scholarly journals Peach latent mosaic viroid Detected for the First Time on Almond Trees in Tunisia

Plant Disease ◽  
2005 ◽  
Vol 89 (11) ◽  
pp. 1244-1244 ◽  
Author(s):  
I. Fekih Hassen ◽  
S. Roussel ◽  
J. Kummert ◽  
H. Fakhfakh ◽  
M. Marrakchi ◽  
...  
Keyword(s):  
Fruit Trees ◽  
Mediterranean Area ◽  
Prunus Dulcis ◽  
Pcr Analysis ◽  
Rt Pcr ◽  
New Host ◽  
Hop Stunt Viroid ◽  
Almond Trees ◽  
Plant Pathol ◽  
Peach Trees

Almond (Prunus dulcis Mill) is an important crop in countries of the Mediterranean area. Until now, among viroids, only Hop stunt viroid (HSVd) is known to infect cultivated almond trees (2). In 2004, a survey of almond trees was carried out in orchards in different regions of Tunisia, a major producing and exporting country of almond. Symptoms such as mosaic and necrotic lesions, potentially caused by the Peach latent mosaic viroid (PLMVd), were observed on leaves of cultivated almond trees. Since PLMVd was recently detected in peach and pear trees in Tunisia (4), the presence of this viroid in almond trees was studied. The detection method on the basis of one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays was previously described and validated for the detection of this viroid in fruit trees (4). Amplification products were obtained by using previously reported primer pairs of PLMVd (1). Positive controls included RNA preparations of twigs of PLMVd-infected GF 305 peach seedlings. These materials, provided by B. Pradier (Station de Quarantaine des Ligneux, Lempdes, France), were positive as revealed by chip budding on peach seedling indicator plants grown under greenhouse conditions. RT-PCR analysis of nucleic acid preparations from leaves of almond showed specific amplification products with the expected size of 337 bp for two almond trees among 17 trees tested. Nucleotide sequence analyses of cloned amplification products obtained with the PLMVd primers confirmed a size of 337 bp and revealed a sequence similar to sequences from other PLMVd isolates previously characterized. The sequences shared 94 to 98% identity with the reference isolates of PLMVd from peach (EMBL Accession No. M83545, AF170511, AF170514, and AY685181). The two infected almond trees are proximal to each other and peach trees infected with PLMVd. This suggests that one tree may have served as a source of inoculum for the other through agronomic practices such as pruning or the aphid Myzus percicae (3). Alternatively, PLMVd may have originated in an unknown host and was then transmitted to almond trees. Our investigation shows that almond is a new host for PLMVd. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) M. C. Cañizares et al. Eur. J. Plant Pathol. 105:553, 1999. (3) J. C. Desvignes et al. Phytoma 444:70, 1992. (4) I. Fekih Hassen et al. Plant Dis. 88:1164, 2004.

scholarly journals First Report of Pear blister canker viroid, Peach latent mosaic viroid, and Hop stunt viroid Infecting Fruit Trees in Tunisia

Plant Disease ◽  
2004 ◽  
Vol 88 (10) ◽  
pp. 1164-1164 ◽  
Author(s):  
I. Fekih Hassen ◽  
J. Kummert ◽  
S. Marbot ◽  
H. Fakhfakh ◽  
M. Marrakchi ◽  
...  
Keyword(s):  
Plant Pathogens ◽  
Prunus Persica ◽  
Fruit Trees ◽  
Pcr Analysis ◽  
Economic Damage ◽  
Rt Pcr ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
Italian Isolate ◽  
Pear Trees

Viroids of fruit trees are plant pathogens distributed worldwide and can cause severe losses and economic damage to crops. A survey of fruit trees was carried out in 17 orchards in the northern and Sahel regions of Tunisia. Samples were collected in field trees of peach (Prunus persica L), pear (Pyrus communis L), and almond (Prunus dulcis Mill.) that showed symptoms potentially caused by viroids (leaf mosaic in peach, blister canker in pear, and necrotic leaves in almond). The investigation was conducted during May, September, and December 2003 to screen for the presence of Pear blister canker viroid (PBCVd) on pear, Peach latent mosaic viroid (PLMVd) on peach, and Hop stunt viroid (HSVd) on the three plant species in naturally infected field trees. The detection method was based on one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays using a Titan kit (Roche Diagnostics, Penzberg, Germany). DNA amplification was obtained by using previously reported primer pairs for PLMVd and HSVd (1,4). For PBCVd, forward primer 5′ GTCTGAAGCCTGGGCGCTGG 3′ and reverse primer 5′ CCTTCGT CGACGACGAGCCGAG 3′ were designed using an available sequence (3). Positive controls included isolate D168 of PLMVd (obtained from Dr. B. Pradier, Station de Quarantaine des Ligneux, Lempdes, France) and propagated in GF 305 rootstock and HSVd (provided by Dr. R. Flores, Instituto de Biologia Molecular y cellular de Plantas, Valencia, Spain) propagated in cucumber. The method described by Grasseau et al. (2), with some modifications, was used to prepare the samples for RT-PCR. RT-PCR analysis of nucleic acid preparations from leaves and bark of peach, pear, and almond showed that PLMVd occurred in the northern and Sahel regions of Tunisia. Of 37 peach trees tested, 12 were found infected with PLMVd. Two pear trees among 73 tested were infected with PBCVd. HSVd was detected in 2 of 11 almond, 1 of 37 peach, and 7 of 72 pear trees tested. One pear tree infected with HSVd was also infected with PBCVd. Symptoms observed in fruit trees were not consistently associated with the presence of viroids. Nucleotide sequence analyses of cloned amplification products obtained using the PBCVd, PLMVd, and HSVd primers confirmed a size of 315, 330, and 300 nt, respectively, and revealed a sequence similar to sequence variants from other isolates previously characterized for each viroid. PBCVd was 99% identical with the P47A isolate variant 9 (GenBank Accession No. Y18043); PLMVd shared 85 to 96% identity with the PC-C32 Italian isolate of PLMVd from peach (GenBank Accession No. AJ550905), and HSVd shared 99 to 100% identity with the HSVd from dapple plum fruit (GenBank Accession No. AY460202). To our knowledge, our investigation reports for the first time, the occurrence of PLMVd, PBCVd, and HSVd infecting fruit trees in Tunisia, stressing the need for a certification program to aid in prevention and spread of fruit tree viroids in this country. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) N. Grasseau et al. Infos-Ctifl (Centre Technique Interprofessionel des Fruits et Légumes). 143:26,1998. (3) C. Hernandez et al. J. Gen. Virol 73:2503, 1992. (4) S. Loreti et al. EPPO Bull. 29:433, 1999.

scholarly journals Asma ve Narlardan İzole Edilen Grapevine leafroll-associated virus-1 İzolatlarının Kısmi Sekanslarının Karşılaştırmalı Genomik Analizleri

2017 ◽  
Vol 5 (10) ◽  
pp. 1136
Author(s):  
Eminur Elçi ◽  
Mona Gazel ◽  
Kadriye Çağlayan
Keyword(s):  
Movement Protein ◽  
Economic Importance ◽  
Pcr Analysis ◽  
Yield Losses ◽  
Grapevine Virus ◽  
Rt Pcr ◽  
Virus Diseases ◽  
New Host ◽  
Pcr Products ◽  
Leafroll Disease

Grapevine leafroll disease is one of the worldwide diseases with economic importance among grapevine virus diseases since many years. Grapevine leafroll-associated virus-1 (GLRaV-1) is the first identified virus related to leafroll viruses which are belonged to Closterovirus and Ampelovirus. Leafroll symptoms are typical for this virus and it causes yield losses on grapevines. Pomegranates are also economically important trees and up to now; only a few viral agents were identified in this plant species and in the last years, it was reported that pomegranate could be as a new host of GLRaV-1. Aim of this study was to compare GLRaV-1 isolates from grapevine and pomegranates. For this purpose, dsRNA and total RNA isolations were done and RT-PCR analysis were conducted by using primers of movement protein (p24) and heatshock70 protein (HSP70h) genes of GLRaV-1 and PCR products were cloned and sequenced in the collected samples from Hatay and Niğde in 2014. -PCR analysis was done by using degenerated primer heatshock 70 homolog protein of Closterovirus. Blast and phylogenetic analysis were performed with the obtained partial nucleotid sequences. At the end of this study, it was ensured that GLRaV-1 isolates isolated from the pomegranate, which is thought to be a new host, were analysed comparatively with the grapevine isolates and high similarities were detected between isolates.

scholarly journals Identification of viruses infecting six plum cultivars in Korea by RNA-sequencing

PeerJ ◽  
2020 ◽  
Vol 8 ◽  
pp. e9588 ◽  
Author(s):  
Yeonhwa Jo ◽  
Hoseong Choi ◽  
Sen Lian ◽  
Jin Kyong Cho ◽  
Hyosub Chu ◽  
...  
Keyword(s):  
Rna Sequencing ◽  
De Novo ◽  
Reference Database ◽  
Rna Seq ◽  
Rt Pcr ◽  
Virus Identification ◽  
Hop Stunt Viroid ◽  
Chlorotic Leaf ◽  
Peach Trees ◽  
Next Generation Sequencing Ngs

Background Plums are a kind of stone fruit, a category that includes peaches, cherries, apricots, and almonds. In Korea, Japanese plum trees are usually cultivated as they best suit the climate. To date, there have been few studies in Korea on viruses infecting plum trees compared to those infecting peach trees. Methods To identify viruses and viroids infecting plum trees, we collected leaf samples from six different plum cultivars and subjected them to RNA-sequencing (RNA-seq). Six different plum transcriptomes were de novo assembled using the Trinity assembler followed by BLAST searching against a viral reference database. Results We identified hop stunt viroid (HSVd) and six viruses, including apple chlorotic leaf spot virus (ACLSV), little cherry virus-1 (LChV-1), peach virus D (PeVD), peach leaf pitting-associated virus (PLPaV), plum bark necrosis stem pitting-associated virus (PBNSPaV), and prunus necrotic ringspot virus (PNRSV), from six plum cultivars by RNA-seq. RT-PCR confirmed the infection of HSVd and three viruses—ACLSV, PBNSPaV, and PNRSV—in plum trees. However, RT-PCR demonstrated that plum trees in this study were not infected by LChV-1, PeVD, or PLPaV. It is likely that the three viruses LChV-1, PeVD, and PLPaV as identified by RNA-seq were contaminants from other peach libraries caused by index misassignment, which suggests that careful confirmation by other methods should be carried out in next-generation sequencing (NGS)-based virus identification. Taken together, we identified a viroid and three viruses infecting plum trees in Korea.

scholarly journals Gynura japonica: A new host of Apple stem grooving virus and Chrysanthemum virus B in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Yuchao Lai ◽  
Xinyang Wu ◽  
Lanqing Lv ◽  
Jiajia Weng ◽  
Kelei Han ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
Fruit Trees ◽  
Complete Sequence ◽  
Zhejiang Province ◽  
Chinese Isolate ◽  
Rt Pcr ◽  
Leaf Sample ◽  
New Host ◽  
Biological Studies ◽  
Blastn Analysis

Gynura japonica (Thunb.) Juel [Asteraceae; syn: G. segetum (Lour.) Merr] is an important perennial medicinal herb used in China for topical treatment of trauma injuries (Lin et al. 2003). It grows naturally in the southern provinces of China and is also sometimes cultivated. During 2018-2020, wild G. japonica plants exhibiting chlorotic spots and mosaic symptoms were observed in Zhejiang province, China. To identify the possible causal agents of the disease, a single symptomatic leaf sample was collected in August 2019 and sent to Zhejiang Academy of Agricultural Sciences (Hangzhou, China) for next generation sequencing (NGS). Total RNAs extracted with TRIzol (Invitrogen, Carlsbad, USA) were subjected to high throughput sequencing on the Illumina NovaSeq 6000 platform with PE150bp and data analysis was performed by CLC Genomic Workbench 11 with default parameters (QIAGEN, Hilden, Germany). A total of 37,314,080 paired-end reads were obtained, and 11,785 contigs (961 to 10,964 bp) were generated and compared with sequences in GenBank using BLASTn or BLASTx. Of the total of 12 viral-related contigs obtained, one with a length of 6,442 nt mapped to the genomic RNA of ASGV (MN495979), seven contigs with lengths ranging from 1,034 to 2,901 nt mapped to Chrysanthemum virus B (CVB), and four mapped to broad bean wilt virus 2 (BBWV2), a virus which is known to infect G. procumbens (Kwak et al. 2017). To further confirm the presence of ASGV and CVB, primers were designed and the complete nucleotide sequences of both viruses were amplified from the original NGS sample using reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) according to the manufacturer’s instructions (Tiosbio, Beijing, China). BLASTn analysis revealed that the complete 6,451 nt sequence of ASGV (GenBank accession No. MW259059) shared the highest identity (81.2%) with a Chinese isolate of ASGV from citrus (MN495979). The two isolates grouped with another Chinese isolate (from pear) in phylogenetic analysis. The predicted coat protein of the virus had the highest nt identity of 93.7% (96.2% amino acid sequence identity) with that of the Chinese ASGV isolate XY from apple (KX686100). The complete genomes of two distinct molecular variants of CVB (both 8,987 nt in length) were also obtained from this sample (GenBank accession Nos. MW269552, MW269553). They shared 86.8% nt identity with each other and had 81.1% and 82.1% identity to the only known complete sequence of CVB from chrysanthemum (AB245142). Ten additional wild G. japonica plants with mosaic symptoms were collected randomly during 2019-2020 from Hangzhou (n=6) and Ningbo (n=4) in Zhejiang province and tested by RT-PCR with specific primer pairs to detect BBWV2, ASGV and CVB. RT-PCR and subsequent sequencing revealed that these three viruses were present in all the samples tested, indicating that co-infection of G. japonica by ASGV, CVB and BBWV2 is common. CVB mainly infects chrysanthemum (Singh et al. 2012), while ASGV is known as a pathogen of various fruit trees especially in the family Rosaceae, although there are recent reports that it can also infect some plants in Gramineae, Asparagaceae and Nelumbonaceae (Bhardwaj et al. 2017; Chen et al. 2019; He et al. 2019). Our results provide the first report that Gynura is a natural host of CVB and ASGV. Further surveys and biological studies are underway to evaluate the importance of Gynura as a virus reservoir for epidemics among the various hosts.

scholarly journals First Report of Peach latent mosaic viroid and Hop stunt viroid Infecting Peach Trees in the Czech Republic

Plant Disease ◽  
2003 ◽  
Vol 87 (12) ◽  
pp. 1537-1537 ◽  
Author(s):  
M. Hassan ◽  
P. Rysanek ◽  
F. Di Serio
Keyword(s):  
Czech Republic ◽  
Stone Fruit ◽  
Reference Sequence ◽  
Mixed Infections ◽  
Rt Pcr ◽  
The Czech Republic ◽  
First Report ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
Peach Trees

Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are known to naturally infect stone fruits, but their contemporary presence in peach trees has been reported only recently (3). During a field validation of detection methods developed for sanitary screening of propagation material, PLMVd and HSVd, alone or in mixed infections, were detected in peach trees grown in the trial orchard of the Czech University of Agriculture in Prague. Leaf samples were collected in September 2002 from symptomless trees of peach cultivars imported from the United States (cvs. Sunhaven, Redhaven, Fairhaven, Cresthaven, Dixired, Halehaven, and NJC 103), Slovakia (cv. Luna), and a tree of Chinese wild peach, Prunus davidiana, and analyzed by reverse transcription-polymerase chain reaction (RT-PCR). PLMVd cDNA was amplified as previously reported (2) or by using two sets of primer pairs designed to amplify partial cDNAs, one reverse primer R: GTTTCTACGG CGGTACCTGA, complementary to the nucleotide positions 204 to 223 and forward primers F1: CGTATCTCAACGCCTCATCA, homologous to the positions 109 to 128, and F2: CTGCAGTTCCCGCTAGAAAG, homologous to the positions 15 to 34 of PLMVd reference sequence (2). The two pairs using the R sequence produced the expected size PCR products of 115 and 209 bp, respectively. RT-PCR for HSVd detection was performed as reported (1). The same total RNA preparations were also analyzed by molecular hybridization with nonisotopic riboprobes specific for each viroid. With minor exceptions, both methods gave similar results. Of 66 tested trees, 5 were infected with PLMVd, 46 were infected with PLMVd and HSVd, and 15 were free of both viroids. Viroid free plants included cvs. Luna, Cresthaven, Dixired, and Halehaven and the species P. davidiana. The high number of infections by both viroids was unexpected because mixed infections are generally rare (3). Most likely, mixed infections occurred during field manipulations and propagation of infected materials. To our knowledge, this is the first report of PLMVd in the Czech Republic. Although further investigations are needed to ascertain the spread of stone fruit viroids in the Czech Republic, our results also report an unusually high incidence of mixed infections of peach trees in this country. These results stress the need for a certification program to help control the spread of stone fruit viroids in the Czech Republic. References: (1) K. Amari et al. J. Gen. Virol. 82:953, 2001. (2) A. M. Shamloul et al. Acta Hort. 386:522, 1995. (3) M. Tessitori et al. Plant Dis. 86:329, 2001.

scholarly journals First Report of Peach latent mosaic viroid in Peach Trees in Montenegro

Plant Disease ◽  
2012 ◽  
Vol 96 (1) ◽  
pp. 150-150 ◽  
Author(s):  
I. Mavric Pleško ◽  
M. Viršcek Marn ◽  
Z. Miladinovic ◽  
J. Zindovic
Keyword(s):  
Prunus Persica ◽  
Stone Fruit ◽  
Plum Pox Virus ◽  
Rt Pcr ◽  
First Report ◽  
Fruit Species ◽  
Hop Stunt Viroid ◽  
Viroid Infection ◽  
Fruit Samples ◽  
Peach Trees

Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are known to infect stone fruit species worldwide. The viroid infection can be latent or induce a variety of disease symptoms. Stone fruit samples were collected in Montenegro for a Plum pox virus (PPV) survey in 2007. Thirteen samples infected with PPV, taken from 12-year-old peach trees (Prunus persica (L.) Batsch, cv. Elegant Lady) in the area of Cemovsko field, were tested for the presence of PLMVd and HSVd by reverse transcription (RT)-PCR. Mild or severe mosaic, chlorotic rings, and fruit deformations were observed on some trees. Total RNA was extracted from all samples with a RNeasy Plant Mini Kit (Qiagen, Chatsworth, CA) and RT-PCR was performed. Samples were tested for HSVd and PLMVd infection using primer pairs RF-43/RF-44 for PLMVd (1) and VP-19/VP-20 for HSVd (2). Amplification products of approximately 348 bp were obtained from nine samples with PLMVd primers. Amplification products from seven samples were successfully cloned into pGEM-T Easy Vector (Promega, Madison, WI) and used for transformation of Escherichia coli. At least four clones of each sample were sequenced. Obtained sequences were 337 and 338 nucleotides long and shared 90.3 to 100% identity. Consensus sequences of each sample were deposited in GenBank under Accession Nos. JF927892–JF927898. They showed 92.6 to 97.9% identity among each other, 94 to 98% identity with the PLMVd isolate G sequence (Accession No. EF591868) and 91.8 to 94.4% identity with PLMVd sequence M83545. HSVd was not detected in analyzed samples. PLMVd infections were found on peach trees in an area where approximately 40% of the peach production is located. Therefore, PLMVd infections can pose a threat to peach production in Montenegro. To our knowledge this is the first report of PLMVd infection of peach in Montenegro. References: (1) S. Ambrós et al. J. Virol. 72:7397, 1998. (2) S. A. Kofalvi et al. J. Gen. Virol. 78:3177, 1997.

scholarly journals First Report of Plum Pox Potyvirus in Ontario, Canada

Plant Disease ◽  
2001 ◽  
Vol 85 (1) ◽  
pp. 97-97 ◽  
Author(s):  
D. Thompson ◽  
M. McCann ◽  
M. MacLeod ◽  
D. Lye ◽  
M. Green ◽  
...  
Keyword(s):  
Western Blot ◽  
Prunus Persica ◽  
Rflp Analysis ◽  
Fruit Trees ◽  
Conclusive Evidence ◽  
Pcr Analysis ◽  
Rt Pcr ◽  
Protein Subunit ◽  
Specific Primers ◽  
Serious Disease

Plum pox potyvirus (PPV) causes plum pox (sharka) disease, which is considered the most serious disease of stone fruits including peach, plum, nectarine, and apricot (2). The disease may cause losses as high as 80 to 100% of some crops (2). A survey was initiated in the Niagara region of Ontario, Canada, after it was reported that PPV was detected in Pennsylvania (1). The initial survey focused on Prunus material imported into Canada from the Pennsylvania region. Where imported trees could be identified, every tree was sampled. In cases where the imported trees were growing in mixed blocks with plants from other sources, 25% of the trees were sampled and tested as composites of four trees. PPV was detected in three symptomless Fantasia nectarine (Prunus persica var. nectarina) trees by triple-antibody sandwich (TAS) ELISA using the REAL Durviz kit (Valencia, Spain), which contains the universal PPV monoclonal 5B. PPV infection was confirmed by western blot analyses (a PPV polyclonal antibody and PPV 5B monoclonal were used as primary antibodies), reverse transcription polymerase chain reaction (RT-PCR), and TC/RT-PCR. In western blot analyses, the coat protein subunit sizes of the Canadian PPV isolates were estimated at 32 kDa based on electrophoretic mobility in 12% SDS-PAGE. RFLP analysis of the 243-bp fragment amplified using PPV specific primers P1 and P2 (4) indicated the presence of RsaI and AluI enzyme restriction sites, which is characteristic of PPV D strains. In RT-PCR analysis using D and M specific primers (3), only the D specific primers amplified a fragment 198 bp in size. This data provided conclusive evidence that the PPV isolates detected in Canada were PPV D, similar to the strain detected in Pennsylvania. The survey is continuing and is being expanded to determine the extent of spread and the exact distribution of the virus. References: (1) L. Levy et al. Phytopathology (Abstr.) 90:46, 2000. (2) M. Nemeth. Virus, Mycoplasma, and Rickettsia Diseases of Fruit Trees. Akademiai Kiado, Budapest. (3) A. Olmos et al. J. Virol. Methods 68:127–137, 1997. (4) T. Wetzel et al. J. Virol. Methods 33:355–365, 1991.

A Study of the Life-history and Control ofCerambyx dux, Fald., a Pest of certain Stone-fruit Trees in Palestine

1932 ◽  
Vol 23 (2) ◽  
pp. 251-256 ◽  
Author(s):  
Philipp Jolles
Keyword(s):  
Coastal Plain ◽  
Fruit Trees ◽  
Control Measures ◽  
Food Plants ◽  
Jordan Valley ◽  
Healthy Tree ◽  
Hill Country ◽  
Almond Trees ◽  
Peach Trees ◽  
The Hill

A long-horned beetle,Cerambyx dux, Fald., is a very serious pest of apricots, peaches, and grafted and wild almonds in Palestine. Its ravages are most probably not confined to these trees and further investigations will undoubtedly enlarge the already important list of food-plants. In localities around Jerusalemsuch as Beit-Jala, Artas, Bethlehem, El Maliha, and Ein Karim (approximate altitude 2,600 feet above sea-level), this pest has been allowed to establish itself over a long period of time and to such an extent that, if immediate and rigid control measures are not undertaken by the growers, apricot and peach trees will, sooner or later, disappear from these localities. These fruit trees can be cultivated without irrigation, which is of great advantage in Palestine, where water is scarce; the fruit fetches good prices both in the local markets and also in Egypt. Their cultivation is therefore of vital importance,especially to the population of the hill country, where conditions of life are difficult and every kind of loss is accentuated. In Jersualem, where almonds, apricots and peaches are planted in household-gardens, not a single healthy tree can be found, and many of them have already succumbed to the attacks of this beetle. In the coastal plain the writer has found this insect in almond trees at Haifa and in apricot and almond trees in villages north of Acre. No records are available of its presence in the coastal plain south of Haifa or in the Jordan Valley.

scholarly journals First Report of Lettuce chlorosis virus Infecting Bean in Spain

Plant Disease ◽  
2014 ◽  
Vol 98 (6) ◽  
pp. 857-857 ◽  
Author(s):  
M. L. Ruiz ◽  
A. Simón ◽  
M. C. García ◽  
D. Janssen
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequences ◽  
Green Bean ◽  
Pcr Analysis ◽  
Economic Damage ◽  
Rt Pcr ◽  
First Report ◽  
Bean Plants ◽  
Field Samples ◽  
Plant Pathol

In September 2011, symptoms typically associated with Bean yellow disorder virus (BYDV) such as intervenal mottling and yellowing on middle and lower leaves combined with brittleness were observed in green bean (Phaseolus vulgaris L.) produced in commercial greenhouses from Granada and Almeria provinces, Spain. The affected plants were all observed in greenhouses infested with Bemisia tabaci. However, collected samples tested negative for BYDV using a specific RT-PCR test (4). Electrophoretic double stranded (ds) RNA analysis from symptomatic plants revealed the presence of a slightly diffused high molecular weight dsRNA band of ~8.5 kb, similar to that produced by the crinivirus Lettuce cholorosis virus (LCV) (3). The dsRNA was purified and used for cDNA synthesis and PCR by uneven PCR (1) using primers derived from LCV genome sequences (GenBank FJ380118 and FJ380119). Amplified DNA fragments were cloned in pGEM-T Easy vector (Promega, Madison, WI) and sequenced. Two different sequences were obtained and the nucleotide and amino acid sequences were analysed using BLAST. Both showed the highest identity with different regions of the LCV genome. The sequence of the first product had 92% nucleotide and 98% amino acid sequence identity with the polyprotein (Orf1a) homologue from RNA1 of LCV (KC602376). The sequence from the second product (KC602375) revealed the highest nucleotide and amino acid identity with the heat shock protein 70 homologue from LCV (90% and 99%, respectively). Based on these sequences, two sets of specific primers were designed (LCVSP 3-forward 5′-AGTGACACAAGTTGGAGCCGAC-3′, LCVSP 4-low 5′-CAGTGTTTGTTGGATATCTGGGG-3′) and (LCVSP 1-forward 5′-TGTTGGAAGGTGGTGAGGTC-3′, LCVSP 2-low 5′-CAGAGACGAGTCATACGTACC-3′) and each produced amplicons of the expected size (463 and 434 nt, respectively) when used in RT-PCR from the collected field samples. Subsequent field surveys from 2012 to 2013 in commercial bean greenhouses confirmed the presence of LCV that apparently had replaced BYDV. Groups of 15 to 20 adults of B. tabaci introduced in clip cages were fed for 24 h on 12 green bean plants infected with LCV and later transferred to six seedlings of bean and six of lettuce (Lactuca sativa L.). After 2 and 4 weeks, total RNA from the lettuce and bean plants was extracted using Plant RNA Reagent (Invitrogen) and subjected to RT-PCR analysis with the LCV-SP 1-2 and LCVSP 3-4 primer sets. All six plants of bean and none of lettuce showed positive for LCV-SP and a repeat experiment revealed identical results. We also seeded and produced lettuce plants within a bean greenhouse that was naturally infected with the virus and infested with B tabaci whiteflies. Under these conditions, we observed that whiteflies migrated freely from the infected bean plants to lettuce. After 4 and 6 weeks, lettuce plants neither produced symptoms nor tested positive for LCV by RT-PCR. This result confirms the existence of a new putative strain of LCV, Lettuce chlorosis virus-SP, unable to infect lettuce plants. To date, natural infections of LCV have not been reported outside California, where the virus failed to infect P. vulgaris (2). This is also the first report of LCV in Spain that infects members of the family Leguminosae. Green bean in southeast Spain was produced in ~9,000 ha of greenhouses until the introduction of BYDV a decade ago, causing considerable economic damage. The recent finding of LCV-SP has urged the local phytosanitary inspections to include this virus in lab tests and to emphasize disease management strategies based on whitefly control. References: (1) X. Chen and R. Wu. Gene 185:195, 1997. (2) J. Duffus et al. Eur. J. Plant Pathol. 102:591, 1996. (3) N. M. Salem et al. Virology 390:45, 2009. (4) E. Segundo et al. Plant Pathol. 53:517, 2004.

Sign in / Sign up

Export Citation Format

Share Document