scholarly journals First Report of Plum Pox Potyvirus in Ontario, Canada

Plant Disease ◽  
2001 ◽  
Vol 85 (1) ◽  
pp. 97-97 ◽  
Author(s):  
D. Thompson ◽  
M. McCann ◽  
M. MacLeod ◽  
D. Lye ◽  
M. Green ◽  
...  
Keyword(s):  
Western Blot ◽  
Prunus Persica ◽  
Rflp Analysis ◽  
Fruit Trees ◽  
Conclusive Evidence ◽  
Pcr Analysis ◽  
Rt Pcr ◽  
Protein Subunit ◽  
Specific Primers ◽  
Serious Disease

Plum pox potyvirus (PPV) causes plum pox (sharka) disease, which is considered the most serious disease of stone fruits including peach, plum, nectarine, and apricot (2). The disease may cause losses as high as 80 to 100% of some crops (2). A survey was initiated in the Niagara region of Ontario, Canada, after it was reported that PPV was detected in Pennsylvania (1). The initial survey focused on Prunus material imported into Canada from the Pennsylvania region. Where imported trees could be identified, every tree was sampled. In cases where the imported trees were growing in mixed blocks with plants from other sources, 25% of the trees were sampled and tested as composites of four trees. PPV was detected in three symptomless Fantasia nectarine (Prunus persica var. nectarina) trees by triple-antibody sandwich (TAS) ELISA using the REAL Durviz kit (Valencia, Spain), which contains the universal PPV monoclonal 5B. PPV infection was confirmed by western blot analyses (a PPV polyclonal antibody and PPV 5B monoclonal were used as primary antibodies), reverse transcription polymerase chain reaction (RT-PCR), and TC/RT-PCR. In western blot analyses, the coat protein subunit sizes of the Canadian PPV isolates were estimated at 32 kDa based on electrophoretic mobility in 12% SDS-PAGE. RFLP analysis of the 243-bp fragment amplified using PPV specific primers P1 and P2 (4) indicated the presence of RsaI and AluI enzyme restriction sites, which is characteristic of PPV D strains. In RT-PCR analysis using D and M specific primers (3), only the D specific primers amplified a fragment 198 bp in size. This data provided conclusive evidence that the PPV isolates detected in Canada were PPV D, similar to the strain detected in Pennsylvania. The survey is continuing and is being expanded to determine the extent of spread and the exact distribution of the virus. References: (1) L. Levy et al. Phytopathology (Abstr.) 90:46, 2000. (2) M. Nemeth. Virus, Mycoplasma, and Rickettsia Diseases of Fruit Trees. Akademiai Kiado, Budapest. (3) A. Olmos et al. J. Virol. Methods 68:127–137, 1997. (4) T. Wetzel et al. J. Virol. Methods 33:355–365, 1991.

scholarly journals First Report of Pear blister canker viroid, Peach latent mosaic viroid, and Hop stunt viroid Infecting Fruit Trees in Tunisia

Plant Disease ◽  
2004 ◽  
Vol 88 (10) ◽  
pp. 1164-1164 ◽  
Author(s):  
I. Fekih Hassen ◽  
J. Kummert ◽  
S. Marbot ◽  
H. Fakhfakh ◽  
M. Marrakchi ◽  
...  
Keyword(s):  
Plant Pathogens ◽  
Prunus Persica ◽  
Fruit Trees ◽  
Pcr Analysis ◽  
Economic Damage ◽  
Rt Pcr ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
Italian Isolate ◽  
Pear Trees

Viroids of fruit trees are plant pathogens distributed worldwide and can cause severe losses and economic damage to crops. A survey of fruit trees was carried out in 17 orchards in the northern and Sahel regions of Tunisia. Samples were collected in field trees of peach (Prunus persica L), pear (Pyrus communis L), and almond (Prunus dulcis Mill.) that showed symptoms potentially caused by viroids (leaf mosaic in peach, blister canker in pear, and necrotic leaves in almond). The investigation was conducted during May, September, and December 2003 to screen for the presence of Pear blister canker viroid (PBCVd) on pear, Peach latent mosaic viroid (PLMVd) on peach, and Hop stunt viroid (HSVd) on the three plant species in naturally infected field trees. The detection method was based on one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays using a Titan kit (Roche Diagnostics, Penzberg, Germany). DNA amplification was obtained by using previously reported primer pairs for PLMVd and HSVd (1,4). For PBCVd, forward primer 5′ GTCTGAAGCCTGGGCGCTGG 3′ and reverse primer 5′ CCTTCGT CGACGACGAGCCGAG 3′ were designed using an available sequence (3). Positive controls included isolate D168 of PLMVd (obtained from Dr. B. Pradier, Station de Quarantaine des Ligneux, Lempdes, France) and propagated in GF 305 rootstock and HSVd (provided by Dr. R. Flores, Instituto de Biologia Molecular y cellular de Plantas, Valencia, Spain) propagated in cucumber. The method described by Grasseau et al. (2), with some modifications, was used to prepare the samples for RT-PCR. RT-PCR analysis of nucleic acid preparations from leaves and bark of peach, pear, and almond showed that PLMVd occurred in the northern and Sahel regions of Tunisia. Of 37 peach trees tested, 12 were found infected with PLMVd. Two pear trees among 73 tested were infected with PBCVd. HSVd was detected in 2 of 11 almond, 1 of 37 peach, and 7 of 72 pear trees tested. One pear tree infected with HSVd was also infected with PBCVd. Symptoms observed in fruit trees were not consistently associated with the presence of viroids. Nucleotide sequence analyses of cloned amplification products obtained using the PBCVd, PLMVd, and HSVd primers confirmed a size of 315, 330, and 300 nt, respectively, and revealed a sequence similar to sequence variants from other isolates previously characterized for each viroid. PBCVd was 99% identical with the P47A isolate variant 9 (GenBank Accession No. Y18043); PLMVd shared 85 to 96% identity with the PC-C32 Italian isolate of PLMVd from peach (GenBank Accession No. AJ550905), and HSVd shared 99 to 100% identity with the HSVd from dapple plum fruit (GenBank Accession No. AY460202). To our knowledge, our investigation reports for the first time, the occurrence of PLMVd, PBCVd, and HSVd infecting fruit trees in Tunisia, stressing the need for a certification program to aid in prevention and spread of fruit tree viroids in this country. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) N. Grasseau et al. Infos-Ctifl (Centre Technique Interprofessionel des Fruits et Légumes). 143:26,1998. (3) C. Hernandez et al. J. Gen. Virol 73:2503, 1992. (4) S. Loreti et al. EPPO Bull. 29:433, 1999.

Identification of a gene cluster for cell-surface genes of the SRS superfamily inNeospora caninumand characterization of the novelSRS9gene

Parasitology ◽  
2011 ◽  
Vol 138 (14) ◽  
pp. 1832-1842 ◽  
Author(s):  
V. RISCO-CASTILLO ◽  
V. MARUGÁN-HERNÁNDEZ ◽  
A. FERNÁNDEZ-GARCÍA ◽  
A. AGUADO-MARTÍNEZ ◽  
E. JIMÉNEZ-RUIZ ◽  
...  
Keyword(s):  
Western Blot ◽  
Gene Cluster ◽  
Neospora Caninum ◽  
Pcr Analysis ◽  
Rt Pcr ◽  
Specific Expression ◽  
Initial Characterization ◽  
Hydrophilic Region

SUMMARYHere we present the detection of a gene cluster forNeospora caninumsurface genes, similar to theToxoplasma gondiiSRS9 locus, and the cloning and characterization of the NcSRS9gene. PCR genome walking, using NcBSR4gene as a framework, allows the identification, upstream NcBSR4, of 2 sequences homologous to theSRS5and the Ubiquinol-cytochrome C reductase genes and, downstream NcBSR4, of an ORF of 1191 bp coding for a 396-amino acid polypeptide with 59% similarity to the TgSRS9 antigen. A putative 39-residue signal peptide was found at the NH2-terminus followed by a hydrophilic region, and a potential site for a glycosylphosphatidylinositol anchor at the COOH-terminus. A recombinant NcSRS9 protein was produced and was recognized on a Western blot by a low proportion of sera from a panel of naturally infected cows and calves. In addition, Western blot analysis using polyclonal anti-rNcSRS9 revealed stage-specific expression of NcSRS9 in bradyzoites but not in tachyzoites, and immunohistochemistry on brain from a congenitally infected calf showed NcSRS9 recognition in bradyzoites contained in tissue cysts. However, bradyzoite-specific expression of NcSRS9 could not be proven by immunofluorescence on bradyzoites obtainedin vitroand RT-PCR analysis showed no significant variations of NcSRS9transcripts duringin vitrotachyzoite-bradyzoite switch, probably due to incomplete maturity ofin vitrobradyzoites. Initial characterization of NcSRS9 in this study may lead to further studies for a better understanding ofN. caninumpersistence.

scholarly journals Cloning and Characterization of Five MADS Box Genes in Peach (Prunus persica)

HortScience ◽  
2005 ◽  
Vol 40 (4) ◽  
pp. 1146D-1146
Author(s):  
Yong Xu ◽  
Fan Wu ◽  
Rong-Cai Ma
Keyword(s):  
Expression Pattern ◽  
Prunus Persica ◽  
Pcr Analysis ◽  
Mads Box ◽  
Mads Box Genes ◽  
Rt Pcr ◽  
Coding Regions ◽  
Development Processes ◽  
Flower And Fruit Development ◽  
Inner Parts

MADS box genes regulate most of the development processes in plants. Studying peach MADS box genes will provide insights into its flower and fruit development. Five MADS box cDNAs with complete coding regions were cloned in this study. PpMADS2 cDNA is 1116-bp long. RT-PCR analysis indicated that PpMADS2 is expressed in leaf, flower, fruit, and nutlet. PpMAD4 cDNA is 824-bp long, which is the homologue of Agamous. RT-PCR analysis indicated that PpMADS4 is expressed in the two inner parts of flower, fruit, and nutlet; and was absent in leaf and the two outer parts of the flower. This expression pattern is similar to that of Agamous gene in A. thaliana. PpMADS4 could promote the flowering process in A. thaliana tested by genetic transformation. PpMADS5 cDNA is 873-bp long, which is the homologue of SEP3. RT-PCR analysis indicated that PpMADS5 is expressed in the three inner parts of flower, fruit, and nutlet; and was absent in leaf and sepal, similar to the expression pattern of SEP3 gene in Arabidopsis. PpMAD6 cDNA is 1037-bp long, which is the homologue of FUL. RT-PCR analysis indicated that PpMADS6 is expressed in leaf, sepal, petal, carpel, and fruit; and was absent in stamen and nutlet. PpMAD7 cDNA is 1147-bp long, which is the homologue of SEP1. RT-PCR analysis indicated that PpMADS7 is expressed in the four parts of flower and fruit, and was absent in leaf, stamen, and nutlet. Furthermore, two SSRs were identified in the 5' UTR in the two MADS box genes, PpMADS2 and PpMADS7, respectively. The SSR in PpMAD2 was more polymorphic than that in PpMADS7 in the 39 Prunus accessions collected.

scholarly journals First Report of Natural Infection of Zucchini by Tomato Chlorosis Virus and Cucurbit Chlorotic Yellows Virus in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Xiaohui Sun ◽  
Ning Qiao ◽  
Xianping Zhang ◽  
Lianyi Zang ◽  
Dan Zhao ◽  
...  
Keyword(s):  
Natural Infection ◽  
Pcr Analysis ◽  
Control Group ◽  
Rt Pcr ◽  
Degenerate Primers ◽  
Specific Primers ◽  
First Report ◽  
Sequence Identity ◽  
Tomato Chlorosis Virus ◽  
Cucurbit Chlorotic Yellows Virus

Zucchini (Cucurbita pepo) is an extensively cultivated and important economic cucurbit crop in China. In September 2018 and 2019, interveinal chlorosis and yellowing symptoms, suspected to be caused by either tomato chlorosis virus (ToCV; genus Crinivirus) or cucurbit chlorotic yellows virus (CCYV; genus Crinivirus) or by their co-infection, were observed on zucchini plants in a greenhouse in Shandong Province, China. The incidence of the disease in the greenhouse was 20–30%. To identify the causal agent(s) of the disease, leaf samples from 66 zucchini plants were collected in 14 greenhouses in the cities of Shouguang (n = 12), Dezhou (n = 36), Qingzhou (n = 12), and Zibo (n = 6) in Shandong. Four whitefly (Bemisia tabaci) samples and four symptomatic tomato samples were also collected from these sampling sites (one each for each site) because numerous whiteflies were observed in the sampling greenhouses and ToCV was previously reported in greenhouse tomato plants from these regions (Zhao et al. 2014). To determine whether the symptoms were associated with Crinivirus infection, reverse transcription polymerase chain reaction (RT-PCR) using Crinivirus-specific degenerate primers (CriniRdRp251F/CriniRdRp995R) (Wintermantel and Hladky 2010) was performed first on total RNA extracted using the TRIzol protocol (Jordon-Thaden et al. 2015). Thereafter, the RNA samples were subjected to RT-PCR with ToCV- or CCYV-specific primers (Sun et al. 2016; Gan et al. 2019). Of the 66 zucchini samples, 54 tested positive by the degenerate crinivirus primer pair; and among them, 10 tested positive for ToCV only, 40 positive for CCYV only, and 4 positive for both viruses. Interestingly, while both viruses were detected in all B. tabaci samples, only ToCV was detected in the tomato samples (n = 4). To confirm the identity of the viruses, the amplicons of ToCV (four samples each of tomato, B. tabaci and zucchini) and CCYV (four samples each of B. tabaci and zucchini) were Sanger sequenced (Tsingke Biotechnology Co., Ltd., Beijing, China) after cloning into pMD18-T vectors (Takara, Shiga, Japan). BLASTn analysis demonstrated that all sequences were identical to their respective amplicons. The ToCV sequences (GenBank accession numbers: tomato, MN944406; B. tabaci, MN944404; zucchini, MN944405) shared 100% sequence identity with isolates from Beijing (KT751008, KC887999, KR184675, and KP335046), Hebei (KP217196), and Shandong (KX900412). The CCYV sequence (GenBank accession number MT396249) shared 99.9% sequence identity with isolates China (JN126046, JQ904629, KP896506, KX118632, KY400633, and MK568545), Greece (LT716000, LT716001, LT716002, LT716005, and LT716006), and Cyprus (LT992909, LT992910, and LT992911). To assess the transmissibility of ToCV and CCYV, virus-free B. tabaci (n = 30) were placed in ToCV or CCYV-infected zucchini plants for one day for virus acquisition. Thereafter, the whiteflies were transferred into virus-free zucchini seedlings (cv. ‘Zaoqingyidai’, 4-leaf-stage, n = 6 for each of the control, ToCV and CCYV treatment) for one day. Three weeks after inoculation, all plants that were inoculated with either ToCV or CCYV displayed same symptoms as those observed in the greenhouses, whereas plants in the control group remained symptom free. RT-PCR analysis using ToCV- and CCYV-specific primers confirmed the infection of the plants with the respective virus, whereas control plants were free from the viruses. CCYV has been previously reported on zucchini in Algeria (Kheireddine et al. 2020), Iran (LR585225), and Cyprus (LT992910). To our knowledge, this is the first report of CCYV infection in zucchini in China, and moreover the first report of ToCV infection in zucchini in the world. Clearly, stringent management is needed to minimize the losses caused by these viruses in greenhouse operations in the region.

scholarly journals Human immature germ cells and ejaculated spermatozoa contain aromatase and oestrogen receptors

2004 ◽  
Vol 32 (1) ◽  
pp. 279-289 ◽  
Author(s):  
S Lambard ◽  
I Galeraud-Denis ◽  
PT Saunders ◽  
S Carreau
Keyword(s):  
Western Blot ◽  
Germ Cells ◽  
Cell Function ◽  
Oestrogen Receptors ◽  
Rt Pcr ◽  
Specific Primers ◽  
Short Forms ◽  
Human Male ◽  
Cytochrome P450 Aromatase ◽  
Pcr Products

It is now well established that oestrogens play a part in germ cell function. These hormones are synthesised by the cytochrome P450 aromatase (P450 arom) and act via two kinds of receptor (ERalpha and ERbeta). Although the presence of aromatase and oestrogen receptors in mammalian testis is now well documented, the localisation of these proteins in human germ cells is not yet clear. The primary purpose of the current study was to look for the expression of aromatase and oestrogen receptors in human germ cells. Human immature germ cells were collected from semen samples with an excess of rounds cells (>20%) and purified spermatozoa were obtained after sedimentation on a discontinuous PureSperm gradient. Expression of aromatase and oestrogen receptors was determined by RT-PCR with specific primers, and by Western blot using monoclonal antibodies. RT-PCR products for aromatase, ERalpha and ERbeta were amplified from total RNA isolated from human germ cells and spermatozoa. We identified an ERalpha isoform variant that lacks exon 4 in human germ cells and visualised P450 arom as a single band of 49 kDa in germ cells, as we have already reported for human ejaculated spermatozoa. By Western blot, we identified two proteins for ERbeta at approximately 50 and approximately 60 kDa, which could correspond to the long and short forms of ERbeta formed from the use of alternative start sites. In human ejaculated spermatozoa, ERbeta protein was not detected, even though we could amplify mRNA. Using Western blot analysis and a monoclonal antibody specific for ERalpha, we detected two proteins in human immature germ cells: one of the expected size (66 kDa) and a second one of 46 kDa. In mature spermatozoa, only the 46 kDa band was observed and we speculate it may be related to the ERalpha isoform lacking exon I. In conclusion, we have identified P450 arom and ER proteins (full-length and variant) in human germ cells. Further studies are now required to elucidate the mechanism of action of oestrogens on human male germ cells, in terms of both genomic and 'non-genomic' pathways.

scholarly journals Resistance to Plum Pox Virus (Dideron Isolate RB3.30) in a Group of California Almonds and Transfer of Resistance to Peach

2004 ◽  
Vol 129 (4) ◽  
pp. 544-548 ◽  
Author(s):  
P. Martínez-Gómez ◽  
M. Rubio ◽  
F. Dicenta ◽  
T.M. Gradziel
Keyword(s):  
Prunus Persica ◽  
Prunus Avium ◽  
Sour Cherry ◽  
Prunus Armeniaca ◽  
Pcr Analysis ◽  
Plum Pox Virus ◽  
Rt Pcr ◽  
Resistance Transfer ◽  
High Level ◽  
Peach Rootstocks

Sharka [(plum pox virus (PPV)] mainly affects Prunus species, including apricot (Prunus armeniaca L.), peach (Prunus persica L.), plum (Prunus salicina Lindl., Prunus domestica L.), and, to a lesser degree, sweet (Prunus avium L.) and sour cherry (Prunus cerasus L.). Level of resistance to a Dideron isolate of PPV in seven California almond [P. dulcis (Miller) D.A. Webb], five processing peach cultivars, and two peach rootstocks was evaluated. In addition, almond and peach selections resulting from interspecific almond × peach hybridization and subsequent gene introgression were tested. Evaluations were conducted in controlled facilities after grafting the test genotypes onto inoculated GF305 peach rootstocks. Leaves were evaluated for PPV symptoms during three consecutive cycles of growth. ELISA-DASI and RT-PCR analysis were also employed to verify the presence or absence of PPV. Peach cultivars and rootstocks showed sharka symptoms and were ELISA-DASI or RT-PCR positive for some growth cycles, indicating their susceptibility to PPV. Almond cultivars and almond × peach hybrids did not show symptoms and were ELISA-DASI and RT-PCR negative, demonstrating resistance to PPV. Two (almond × peach) F2 selections as well as two of three backcrossed peach selections also showed a resistant behavior against the PPV-D isolate. Results demonstrate a high level of resistance in almond and indicate potential for PPV resistance transfer to commercial peach cultivars.

scholarly journals Identification and Characterization of Avian Retroviruses in Chicken Embryo-Derived Yellow Fever Vaccines: Investigation of Transmission to Vaccine Recipients

2003 ◽  
Vol 77 (2) ◽  
pp. 1105-1111 ◽  
Author(s):  
Althaf I. Hussain ◽  
Jeffrey A. Johnson ◽  
Marcos da Silva Freire ◽  
Walid Heneine
Keyword(s):  
Western Blot ◽  
Yellow Fever ◽  
Pcr Analysis ◽  
Rt Pcr ◽  
Serum Samples ◽  
Rna Sequences ◽  
Western Blot Assay ◽  
Specific Pcr ◽  
Show Evidence

ABSTRACT All currently licensed yellow fever (YF) vaccines are propagated in chicken embryos. Recent studies of chick cell-derived measles and mumps vaccines show evidence of two types of retrovirus particles, the endogenous avian retrovirus (EAV) and the endogenous avian leukosis virus (ALV-E), which originate from the chicken embryonic fibroblast substrates. In this study, we investigated substrate-derived avian retrovirus contamination in YF vaccines currently produced by three manufacturers (YF-vax [Connaught Laboratories], Stamaril [Aventis], and YF-FIOCRUZ [FIOCRUZ-Bio-Manguinhos]). Testing for reverse transcriptase (RT) activity was not possible because of assay inhibition. However, Western blot analysis of virus pellets with anti-ALV RT antiserum detected three distinct RT proteins in all vaccines, indicating that more than one source is responsible for the RTs present in the vaccines. PCR analysis of both chicken substrate DNA and particle-associated RNA from the YF vaccines showed no evidence of the long terminal repeat sequences of exogenous ALV subgroups A to D in any of the vaccines. In contrast, both ALV-E and EAV particle-associated RNA were detected at equivalent titers in each vaccine by RT-PCR. Quantitative real-time RT-PCR revealed 61,600, 348,000, and 1,665,000 ALV-E RNA copies per dose of Stamaril, YF-FIOCRUZ, and YF-vax vaccines, respectively. ev locus-specific PCR testing of the vaccine-associated chicken substrate DNA was positive both for the nondefective ev-12 locus in two vaccines and for the defective ev-1 locus in all three vaccines. Both intact and ev-1 pol sequences were also identified in the particle-associated RNA. To investigate the risks of transmission, serum samples from 43 YF vaccine recipients were studied. None of the samples were seropositive by an ALV-E-based Western blot assay or had detectable EAV or ALV-E RNA sequences by RT-PCR. YF vaccines produced by the three manufacturers all have particles containing EAV genomes and various levels of defective or nondefective ALV-E sequences. The absence of evidence of infection with ALV-E or EAV in 43 YF vaccine recipients suggests low risks for transmission of these viruses, further supporting the safety of these vaccines.

scholarly journals Detection of Phytoplasmas in Declining Pears in Southern Australia

Plant Disease ◽  
1997 ◽  
Vol 81 (3) ◽  
pp. 254-258 ◽  
Author(s):  
B. Schneider ◽  
K. S. Gibb
Keyword(s):  
Nested Pcr ◽  
Fragment Length Polymorphism ◽  
Rflp Analysis ◽  
Restriction Enzymes ◽  
Pcr Analysis ◽  
Pcr Assay ◽  
Specific Primers ◽  
Pear Tree ◽  
Pear Trees ◽  
Polymerase Chain

Forty-nine pear tree samples collected in Victoria, most of them showing decline symptoms, were tested by polymerase chain reaction (PCR) analysis to detect phytoplasmas. Two universal phytoplasma-specific primer pairs, fP1/rP7 and fU5/rU3, were tested, but only fU5/rU3 amplified the phytoplasma DNA adequately. Nested PCR with universal and group-specific primers, however, proved more effective. Thirty pear trees reacted positively in a nested PCR assay. Restriction fragment length polymorphism (RFLP) analysis with the restriction enzymes MseI and AluI of the PCR fragment amplified with the primer pair fU5/rU3 revealed patterns identical to those from the sweet potato little leaf phytoplasma. This is the first report of a phytoplasma in pear in Australia.

scholarly journals Peach latent mosaic viroid Detected for the First Time on Almond Trees in Tunisia

Plant Disease ◽  
2005 ◽  
Vol 89 (11) ◽  
pp. 1244-1244 ◽  
Author(s):  
I. Fekih Hassen ◽  
S. Roussel ◽  
J. Kummert ◽  
H. Fakhfakh ◽  
M. Marrakchi ◽  
...  
Keyword(s):  
Fruit Trees ◽  
Mediterranean Area ◽  
Prunus Dulcis ◽  
Pcr Analysis ◽  
Rt Pcr ◽  
New Host ◽  
Hop Stunt Viroid ◽  
Almond Trees ◽  
Plant Pathol ◽  
Peach Trees

Almond (Prunus dulcis Mill) is an important crop in countries of the Mediterranean area. Until now, among viroids, only Hop stunt viroid (HSVd) is known to infect cultivated almond trees (2). In 2004, a survey of almond trees was carried out in orchards in different regions of Tunisia, a major producing and exporting country of almond. Symptoms such as mosaic and necrotic lesions, potentially caused by the Peach latent mosaic viroid (PLMVd), were observed on leaves of cultivated almond trees. Since PLMVd was recently detected in peach and pear trees in Tunisia (4), the presence of this viroid in almond trees was studied. The detection method on the basis of one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays was previously described and validated for the detection of this viroid in fruit trees (4). Amplification products were obtained by using previously reported primer pairs of PLMVd (1). Positive controls included RNA preparations of twigs of PLMVd-infected GF 305 peach seedlings. These materials, provided by B. Pradier (Station de Quarantaine des Ligneux, Lempdes, France), were positive as revealed by chip budding on peach seedling indicator plants grown under greenhouse conditions. RT-PCR analysis of nucleic acid preparations from leaves of almond showed specific amplification products with the expected size of 337 bp for two almond trees among 17 trees tested. Nucleotide sequence analyses of cloned amplification products obtained with the PLMVd primers confirmed a size of 337 bp and revealed a sequence similar to sequences from other PLMVd isolates previously characterized. The sequences shared 94 to 98% identity with the reference isolates of PLMVd from peach (EMBL Accession No. M83545, AF170511, AF170514, and AY685181). The two infected almond trees are proximal to each other and peach trees infected with PLMVd. This suggests that one tree may have served as a source of inoculum for the other through agronomic practices such as pruning or the aphid Myzus percicae (3). Alternatively, PLMVd may have originated in an unknown host and was then transmitted to almond trees. Our investigation shows that almond is a new host for PLMVd. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) M. C. Cañizares et al. Eur. J. Plant Pathol. 105:553, 1999. (3) J. C. Desvignes et al. Phytoma 444:70, 1992. (4) I. Fekih Hassen et al. Plant Dis. 88:1164, 2004.

Sign in / Sign up

Export Citation Format

Share Document