genome was obtained with the degenerate primers Potex 2RC (5′-AGC ATR GNN SCR TCY TG-3′) and Potex 5 (5′-CAY CAR CAR GCM AAR GAT GA-3′) (3). Forward (AnFBV CP 1F-5′-AGC CTG GCA ATC TGC GTA CTG ATA-3′) and reverse (AnFBV CP 1R-5′-AAT ACC GCC CTC CTG TTT GGA AGT-3′) primers based on the published AnFBV genomic sequence (GenBank Accession No. NC_007733) were used to amplify a portion of the viral coat protein (CP) gene. The nucleotide sequence of the amplicon generated using the potexvirus-specific primers (GenBank Accession No. EU679362) was 99% identical to the published AltMV (GenBank Accession No. NC_007731) sequence and the nucleotide sequence of the amplicon obtained using the AnFBV CP primers was 99% identical to the published AnFBV genomic sequence (GenBank Accession No. EU679363). AnFBV occurs widely in angelonia (1) and AltMV has been identified in phlox (2). These data confirm the presence of AltMV and AnFBV in diseased angelonia plants showing stunting and nutrient deficiency-like symptoms and substantiates, to our knowledge, this first report of AltMV in angelonia in the United States. References: (1) S. Adkins et al. Phytopathology 96:460, 2006. (2) J. Hammond et al. Arch. Virol. 151:477, 2006. (3) R. A. A. van der Vlugt and M. Berendeson. Eur. J. Plant Pathol. 108:367, 2002.

scholarly journals Dicentra, Epimedium, and Heuchera: New Perennial Ornamental Hosts of Tobacco rattle virus in the United States

Plant Disease ◽  
2000 ◽  
Vol 84 (12) ◽  
pp. 1344-1344 ◽  
Author(s):  
B. E. L. Lockhart
Keyword(s):  
Electron Microscopy ◽  
United States ◽  
Tobacco Rattle Virus ◽  
Leaf Tissue ◽  
Particle Morphology ◽  
The United States ◽  
Enzyme Linked Immunosorbent Assay ◽  
Infected Leaf ◽  
Natural Occurrence ◽  
First Report

Yellow ringspotting and concentric line patterns in plants of Dicentra (bleeding heart), Epimedium (barrenwort), and Heuchera (coral bells) from commercial nurseries and home gardens in Minnesota, Michigan, and Massachusetts were associated with infection by Tobacco rattle virus (TRV), which was identified by particle morphology, enzyme-linked immunosorbent assay and immunosorbent electron microscopy. No other viruslike particles were observed by electron microscopy in partially purified preparations of TRV-infected leaf tissue, and TRV was not detected in asymptomatic plants. This is the first report of TRV occurrence in Dicentra in the United States and the first report of TRV occurrence in Epimedium and Heuchera. In previous reports (1,2) we have called attention to the increasing incidence of TRV in vegetatively propagated perennial ornamental plant species in the United States and to the potential for virus spread to crops such as potato, in which TRV has not been reported in the midwestern United States. It is possible that increased international trade in vegetatively propagated ornamental plants may be resulting in the introduction of TRV and other exotic viruses into the United States and elsewhere. It is also possible that the natural occurrence of TRV in North America may be actually more widespread than has been reported. References: (1) B. E. Lockhart et al. Plant Dis. 79:1249, 1995. (2) B. E. Lockhart and J. A. Westendorp. Plant Dis. 82:712, 1998.

scholarly journals First Report of Ascochyta Leaf Spot of Quinoa Caused by Ascochyta sp. in the United States

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 844-844 ◽  
Author(s):  
A. L. Testen ◽  
J. M. McKemy ◽  
P. A. Backman
Keyword(s):  
United States ◽  
Leaf Spot ◽  
Sequence Data ◽  
Chenopodium Quinoa ◽  
The United States ◽  
Management Program ◽  
Tween 20 ◽  
Conidial Suspension ◽  
First Report ◽  
The Impact

The Andean crop quinoa (Chenopodium quinoa Willd.), an amaranthaceous pseudograin, is an important food and export crop for this region. Quinoa is susceptible to Ascochyta leaf spot reportedly caused by Ascochyta hyalospora and/or A. caulina (1,2), and quinoa seeds can be infested by A. hyalospora (3). Quinoa fields were established in Pennsylvania during summer 2011. Widespread leafspot symptoms were observed on quinoa in mid-August 2011 in Centre County, PA. Tan to reddish-brown, irregularly shaped lesions were observed with numerous black pycnidia randomly distributed within each lesion. Crushed pycnidia revealed sub-hyaline to light brown, 1 to 2, or less often 3 septate, cylindrical to ovoid spores, 13 to 25 μm long by 5 to 10 μm wide. Pure cultures of Ascochyta were obtained by plating pycnidia from surface disinfested leaves onto half strength acidified potato dextrose agar (APDA). To obtain conidia for pathogenicity trials, cultures were transferred to oatmeal agar and placed in a 20°C incubator with a 12-h photoperiod. Conidia were harvested by scraping 2-week-old cultures. The conidial suspension was filtered through cheesecloth and adjusted to 1.8 × 105 conidia/mL. Tween 20 (0.1%) was added to the final inoculum and sprayed (with a Crown Spra-tool) onto ten 1-month old quinoa plants. Six plants sprayed with sterile water with 0.1% Tween 20 served as controls. Plants were placed in a growth chamber and bagged for 48 h to maintain >95% humidity. After 48 h, tan, irregularly shaped lesions were observed on inoculated plants, but no symptoms were observed on control plants. Plants were grown for 2 more weeks to observe symptom development, and then leaves with characteristic lesions were collected for isolation. Symptomatic leaves were surface disinfested in 10% bleach for 1 min and tissue from the lesion periphery was plated onto APDA. Obtained cultures were morphologically and molecularly identical to those obtained from quinoa fields. For molecular identification of the pathogen, DNA was extracted from cultures of Ascochyta and amplified using ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAAGG) primers. Sequences obtained shared 99% maximum identity with a GenBank accession of A. obiones (GU230752.1), a species closely related to A. hyalospora and A. caulina (4). However, the obtained pathogen is morphologically more similar to A. hyalospora and A. chenopodii, but not to A. caulina or A. obiones. At this time, final species identification is impossible because no GenBank sequence data is available for A. hyalospora or A. chenopodii. To our knowledge, this is the first report of Ascochyta leaf spot of quinoa in the United States. The impact of Ascochyta leaf spot on domestic and global quinoa production is unknown, but management of foliar diseases of quinoa, including Ascochyta leaf spot, is a critical component of any disease management program for quinoa. References: (1) S. Danielsen. Food Rev. Int. 19:43, 2003. (2) M. Drimalkova. Plant Protect. Sci. 39:146, 2003. (3) G. Boerema. Neth. J. Plant. Pathol. 83:153, 1977. (4) J. de Gruyter. Stud. Mycol. 75:1, 2012.

scholarly journals First Report of Leaf Blight and Stem Dieback of St. John's-Wort Caused by Diploceras hypericinum in Oregon

Plant Disease ◽  
2000 ◽  
Vol 84 (11) ◽  
pp. 1250-1250 ◽  
Author(s):  
M. L. Putnam
Keyword(s):  
United States ◽  
Pacific Northwest ◽  
Leaf Tissue ◽  
The United States ◽  
Leaf Blight ◽  
Jefferson County ◽  
Single Spore ◽  
First Report ◽  
St John’S Wort ◽  
St John's Wort

St. John's-wort, Hypericum perforatum L., was formerly considered a noxious weed in the Pacific Northwest and is now grown commercially for its medicinal properties. In May 1999, plants from a 5-ha field in Jefferson County, OR, were observed with yellowing leaves and stem dieback. Lower leaves showed marginal necrosis or circular, expanding, uniformly brown, unremarkable leaf lesions that appeared randomly over the lamina and consumed from a quarter to nearly the entire leaf area. Remaining leaf tissue was chlorotic, and affected leaves eventually abscised. Infection of the stems resulted in girdling lesions 0.5 to 1.0 cm in length that caused chlorosis, wilting, and eventual dieback of tissues distal to the lesion. Diploceras hypericinum (Cesati) Diedicke was sporulating on affected stems and leaves. The fungus was isolated from surface-disinfested tissue onto 1.5% water agar. A single-spore isolate was used to inoculate 10-month-old plants raised from seed in sand. Spores from 6-week-old cultures grown on 50% potato-dextrose agar were harvested, suspended in phosphate buffer with 0.2% gelatin (PBG), and sprayed onto three plants using a DeVilbiss atomizer. Inoculum concentration was 7 × 103 and 3 ml per plant were used (plants were 8 to 10 cm tall). Three control plants were sprayed with sterile PBG. Inoculated and control plants were separately bagged to retain moisture and maintained at 22 to 25°C. Four days later, inoculated plants exhibited leaf spots similar to those originally observed, followed by stem dieback. D. hypericinum was isolated from all inoculated plants but not from control plants. The known distribution of D. hypericinum is France, Germany, Portugal, Sweden, Greece, and Ontario, Canada (1,2). This is the first report of D. hypericinum causing leaf blight and stem dieback of St. John's-wort in the United States. References: (1) D. F. Farr et al. 1989. Fungi on Plants and Plant Products in the United States. American Phytopathological Society, St. Paul, MN. (2) T. R. Nag Raj. 1993. Coelomycetous Anamorphs with Appendage-bearing Conidia. Mycologue Publications, Waterloo, Canada.

Sign in / Sign up

Export Citation Format

Share Document