scholarly journals Calcium fertilisation reduces incidence of soft rot (Erwinia carotovora) on potato tubers

1997 ◽  
Vol 50 ◽  
pp. 535-535
Author(s):  
P.J. Wright ◽  
C.M. Triggs
Keyword(s):  
Erwinia Carotovora ◽  
Soft Rot ◽  
Potato Tubers

Use of 1,4-naphthoquinones for control of Erwinia carotovora

2004 ◽  
Vol 50 (11) ◽  
pp. 951-956 ◽  
Author(s):  
Luis F.C Medina ◽  
Valter Stefani ◽  
Adriano Brandelli
Keyword(s):  
Antimicrobial Effect ◽  
Erwinia Carotovora ◽  
Soft Rot ◽  
Sodium Ascorbate ◽  
Bacterial Suspension ◽  
Oxygen Species ◽  
Potato Tubers ◽  
Phytopathogenic Bacteria ◽  
Minimal Inhibitory Concentrations

The antimicrobial effect of 5 naphthoquinones was tested against the phytopathogenic bacteria Erwinia carotovora. Disk diffusion tests and determination of minimal inhibitory concentrations (MIC) indicate that the compound naphthazarin (NTZ) has the best antibacterial activity among the naphthoquinones tested. Studies on the mode of action indicate the effect of NTZ was bactericidal at 10 µg/mL. When cultivation was done in the presence of sodium ascorbate, the restoration of E. carotovora growth was observed with 3 µg/mL NTZ, but not when a 10 µg/mL dose was used. The incubation of NTZ with bacterial suspension of E. carotovora resulted in important changes in the absorption spectra of this naphthoquinone, indicating that a redox reaction takes place. These results may suggest that NTZ induces an increase of reactive oxygen species that are toxic to the cell. The compound NTZ was also effective in preventing E. carotovora growth on potato tubers, inhibiting the soft rot development at a concentration of 2 mg/mL.Key words: antimicrobial, naphthazarin, phytopathogen, potato, 5,8-dihydroxy-1,4-naphthoquinone.

Bacteriocin-like substance inhibits potato soft rot caused by Erwinia carotovora

2006 ◽  
Vol 52 (6) ◽  
pp. 533-539 ◽  
Author(s):  
Florencia Cladera-Olivera ◽  
Geruza R Caron ◽  
Amanda S Motta ◽  
André A Souto ◽  
Adriano Brandelli
Keyword(s):  
Electron Microscopy ◽  
Transmission Electron Microscopy ◽  
Bacillus Licheniformis ◽  
Membrane Lipids ◽  
Erwinia Carotovora ◽  
Soft Rot ◽  
Bactericidal Effect ◽  
Potato Tubers ◽  
Transmission Electron ◽  
Bacterial Surfaces

Soft rot is a major problem encountered in potatoes during postharvest storage. The soft rot bacterium Erwinia carotovora was inhibited by a novel bacteriocin-like substance (BLS) produced by Bacillus licheniformis P40. The BLS caused a bactericidal effect on E. carotovora cells at 30 µg mL–1. Transmission electron microscopy showed that BLS-treated cells presented wrinkled bacterial surfaces and shrinkage of the whole cell, indicating plasmolysis. Erwinia carotovora cells treated with BLS were analyzed by FTIR showing differences in the 1390 cm–1 and 1250–1220 cm–1 bands, corresponding to assignments of membrane lipids. BLS was effective in preventing E. carotovora spoilage on potato tubers, reducing the symptoms of soft rot at 240 µg mL–1 and higher concentrations. Soft rot development was completely blocked at 3.7 mg mL–1. This BLS showed potential to protect potato tubers during storage. Key words: bacteriocin, plant pathogen, potato, soft rot, storage.

scholarly journals Variability of aggressiveness and virulence of Erwinia carotovora subsp. carotovorum causing the soft rot on potato tubers in the western of Algeria

2018 ◽  
Vol 9 (1) ◽  
Author(s):  
M’hamed Benada ◽  
Boualem Boumaaza ◽  
Sofiane Boudalia ◽  
Omar Khaladi ◽  
Bettache Guessas
Keyword(s):  
Erwinia Carotovora ◽  
Soft Rot ◽  
In Vitro Tests ◽  
Potato Storage ◽  
Bacterial Isolates ◽  
Potato Tubers ◽  
Potato Plants ◽  
Set Up ◽  
Cultivar Susceptibility

Soft rot symptoms were observed on potato plants in several potato cultivars in the western part of Algeria. A total of four strains of Erwinia are devided as follow: i) three strains of bacteria isolated from diseased tissues and soil, identified as Erwinia carotovora subsp carotovorum using conventional bacteriological and biochemical methods; and ii) one strain as Erwinia sp, not pathogens. In vitro tests, on tuber slices were set up to determine slices weight lost, which allows to find differences in cultivar susceptibility and isolate aggressiveness. Among the five cultivars, Laura was the most susceptible than the others tested cultivars. Moreover, it was found that MAI isolate was the most virulent than the other bacterial isolates. The results of this study should allow an optimization of the potato storage, after considering the susceptibility of a given cultivar to soft rot development and the aggressiveness.

scholarly journals Identification and Pathogenicity of Phytopathogenic Bacteria Associated with Soft Rot Disease of Girasole Tuber

2012 ◽  
Vol 4 (1) ◽  
pp. 75-81
Author(s):  
Mamdoh Ewis ISMAIL ◽  
Montaser Fawzy ABDEL-MONAIM ◽  
Yasser Mahmoud MOSTAFA
Keyword(s):  
Erwinia Carotovora ◽  
Soft Rot ◽  
Bacterial Isolates ◽  
Potato Tubers ◽  
Growing Seasons ◽  
Pathogenicity Tests ◽  
Rot Disease ◽  
Reducing Substances ◽  
Specific Symptoms ◽  
Deep Cavities

During 2010-2011 growing seasons six bacterial isolates were separated from naturally infected girasole plants tubers (Helianthus tuberosus L.) cv. ‘Balady’, showing soft rot, collected from experimental Farm of the Faculty of Agriculture, in El-Minia University, Egypt. Pathogenicity tests showed various virulence for the bacteria isolated from girasole tubers, found pathogenic. These organisms were characterized as rod-shaped, Gram negative, α-methyl-d-glucoside medium, reducing substances from sucrose, phos, phatase activity and deep cavities on pectate medium. Otherwise, diagnostic tests suggested that the pathogen was Erwinia carotovora ssp. carotovora. The isolated bacteria caused soft rot of wounded tubers when inoculated into tissues. The bacterial isolates were compared for their degree of pathogenicity as well as for differences in specific symptoms, induced in different hosts. The tested isolates could infect several host ranges, such as fruits of apricot, apple, olive, lemon, squash, eggplant and potato tubers, bulbs and garlic and onion cloves, roots radish, carrot, sweet potato and rape. On the other hand, no symptoms were exhibited on pods of bean and cowpea, faba bean, fruits of pepper and tomato. The extracts of experimentally diseased girasole tubers were active in pectinase and also in caboxymethyl cellulose at pH 6 compared to enzyme activities in healthy tissues. Also, the isolated bacteria increased the total and reducing sugars in infected tissues.

scholarly journals Evaluation of potato cultivars and breeding lines for susceptibility to tuber soft rot induced by Erwinia carotovora subsp atroseptica

2009 ◽  
Vol 62 ◽  
pp. 403-403
Author(s):  
M. Jeram ◽  
P.J. Wright ◽  
J.A.D. Anderson ◽  
S.L. Lewthwaite
Keyword(s):  
Erwinia Carotovora ◽  
Soft Rot ◽  
Storage Conditions ◽  
Potato Cultivars ◽  
Control Measures ◽  
Postharvest Disease ◽  
Potato Tubers ◽  
Breeding Lines ◽  
Susceptibility To Infection ◽  
Potato Breeding Programme

Bacterial soft rot of potato tubers in storage is an economically important postharvest disease worldwide Disease control measures include reduction of tuber damage at harvest provision of suitable storage conditions and breeding of resistant cultivars Tubers of 18 potato cultivars and breeding lines were assessed for susceptibility to infection by Erwinia carotovora subsp atroseptica (Eca) over three maincrop seasons between 2003 and 2007 Susceptibility to Ecainduced soft rot was determined by measuring the weight of rotted tissue in anaerobically incubated whole tubers 7 days after inoculation with Eca Potato lines differed in susceptibility to soft rot by a factor of >37 (weight of rotted tissue) Cultivars Crop 28 Ilam Hardy and 30975 were highly susceptible and 065/27 Crop 15 and Crop 16 were least susceptible to Ecainduced soft rot As a consequence of these trials several of these lines are now being used in Plant Food Researchs potato breeding programme in order to develop cultivars with lower soft rot susceptibility than cultivars currently grown

scholarly journals Occurrence of Potato Soft Rot Caused by Erwinia carotovora (synonym Pectobacterium carotovorum) in Nepal: A First Report

Plant Disease ◽  
2010 ◽  
Vol 94 (3) ◽  
pp. 382-382 ◽  
Author(s):  
J. R. Lamichhane ◽  
G. M. Balestra ◽  
L. Varvaro
Keyword(s):  
16S Rdna ◽  
Solanum Tuberosum L ◽  
Erwinia Carotovora ◽  
Soft Rot ◽  
Bacterial Suspension ◽  
Potato Tubers ◽  
Biochemical Tests ◽  
Wide Range ◽  
Fundamental Value ◽  
Negative Controls

Potato (Solanum tuberosum L.) is the fourth most important major crop of Nepal after rice, corn, and wheat, with an annual production of 1.94 million t and 153,000 ha of harvested area. It is a staple food crop in the remote hilly areas and the main vegetable in other parts of the country. Potato is grown in all three major agricultural zones (high hills, mid hills, and plain land) of Nepal, at an altitude ranging from 60 m to more than 4,000 m. Erwinia carotovora causes soft rot worldwide on a wide range of hosts including potato, carrot, and cabbage. During the spring of 2009, a soft rot with a foul smell was noted in stored potato tubers of different local cultivars, especially Rato Alu and Seto Alu, in the Kathmandu District, central region of Nepal. Symptoms on tubers appeared as tan, water-soaked areas with watery ooze. The rotted tissues were white-to-cream colored. Seven different potato fields, where the stored tubers originated, were surveyed and 23 samples consisting of approximately three symptomatic tubers were collected. Bacteria were successfully isolated from all diseased tissues on nutrient agar supplemented with 5% sucrose and incubated at 26 ± 1°C. After purification on tripticase soy agar medium, 17 isolates were identified as E. carotovora by the following deterministic tests: all strains were gram-negative rods; oxidase negative; facultatively anaerobic; able to degrade pectate; sensitive to erythromycin; negative for phosphatase; unable to produce acid from α-methyl-glucoside; and produced acid from trehalose. Pathogenicity of the strains was evaluated by depositing a bacterial suspension (106 CFU/ml) on potato slices (cv. Monalisa) and incubating at 30 ± 1°C. A reference strain of E. carotovora subsp. carotovora (NCPPB 2577) and sterile distilled water were used, respectively, as positive and negative controls. All strains caused soft rot within a week. Bacteria were reisolated from the slices and were shown to be identical to the original strains according to the above morphological, cultural, and biochemical tests. A 1,430-bp region of the 16S rDNA from all strains was amplified with primers NOC 1F (AGAGTTTGATCATGGCTCAG) and NOC 3R (ACGGTTACCTTGTTACGACTT) and sequenced (GenBank Accession No. GU075708; strain NEP ECC09). A BlastN search of GenBank revealed that the strains had 100% nt identity with the 16S rDNA sequence of E. carotovora subsp. carotovora type strain ATCC 15713 (GenBank Accession No. U80197). The finding of this pathogen is of fundamental value since this crop represents one of the economically important crops of Nepal. This pathogen has already been reported in the countries of China and India (1) with whom Nepal shares its boundaries. The pathogen may have been introduced to this region of Nepal via seed potato tubers from other countries. Reference: (1) G. S. Shekhawat et al. Potato Res. 19:241, 1976.

Sign in / Sign up

Export Citation Format

Share Document