scholarly journals First Report of Crown Gall, Caused by Agrobacterium tumefaciens on Geraldton Wax (Chamelaucium uncinatum) in South Africa

Plant Disease ◽  
1999 ◽  
Vol 83 (8) ◽  
pp. 783-783
Author(s):  
E. Carstens ◽  
Z. Dawood ◽  
E. L. Mansvelt ◽  
S. Serfontein ◽  
D. G. Malan
Keyword(s):  
South Africa ◽  
Pathogenic Bacteria ◽  
Export Market ◽  
Bacterial Suspension ◽  
Identification System ◽  
Poor Growth ◽  
First Report ◽  
Plant Pathogenic Bacteria ◽  
Pure Cultures ◽  
Chamelaucium Uncinatum

Geraldton wax (Chamelaucium uncinatum, family Myrtaceae) plants are grown as cutflowers for the export market in South Africa. In July 1998, gall-like structures were observed on collars and roots of Geraldton wax plants in commercial fields in Wellington. The galls were observed after plants exhibited poor growth. The galls varied in size and in texture from soft and spongy to hard. Secondary symptoms involved poor root development and browning of stem tissues near galls. Isolations from the galls yielded nearly pure cultures of a Gram negative, rod-shaped bacterium on Roy Sauer medium (2), typical of an Agrobacterium sp. Carbon source utilization testing with the Biolog GN Bacterial Identification System (version 3.50) confirmed the bacterium as a biovar of A. tumefaciens with a similarity of 0.88. Pathogenicity was confirmed by injecting 4- to 6-week old tomato and tobacco plants and 1-year-old Geraldton wax plants with approximately 5 μl of the bacterial suspension (108 CFU/ml) in sterile, distilled water. Inoculated plants were then transferred to a greenhouse at 25°C. Galls developed 1 month after inoculation. The bacterium was readily reisolated from the inoculated plants. A. tumefaciens is endemic to South Africa and has a very wide host range that includes several ornamentals (1). This is the first report of A. tumefaciens on Geraldton wax plants in South Africa. References: (1) J. F. Bradbury. 1986. Guide to Plant Pathogenic Bacteria. CAB Int., Slough, U.K. (2) N. W. Schaad. 1988. Laboratory Guide for Identification of Plant Pathogenic Bacteria. The American Phytopathological Society, St. Paul, MN.

scholarly journals First Report of Crown Gall, Caused by Agrobacterium tumefaciens on Soapberry (Sapindus delavayi) in China

Plant Disease ◽  
2013 ◽  
Vol 97 (5) ◽  
pp. 685-685
Author(s):  
Y. J. Wang ◽  
Y. Y. He ◽  
Z. Xie ◽  
L. Q. Zhang
Keyword(s):  
Agrobacterium Tumefaciens ◽  
16S Rdna ◽  
Crown Gall ◽  
Maximum Parsimony Analysis ◽  
Bacterial Suspension ◽  
Identification System ◽  
Distilled Water ◽  
Bacterial Identification ◽  
Poor Growth ◽  
First Report

Soapberry (Sapindus delavayi (Franch.) Radlk.,) plants are widely grown as shade trees in the subtropical to tropical regions of China. In July 2011, large, aerial galls were observed on the above-ground trunks of 5-year-old soapberry plants in two commercial nursery gardens located in Zhejiang Province. Disease incidence was estimated to be 75%. The galls varied in weight from 2 to 24 g and in texture from soft and spongy to hard, and in some cases, the galls completely girdled the trunk. The trees with galls exhibited poor growth compared with healthy trees. Isolations from the grinded and macerated galls yielded nearly pure white, circular, and glistening bacterial colonies on Roy Sauer medium (2). Six random colonies from different galls were selected for bacterial identification, and showed the same morphological, physiological, and biochemical characters and 16S rDNA sequences. All six isolates (isolate SD01 to SD06) were gram negative, rod-shaped bacteria. Carbon source utilization testing with the Biolog GN Bacterial Identification System (version 3.50) confirmed the bacteria as Agrobacterium tumefaciens with a similarity of 0.90. The most-parsimonious tree from the maximum parsimony analysis (PHYLIP package, version 3.68, 500 replicates) of bacterial 16S rDNA gene sequences showed that A. tumefaciens SD01 (GenBank Accession No. JX997939) clustered phylogenetically most closely (99.5% similarity) with A. tumefaciens C58 (AE007870.2). Pathogenicity was confirmed by injecting 3- to 5-week old tomato and sunflower plants and 2-year-old soapberry with approximately 5 μl of the bacterial suspension (108 CFU/ml) in sterile, distilled water. Sterile distilled water was used as a negative control. Ten plants of each treatment were inoculated. Inoculated plants were then transferred to a greenhouse at 25°C. Typical tumors developed at the inoculation sites on tomatoes and sunflower plants 3 weeks after inoculation and on soapberry 6 weeks after inoculation. No symptoms were observed on the control plants. The bacteria that were readily reisolated from the inoculated plants exhibited the same morphological, physiological characters and 16S rDNA sequence as the original culture and were confirmed as A. tumefaciens, fulfilling Koch's postulates. A. tumefaciens is endemic to China and has a very wide host range (1). However, crown gall of soapberry has never been found in China and other countries. To our knowledge, this is the first report of A. tumefaciens on soapberry plants in China. References: (1) M. A. Escobar and A. M. Dandekar. Trends Plant Sci. 8:380, 2003. (2) L. W. Moore et al. Page 17 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et al., eds. The American Phytopathological Society, St. Paul, MN, 2001.

scholarly journals Occurrence of Bacterial Stem Rot, Caused by Erwinia chrysanthemi, on Field-Grown Tomato in Florida

Plant Disease ◽  
1998 ◽  
Vol 82 (7) ◽  
pp. 831-831 ◽  
Author(s):  
D. O. Chellemi ◽  
H. A. Dankers ◽  
K. Hill ◽  
R. E. Cullen ◽  
G. W. Simone ◽  
...  
Keyword(s):  
Pathogenic Bacteria ◽  
Methyl Esters ◽  
Sole Source ◽  
Erwinia Chrysanthemi ◽  
Identification System ◽  
Bacterial Cells ◽  
Sterile Water ◽  
Microbial Identification ◽  
Pure Cultures ◽  
Tomato Isolate

In September 1997, wilted 4-week-old tomato (Lycopersicon esculentum Mill.) plants were observed in a commercial production field in St. Lucie County, FL. Closer inspection of affected plants revealed hollow stems and petioles with dark, water-soaked lesions. Diseased tissue was macerated and streaked onto nutrient agar (NA) and crystal violet pectate (CVP) agar. After incubation for 2 days at 30°C, isolates produced pits on the CVP agar. Isolates were transferred onto NA and the incubation and transfer procedure was performed two additional times to obtain pure cultures. Suspensions of bacterial cells were injected into tomato and tobacco leaves to test for a hypersensitive or pathogenic reaction. Isolates produced collapsed necrotic tissue on tomato while no reaction was observed on tobacco. Tests for differentiating species and subspecies in the ‘carotovora’ group of Erwinia were conducted following the protocol of Dickey and Kelman (1). With known cultures of E. carotovora subsp. carotovora and E. chrysanthemi as controls, the isolate from tomato was determined to function as a facultative anaerobe, utilize asparagine as a sole source of carbon and nitrogen, and give positive reactions for pectate degradation, phosphatase, and growth at 37°C. Known cultures of E. carotovora subsp. carotovora, E. chrysanthemi, and the tomato isolate were grown on trypticase soy broth agar for 24 h at 28°C and their cellular fatty acids derivatized to fatty acid methyl esters (FAMEs). Statistical analyses of FAME profile data (MIDI Microbial Identification System, Newark, DE, version 3.60) identified the tomato isolate as Erwinia chrysanthemi. Pathogenicity was determined by inoculating 50-day-old tomato plants (cv. SunPride) with a suspension of E. chrysanthemi obtained from nutrient broth plates incubated at 24°C for 60 h. Three plants each were inoculated with the E. chrysanthemi identified from tomato, sterile water, and known cultures of E. chrysanthemi and E. carotovora subsp. carotovora by placing a drop at the junction of the petiole and stem and passing a sterile needle through the drop into the stem. Plants were maintained in a greenhouse. Dark, water-soaked cankers were observed on the stems of plants inoculated with E. chrysanthemi, including the tomato isolate and E. carotovora subsp. carotovora, after 7 days. No symptoms were observed on plants inoculated with sterile water. Reisolation of the pathogen and identification was performed with tissue from one of the symptomatic inoculated plants. Analyses of FAMEs confirmed E. chrysanthemi as the causal agent. This is the first report of E. chrysanthemi causing a vascular disease of field-grown tomato in Florida. Reference: (1) R. S. Dickey and A. Kelman. 1988. Pages 44–59 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. N. W. Schaad, ed. American Phytopathological Society, St. Paul, MN.

Evaluation of methods for isolation of DNA for polymerase chain reaction (PCR)-based identification of pathogenic bacteria from pure cultures and water samples

2008 ◽  
Vol 58 (5) ◽  
pp. 995-999 ◽  
Author(s):  
K. Horáková ◽  
H. Mlejnková ◽  
P. Mlejnek
Keyword(s):  
Polymerase Chain Reaction ◽  
Water Samples ◽  
Pathogenic Bacteria ◽  
Pcr Amplification ◽  
Bacterial Suspension ◽  
Chain Reaction ◽  
Alkaline Lysis ◽  
Bacterial Dna ◽  
Pure Cultures ◽  
Polymerase Chain

Polymerase chain reaction (PCR) provides a reliable detection of pathogenic bacteria in water samples. However, this method can be adversely influenced by the purity of the DNA template. This is a particularly important obstacle when the bacterial DNA is directly extracted from water samples. In this study we compared the suitability of 8 different methods for isolation of bacterial DNA from pure cultures and 10 different methods for isolation of DNA from water samples. The quality of extracted DNA was assessed by PCR amplification of target sequences derived from uid (E. coli and Shigella sp.), tuf (Enterococcus sp.) and hns (Salmonella sp.). Results indicated that there are differences among the methods tested and only a few of them gave satisfactory results. The method based on alkaline lysis of bacterial suspension, which was developed in our laboratory, seemed to be efficient enough for the detection of bacteria from pure cultures. Detection of bacteria directly from water samples was more difficult. The modified method developed by Slusarenko was found as the best of the tested methods.

scholarly journals First Report of Acidovorax avenae subsp. avenae Causing Bacterial Leaf Stripe of Strelitzia nicolai

Plant Disease ◽  
2011 ◽  
Vol 95 (11) ◽  
pp. 1474-1474 ◽  
Author(s):  
T. E. Seijo ◽  
N. A. Peres
Keyword(s):  
Pathogenic Bacteria ◽  
Fatty Acid Analysis ◽  
South Florida ◽  
Metabolic Phenotype ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
First Report ◽  
Plastic Bags ◽  
Young Leaves ◽  
Symptomatic Tissue

White bird of paradise (Strelitzia nicolai Regel & K. Koch) is a commonly grown ornamental in central and south Florida. Each summer of 2004 to 2007, a reoccurring disease was observed at a commercial nursery in central Florida. Diseased plants had brown, necrotic stripes between the lateral leaf veins, which usually appeared along the midvein and spread toward the leaf edge. Lesions developed on the youngest leaves as they emerged from the central whorl. During 2004 and 2005, 20 symptomatic leaves were sampled. A white, nonfluorescent bacterium was consistently isolated from symptomatic tissue. It induced a hypersensitive response (HR) on tomato, grew at 41°C, and was identified as a Acidovorax sp. based on fatty acid analysis and as Acidovorax avenae subsp. avenae by Biolog metabolic phenotype analysis (similarity 0.76 to 0.86). A partial 16S rRNA gene sequence (1,455 bp) (Accession No. EF418616) was identical to four sequences in the NCBI (National Center for Biotechnology Information) database: one from A. avenae subsp. avenae and three from A. avenae of undetermined subspecies. To confirm pathogenicity, a bacterial suspension (O.D590 = 0.1) was applied to fill the central whorl (~0.5 to 1 ml) of potted S. nicolai. Plants were incubated for 7 to 10 days inside plastic bags at ambient temperature. Plants were inoculated individually with five strains of A. avenae subsp. avenae, four from S. nicolai, and one from corn (ATCC19860). Two to nine plants per strain were inoculated in each experiment. All strains were tested at least twice and noninoculated control plants were included. Symptoms were reproduced on the emerging leaf of 50 to 100% of inoculated plants with all five A. avenae subsp. avenae strains. No symptoms were observed on the controls. The bacteria recovered from symptomatic tissue were confirmed to be A. avenae subsp. avenae. Corn seedlings were inoculated as described above, except that entire seedlings were sprayed. Water-soaked lesions along the length of older leaf blades developed in 4 to 7 days. Only the corn strain was pathogenic (>80% of seedlings symptomatic), indicating host specificity. To our knowledge, this is the first report of A. avenae subsp. avenae infecting S. nicolai. In 1971, Wehlburg (2) described the same symptoms on orange bird of paradise (S. reginae) as being caused by a nonfluorescent Pseudomonas sp. This report likely describes the same disease since the published description is consistent with symptoms caused by A. avenae subsp. avenae. The pathogen reported by Wehlburg (2) had one polar flagellum, reduced nitrate, produced oxidase and a HR, and utilized arabinose, but not sucrose or arginine, characteristics consistent with those of A. avenae subsp. avenae (1). The only difference was A. avenae subsp. avenae has a delayed positive starch hydrolysis (1), whereas Welhburg's strain was negative. This disease occurs mainly on young leaves when plants receive daily overhead irrigation. Incidence can be as high as 40%, occasionally causing mortality, but even mild symptoms affect appearance and reduce marketability as an ornamental. References: (1) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. The American Phytopathological Society, St. Paul, MN, 2001. (2) C. Wehlburg. Plant Dis. Rep. 55:447, 1971.

scholarly journals First Report of Pectobacterium carotovorum subsp. carotovorum Causing Soft Rot of Orostachys japonica in Korea

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 989-989 ◽  
Author(s):  
W. Cheon ◽  
Y. H. Jeon
Keyword(s):  
16S Rrna ◽  
Pathogenic Bacteria ◽  
Sequence Similarity ◽  
Soft Rot ◽  
Bacterial Suspension ◽  
Pectobacterium Carotovorum ◽  
First Report ◽  
Biolog System ◽  
Carotovorum Subsp ◽  
Physiological Tests

Orostachys japonica (Maxim) A. Berger is an important traditional medicine in Korea. The extract of this plant has antioxidant activity and suppresses cancer cell proliferation (1). From summer through fall of 2012 and 2013, a high incidence (~10% to 30%) of disease outbreaks of all plants characterized by water-soaked lesions and soft rot with a stinky odor was observed in cultivated O. japonica around Uljin (36°59′35.04″N, 126°24′1.51″E), Korea. Water-soaked lesions were first observed on the stem base of plants. Subsequently, the plants collapsed, although the upper portion remained asymptomatic. Thereafter, the lesions expanded rapidly over the entire plant. To isolate potential pathogens from infected leaves, small sections (5 to 10 mm2) were excised from the margins of lesions. Ten bacteria were isolated from ten symptomatic plants. Three representative isolates from different symptomatic plants were used for identification and pathogenicity tests. Isolated bacteria were gram negative, pectolytic on crystal violet pectate agar, nonfluorescent on King's medium B, and elicited a hypersensitive response in tobacco plants. All isolates caused soft rot of potato tubers. These isolates also differed from isolates of Erwinia chrysanthemi (Ech) that they were insensitive to erythromycin and did not produce phosphatase. These isolates differed from known strains of E. carotovora subsp. atroseptica in that they did not produce reducing substances from sucrose (2). Use of the Biolog GN microplate and the Release 4.0 system identified the isolate as Pectobacterium carotovorum subsp. carotovorum with 81.2% similarity. The 16S rRNA of the isolated bacteria was amplified by PCR and sequenced as described by Weisburg et al. (3). A BLAST analysis for sequence similarity of the 16S rRNA region revealed 99% similarity with nucleotide sequences for P. carotovorum subsp. carotovorum isolates (KC790305, KC790280, JF926758, JX196705, and AB680074). The pathogenicity of three bacterial isolates was examined on three 2-year-old O. japonica plants by adding 50 μl of a bacterial suspension containing 108 CFU/ml when wounding the leaves with sterile needles. Ten control plants were inoculated with sterilized water. After inoculation, plants were maintained in a growth chamber at 25°C with relative humidity ranging from 80 to 90%. After 2 to 3 days, tissue discoloration, water-soaked lesions, and soft rot developed around the inoculation point. Severe symptoms of soft rot and darkening developed on leaves of inoculated plants within 3 to 5 days after inoculation. All controls remained healthy during these experiments. The bacterial strains re-isolated from the parts of the leaf showing the symptoms and identified as P. carotovorum subsp. carotovorum on the basis of the biochemical and physiological tests, as well as Biolog system. The results obtained for pathogenicity, Biolog analysis, and molecular data corresponded with those for P. carotovorum subsp. carotovorum. To our knowledge, this is the first report of the presence of P. carotovorum on O. japonica in Korea. References: (1) C.-H. Kim et al. Kor. J. Med. Crop Sci. 11:31, 2003. (2) N. W. Schaad et al. Erwinia Soft Rot Group. Page 56 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et al. eds. American Phytopathological Society, St. Paul. MN, 2001. (3) W. G. Weisburg et al. J. Bacteriol. 173:697, 1991.

scholarly journals First Report of Pseudomonas cichorii Causing Leaf Spot of Vegetable Sponge Gourd in China

Plant Disease ◽  
2014 ◽  
Vol 98 (1) ◽  
pp. 153-153 ◽  
Author(s):  
B. J. Li ◽  
H. L. Li ◽  
Y. X. Shi ◽  
X. W. Xie
Keyword(s):  
Leaf Spot ◽  
Pathogenic Bacteria ◽  
Identification System ◽  
Pathogenicity Test ◽  
Distilled Water ◽  
Pseudomonas Cichorii ◽  
First Report ◽  
Microbial Identification ◽  
Pectolytic Activity ◽  
Sponge Gourd

A suspect bacterial leaf spot on vegetable sponge gourd (Luffa cylindrical (L.) Roem.) was found in a commercial greenhouse in Pi County, Chengdu City, Sichuan Province, China, in February 2011. Approximately 20 to 30% of plants were affected, causing serious economic loss. Symptoms occurred only on seedlings and consisted of water-soaked, irregularly shaped, black lesions on the surface and margins of cotyledons. A bacterium was consistently isolated on nutrient agar from diseased leaf tissues that had been surface disinfected in 70% ethyl alcohol for 30 s. The bacterium produced small gray colonies with smooth margins, was gram negative, fluoresced on King's B medium, and showed pectolytic activity when inoculated on potato slices. The partial sequences of 16SrRNA gene (1,377 bp) of the bacterium (GenBank Accession No. KC762217), amplified by using universal PCR primers 16SF (5′-AGAGTTTGATCCTGGCTCAG-3′) and 16SR (5′-GGTTACCTTGTTACGACTT-3′), shared 100% similarity with that of Pseudomonas cichorii (GenBank Accession No. HM190228). The vegetable sponge gourd isolate was also identified by using the Biolog Microbial Identification System (version 4.2, Biolog Inc., Hayward, CA) as P. cichorii with the following characteristics (1): negative for arginine dihydrolase, gelatin liquefaction, and N2 production. Positive reactions were obtained in tests for catalase, oxidase, potato rot, utilization of melibiose, and mannitol. Tests were negative for utilization of sucrose, trehalose, D-arabinose, raffinose, cellobiose, and rhamnose. A pathogenicity test was conducted on 4-week-old vegetable sponge gourd plants by spray-inoculation with 108 CFU/ml sterile distilled water on the leaves of 15 vegetable sponge gourd plants and by needle puncture on the stems of 15 other plants with P. cichorii, respectively. Control plants were misted with sterile distilled water or punctured on the stem with a clean needle. Plants were placed in a greenhouse maintained at 28 ± 2°C with relative humidity of 80 to 85%. Symptoms, the same as seen on the original diseased plants, developed after 7 to 10 days on inoculated plants. Control plants remained healthy. The bacterium was readily re-isolated from inoculated plants and identified as P. cichorii using P. cichorii-specific primer hrpla/hrp2a (1). To our knowledge, this is the first report of P. cichorii causing disease on commercially grown vegetable sponge gourd in China. This new finding will provide the basis for developing resources for diagnostics and management, including screening varieties for resistance. References: (1) S. Mazurier et al. J. FEMS Microbiol. Ecol. 49:455, 2004. (2) N. W. Schaad et al., eds. Laboratory Guide for Identification of Plant Pathogenic Bacteria, 3rd ed. APS Press, St. Paul, MN, 2001.

scholarly journals First Report of Fire Blight Caused by Erwinia amylovora on Meadowsweet (Spirea prunifolia) in Turkey

Plant Disease ◽  
2014 ◽  
Vol 98 (1) ◽  
pp. 153-153 ◽  
Author(s):  
K. K. Bastas ◽  
F. Sahin
Keyword(s):  
Pathogenic Bacteria ◽  
Fire Blight ◽  
Erwinia Amylovora ◽  
Natural Infection ◽  
Hypodermic Needle ◽  
Identification System ◽  
Bacterial Strains ◽  
First Report ◽  
Molecular Tests ◽  
Initial Symptoms

Fire blight, caused by Erwinia amylovora (Burr.) Winslow et al., affects plants in the Rosaceae family, which includes trees and shrubs in orchards, nurseries, and landscape plantations. During the springs and summers of 2008 and 2010, dying branches, necrotic leaves attached to shoots, and blighted twigs of meadowsweet (Spirea prunifolia) were observed at three different locations of landscape areas in Konya Province, Turkey. Disease incidence was approximately 1% on the plants during the surveys. Initial symptoms of reddish to brownish streaks on the shoots of infected plants were observed in spring. Nine representative bacterial strains were isolated from the lesions on shoots of seven meadowsweet plants on nutrient sucrose agar (NSA) medium and identified as E. amylovora on basis of biochemical, physiological (2,3) and molecular tests (1). Bacteria were gram-negative, rod shaped, aerobic, fermentative, yellow-orange on Miller and Scroth medium (2), positive for levan formation and acetoin production, did not grow at 36°C, positive for gelatin hydrolysis, and negative for esculin hydrolysis, indole, urease, catalase, oxidase, arginine dehydrolase, reduction of nitrate, acid production from lactose, and inositol. All strains were hypersensitive response-positive on tobacco (Nicotiana tabacum var. White Burley) plants. All strains were identified as E. amylovora using the species-specific primers set, A/B (1), by PCR assay, and by fatty acid methyl ester (FAME) profiles determined by Sherlock Microbial Identification System software (TSBA 6 v. 6.00; Microbial ID, Newark, DE) with similarity indices ranging from of 79 to 99%. Pathogenicity was tested by injecting of petioles and actively growing three shoot tips of 2-year-old S. prunifolia seedlings cv. number 29 using a 0.46 mm-diameter hypodermic needle with bacterial suspensions containing 108 CFU mL–1 in sterile distilled water (SDW) Plants were inoculated with each of the nine bacterial strains and two references strains, Ea29 and NCPPB 2791 (Selcuk University, Department of Plant Protection, Konya, Turkey). Symptoms resembling those associated with natural infection appeared on the inoculated plants 7 days after inoculation. Plants inoculated with SDW served as a negative control treatment, and no symptoms were observed on these plants. All tests were repeated three times with the same results. Bacterial re-isolations were attempted from the control plants as well as shoots and leaves inoculated with the two reference strains and the nine bacteria identified as E. amylovora. Bacteria isolated from inoculated plants were identified as E. amylovora using the biochemical, physiological, and molecular tests described above, but this bacterium was not isolated from the control plants. Phytosanitary measures must be taken to avoid spread of the pathogen to ornamentals in new landscape areas in Turkey. This report is important because infected Spirea spp. can be a potential inoculum source for other rosaceous ornamentals. To our knowledge, this is the first report of the occurrence of fire blight on meadowsweet in Turkey. References: (1) S. Bereswill et al. Appl. Environ. Microbiol. 58:3522, 1992. (2) A. L. Jones and K. Geider. Laboratory Guide for Identification of Plant Pathogenic Bacteria, pp. 40-55. American Phytopathological Society, St. Paul, MN, 2001. (3) R. A. Lelliott and D. E. Stead. Methods for Diagnosis of Bacterial Diseases of Plants (Methods in Plant Pathology). Oxford, UK, 1987.

scholarly journals First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States

Plant Disease ◽  
2013 ◽  
Vol 97 (10) ◽  
pp. 1375-1375 ◽  
Author(s):  
B. Dutta ◽  
R. D. Gitaitis ◽  
F. H. Sanders ◽  
C. Booth ◽  
S. Smith ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Leaf Spot ◽  
Pathogenic Bacteria ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Pcr Assay ◽  
First Report ◽  
The 16S Rrna Gene

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds. References: (1) N. W. Schaad et al. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, third edition. APS Press. St. Paul, MN, 2001. (2) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (3) Leu et al. Plant Pathol. Bull. 19:137, 2010. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

scholarly journals First Report of Bacterial Canker of Walnut Caused by Brenneria nigrifluens in France

Plant Disease ◽  
2004 ◽  
Vol 88 (2) ◽  
pp. 220-220 ◽  
Author(s):  
M. Ménard ◽  
F. Delort ◽  
A. Baudry ◽  
M. Le Saux
Keyword(s):  
Pathogenic Bacteria ◽  
Reference Strain ◽  
Juglans Regia ◽  
Culture Collection ◽  
First Report ◽  
Plant Pathogenic Bacteria ◽  
Fermentative Metabolism ◽  
Physiological And Biochemical Characteristics ◽  
Reference Strains ◽  
Physiological And Biochemical

Since the summer of 2000, vertical oozing cankers have been observed on trunks and branches of Persian walnut trees (Juglans regia). Cvs. Fernor, Chandler, Mayette, and Hartley were the most frequently affected, but cvs. Lara and Franquette could also be affected. Brenneria nigrifluens (synonym Erwinia nigrifluens) (3) was isolated from diseased trees from 13 orchards and nurseries in southwestern (Aquitaine, Périgord, Charentes, and Quercy), southeastern (Grenoble areas), and western (near Angers) France. Cankers were observed on trunks and branches where brown-to-black exudates staining the bark appeared mainly in the summer. Isolations were performed primarily from exudates but also from infected tissues by using King's medium B. Colonies similar in appearance to Brenneria nigrifluens (1) were purified and characterized. Gram reaction, Kovac's oxidase, oxidative-fermentative metabolism, and urease activity were assayed for all isolates. API Biotype 100 kits (BioMérieux, Marcy l'Etoile, France) were used as recommended, except that incubations were at 28°C for 4 days. When compared with the reference strain (French Collection of Plant Pathogenic Bacteria (CFBP) 4998T = National Collection of Plant Pathogenic Bacteria (NCPPB) 564T = American Type Culture Collection (ATCC) 13028T) from California, 14 isolated strains were identified as B. nigrifluens on the basis of physiological and biochemical characteristics. These 14 strains were deposited in the CFBP under Accession Nos. 6746 to 6759. Pathogenicity of three selected strains (CFBP 6746, 6747, and 6758) was confirmed by inoculating branches of 7-year-old walnut trees with 108 CFU of each isolate introduced in wounds (2). The reference strain (CFBP 4998T) and water were similarly inoculated as controls. Two and five months later, necrotic lesions were observed in the inner bark and dark lines were observed in internal wood, but no external cankers were observed on any trees inoculated with the local and reference strains. B. nigrifluens was reisolated from the dark lines in internal wood up to approximately 10 cm from the inoculation site. To our knowledge, this is the first report of this bacterium in France. References: (1) L. Hauben et al. Syst. Appl. Microbiol. 21:384, 1998. (2) M. Ridé and S. Ridé. Proc. Int. Conf. Plant Pathogenic Bacteria, 4th, 2:957, 1978. (3) E. E. Wilson et al. Phytopathology 47:669, 1957.

Sign in / Sign up

Export Citation Format

Share Document