scholarly journals Assessing Susceptibility of Carrot Roots to Bacterial Soft Rot

HortScience ◽  
1992 ◽  
Vol 27 (9) ◽  
pp. 1020-1022 ◽  
Author(s):  
Barbara Michalik ◽  
Philipp W. Simon ◽  
Warren H. Gabelman
Keyword(s):  
Screening Method ◽  
Erwinia Carotovora ◽  
Soft Rot ◽  
Bacterial Suspension ◽  
Bacterial Soft Rot ◽  
Severe Damage ◽  
Cross Sectional ◽  
Severity Of Disease ◽  
Disease Damage ◽  
Consistent Response

Four methods for screening carrot (Daucus carota L.) germplasm for resistance to bacterial soft rot were compared. There were differences in resistance among strains, with most severe damage caused by Erwinia carotovora pv. carotovora SR 394 (L.R. Jones) Holland and Erwinia carotovora pv. atroseptica SR 159 (van Hall) Jennison. Inoculation of cross-sectional root slices with bacteria applied in suspension-soaked paper disks produced the most consistent response. The severity of disease damage was proportional to bacterial suspension concentration. With the development of a standard screening method, it may be possible for breeders to breed carrots with reduced susceptibility to soft rot.

Use of 1,4-naphthoquinones for control of Erwinia carotovora

2004 ◽  
Vol 50 (11) ◽  
pp. 951-956 ◽  
Author(s):  
Luis F.C Medina ◽  
Valter Stefani ◽  
Adriano Brandelli
Keyword(s):  
Antimicrobial Effect ◽  
Erwinia Carotovora ◽  
Soft Rot ◽  
Sodium Ascorbate ◽  
Bacterial Suspension ◽  
Oxygen Species ◽  
Potato Tubers ◽  
Phytopathogenic Bacteria ◽  
Minimal Inhibitory Concentrations

The antimicrobial effect of 5 naphthoquinones was tested against the phytopathogenic bacteria Erwinia carotovora. Disk diffusion tests and determination of minimal inhibitory concentrations (MIC) indicate that the compound naphthazarin (NTZ) has the best antibacterial activity among the naphthoquinones tested. Studies on the mode of action indicate the effect of NTZ was bactericidal at 10 µg/mL. When cultivation was done in the presence of sodium ascorbate, the restoration of E. carotovora growth was observed with 3 µg/mL NTZ, but not when a 10 µg/mL dose was used. The incubation of NTZ with bacterial suspension of E. carotovora resulted in important changes in the absorption spectra of this naphthoquinone, indicating that a redox reaction takes place. These results may suggest that NTZ induces an increase of reactive oxygen species that are toxic to the cell. The compound NTZ was also effective in preventing E. carotovora growth on potato tubers, inhibiting the soft rot development at a concentration of 2 mg/mL.Key words: antimicrobial, naphthazarin, phytopathogen, potato, 5,8-dihydroxy-1,4-naphthoquinone.

scholarly journals First Report of Bacterial Soft Rot of Potato Caused by Pectobacterium carotovorum subsp. carotovorum in Guangdong Province of China

Plant Disease ◽  
2012 ◽  
Vol 96 (12) ◽  
pp. 1819-1819 ◽  
Author(s):  
J. X. Zhang ◽  
B. R. Lin ◽  
H. F. Shen ◽  
X. M. Pu ◽  
Z. N. Chen ◽  
...  
Keyword(s):  
Guangdong Province ◽  
Housekeeping Genes ◽  
Soft Rot ◽  
Bacterial Suspension ◽  
Pectobacterium Carotovorum ◽  
Bacterial Soft Rot ◽  
First Report ◽  
Wide Range ◽  
Carotovorum Subsp ◽  
Agar Media

Potato (Solanum tuberosum L.) is a major crop in China, with 80.0 million tons being produced in 2010 on 3.3 million ha. Pectobacterium carotovorum subsp. carotovorum Jones 1901; Hauben et al. 1999 causes soft rot worldwide on a wide range of hosts including potato, carrot, and cabbage. During spring 2010, a soft rot with a foul smell was noted in stored potato tubers of different cultivars in the Guangdong Province. Symptoms on tubers appeared as tan, water-soaked areas with watery ooze. The rotted tissues were white to cream colored. Stems of infected plants with typical inky black symptoms could also be found in the fields prior to harvest. Three different potato fields were surveyed, and 13% of the plants had the symptoms. Twenty-seven samples (three symptomatic tubers per sample) were collected. Bacteria were successfully isolated from all diseased tissues on nutrient agar media supplemented with 5% sucrose and incubated at 26 ± 1°C for 36 h. After purification on tripticase soy agar media, four typical strains (7-3-1, 7-3-2, 8-3-1, and 8-3-2) were identified using the following deterministic tests: gram-negative rods, oxidase negative, facultatively anaerobic, able to degrade pectate, sensitive to erythromycin, negative for phosphatase, unable to produce acid from α-methyl-glucoside, and produced acid from trehalose. Biolog analysis (Ver 4.20.05, Hayward, CA) identified the strains as P. carotovorum subsp. carotovorum (SIM 0.808, 0.774, 0.782, and 0.786, respectively). The identity of strains 7-3-1 (GenBank Accession No. JX258132), 7-3-2 (JX258133), and 8-3-1 (JX196705) was confirmed by 16S rRNA gene sequencing (4), since they had 99% sequence identity with other P. carotovorum subsp. carotovorum strains (GenBank Accession Nos. JF926744 and JF926758) using BLASTn. Further genetic analysis of strain 8-3-1 was performed targeting informative housekeeping genes, i.e., acnA (GenBank Accession No. JX196704), gabA (JX196706), icdA (JX196707), mdh (JX196708), mtlD (JX196709), pgi (JX196710), and proA (JX196711) (2). These sequences from strain 8-3-1 were 99 to 100%, homologous to sequences of multiple strains of P. carotovorum subsp. carotovorum. Therefore, strain 8-3-1 grouped with P. carotovorum subsp. carotovorum on the phylogenetic trees (neighbor-joining method, 1,000 bootstrap values) of seven concatenated housekeeping genes when compared with 60 other strains, including Pectobacterium spp. and Dickeya spp. (3). Pathogenicity of four strains (7-3-1, 7-3-2, 8-3-1, and 8-3-2) was evaluated by depositing a bacterial suspension (106 CFU/ml) on the potato slices of cultivar ‘Favorita’ and incubating at 30 ± 1°C. Slices inoculated with just water served as non-inoculated checks. The strains caused soft rot within 72 h and the checks had no rot. Bacteria were reisolated from the slices and were shown to be identical to the original strains based on morphological, cultural, and biochemical tests. Although this pathogen has already been reported in northern China (1), to our knowledge, this is the first report of P. carotovorum subsp. carotovorum causing bacterial soft rot of potato in Guangdong Province of China. References: (1) Y. X. Fei et al. J. Hexi Univ. 26:51, 2010.(2) B. Ma et al. Phytobacteriology 97:1150, 2007. (3) S. Nabhan et al. Plant Pathol. 61:498, 2012. (4) W. G. Weisbury et al. J. Bacteriol. 173:697, 1991.

scholarly journals Original Article. In vitro evaluation of potato genotypes for resistance against bacterial soft rot (Pectobacterium carotovorum) – a new tool for studying disease resistance

2016 ◽  
Vol 57 (1) ◽  
pp. 1-8
Author(s):  
Sima Azadmanesh ◽  
Javad Mozafari ◽  
Nader Hasanzadeh ◽  
Cobra Moslemkhani
Keyword(s):  
Soft Rot ◽  
Bacterial Suspension ◽  
Post Inoculation ◽  
Pectobacterium Carotovorum ◽  
In Vitro Screening ◽  
Bacterial Soft Rot ◽  
Inoculation Techniques ◽  
Potato Collection ◽  
Rot Disease

Abstract In vitro screening techniques were used to evaluate 46 genotypes of Iranian potato collection for resistance to bacterial soft rot caused by Pectobacterium carotovorum subsp. carotovorum (Pcc). One month old in vitro rooted potato plantlets were inoculated by two inoculation techniques under in vitro conditions: 1) sterile toothpicks dipped into bacterial suspension and pressed into the crown of plantlets and 2) the freshly cut crown of plantlets were dipped into bacterial suspension of 108 cfu ∙ ml-1 for 10 min. Typical soft rot disease symptoms, including the percentage of wilted leaves were recorded on inoculated plantlets 3, 6, 9, 12 and 15 days post-inoculation. The potato genotypes which were examined responded differently to Pcc and varying levels of resistance were observed. Potato genotype AG showed the highest level of resistance. Results obtained from in vitro screening were then verified by classical tuber slice assay. The verifications were conducted using five representative cultivars: Milva, Ramus, Picaso, Marfona and Agria which responded similarly to both in vitro and classical evaluation systems. Similar results obtained from these tests indicated that the in vitro screening technique developed in this study could provide a simple and rapid whole plant assay in selecting resistant potato genotypes against bacterial soft rot.

scholarly journals Comparison of Packing Systems for Injury and Bacterial Soft Rot on Bell Pepper Fruit

1994 ◽  
Vol 4 (3) ◽  
pp. 269-272 ◽  
Author(s):  
Sergio J. Carballo ◽  
Sylvia M. Blankenship ◽  
Douglas C. Sanders ◽  
David F. Ritchie ◽  
Michael D. Boyette
Keyword(s):  
Erwinia Carotovora ◽  
Soft Rot ◽  
Bell Pepper ◽  
Bacterial Soft Rot ◽  
Growing Seasons ◽  
Pepper Fruit ◽  
Fruit Decay ◽  
Handling Practices ◽  
Handling Methods ◽  
The Individual

Commercial packing lines in Sampson County, N.C., were surveyed during two growing seasons to study handling methods on susceptibility of bell pepper fruits (Capsicum annuum L.) to bacterial soft rot (Erwinia carotovora subsp. carotovora). Samples were taken from two field packers and one packing house in 1991 and from two field packers and four packing houses in 1992. One field packer and one packing house were common to both years. Fruits were either inoculated with bacteria or untreated and stored at 10 or 21C. Damaged fruits were counted and classified as crushed, cut, bruised, abraded, and other injuries. Fruit injury was less dependent on whether the operation was a packing house or a field packing line than on the overall handling practices of the individual grower. In general, packing peppers in packing houses resulted in an increased number of bruises, whereas fruit from field packing lines had more abrasions. More open skin injuries resulted in greater fruit decay. In both years, fruits stored at 10C had less top rot than fruits stored at 21C. In 1992, they also had less pod rot. Dry and chlorinated lines often had equivalent rot problems.

scholarly journals Occurrence of Potato Soft Rot Caused by Erwinia carotovora (synonym Pectobacterium carotovorum) in Nepal: A First Report

Plant Disease ◽  
2010 ◽  
Vol 94 (3) ◽  
pp. 382-382 ◽  
Author(s):  
J. R. Lamichhane ◽  
G. M. Balestra ◽  
L. Varvaro
Keyword(s):  
16S Rdna ◽  
Solanum Tuberosum L ◽  
Erwinia Carotovora ◽  
Soft Rot ◽  
Bacterial Suspension ◽  
Potato Tubers ◽  
Biochemical Tests ◽  
Wide Range ◽  
Fundamental Value ◽  
Negative Controls

Potato (Solanum tuberosum L.) is the fourth most important major crop of Nepal after rice, corn, and wheat, with an annual production of 1.94 million t and 153,000 ha of harvested area. It is a staple food crop in the remote hilly areas and the main vegetable in other parts of the country. Potato is grown in all three major agricultural zones (high hills, mid hills, and plain land) of Nepal, at an altitude ranging from 60 m to more than 4,000 m. Erwinia carotovora causes soft rot worldwide on a wide range of hosts including potato, carrot, and cabbage. During the spring of 2009, a soft rot with a foul smell was noted in stored potato tubers of different local cultivars, especially Rato Alu and Seto Alu, in the Kathmandu District, central region of Nepal. Symptoms on tubers appeared as tan, water-soaked areas with watery ooze. The rotted tissues were white-to-cream colored. Seven different potato fields, where the stored tubers originated, were surveyed and 23 samples consisting of approximately three symptomatic tubers were collected. Bacteria were successfully isolated from all diseased tissues on nutrient agar supplemented with 5% sucrose and incubated at 26 ± 1°C. After purification on tripticase soy agar medium, 17 isolates were identified as E. carotovora by the following deterministic tests: all strains were gram-negative rods; oxidase negative; facultatively anaerobic; able to degrade pectate; sensitive to erythromycin; negative for phosphatase; unable to produce acid from α-methyl-glucoside; and produced acid from trehalose. Pathogenicity of the strains was evaluated by depositing a bacterial suspension (106 CFU/ml) on potato slices (cv. Monalisa) and incubating at 30 ± 1°C. A reference strain of E. carotovora subsp. carotovora (NCPPB 2577) and sterile distilled water were used, respectively, as positive and negative controls. All strains caused soft rot within a week. Bacteria were reisolated from the slices and were shown to be identical to the original strains according to the above morphological, cultural, and biochemical tests. A 1,430-bp region of the 16S rDNA from all strains was amplified with primers NOC 1F (AGAGTTTGATCATGGCTCAG) and NOC 3R (ACGGTTACCTTGTTACGACTT) and sequenced (GenBank Accession No. GU075708; strain NEP ECC09). A BlastN search of GenBank revealed that the strains had 100% nt identity with the 16S rDNA sequence of E. carotovora subsp. carotovora type strain ATCC 15713 (GenBank Accession No. U80197). The finding of this pathogen is of fundamental value since this crop represents one of the economically important crops of Nepal. This pathogen has already been reported in the countries of China and India (1) with whom Nepal shares its boundaries. The pathogen may have been introduced to this region of Nepal via seed potato tubers from other countries. Reference: (1) G. S. Shekhawat et al. Potato Res. 19:241, 1976.

Sign in / Sign up

Export Citation Format

Share Document