First Report of Natural Infection of Zucchini by Tomato Chlorosis Virus and Cucurbit Chlorotic Yellows Virus in China

Zucchini (Cucurbita pepo) is an extensively cultivated and important economic cucurbit crop in China. In September 2018 and 2019, interveinal chlorosis and yellowing symptoms, suspected to be caused by either tomato chlorosis virus (ToCV; genus Crinivirus) or cucurbit chlorotic yellows virus (CCYV; genus Crinivirus) or by their co-infection, were observed on zucchini plants in a greenhouse in Shandong Province, China. The incidence of the disease in the greenhouse was 20–30%. To identify the causal agent(s) of the disease, leaf samples from 66 zucchini plants were collected in 14 greenhouses in the cities of Shouguang (n = 12), Dezhou (n = 36), Qingzhou (n = 12), and Zibo (n = 6) in Shandong. Four whitefly (Bemisia tabaci) samples and four symptomatic tomato samples were also collected from these sampling sites (one each for each site) because numerous whiteflies were observed in the sampling greenhouses and ToCV was previously reported in greenhouse tomato plants from these regions (Zhao et al. 2014). To determine whether the symptoms were associated with Crinivirus infection, reverse transcription polymerase chain reaction (RT-PCR) using Crinivirus-specific degenerate primers (CriniRdRp251F/CriniRdRp995R) (Wintermantel and Hladky 2010) was performed first on total RNA extracted using the TRIzol protocol (Jordon-Thaden et al. 2015). Thereafter, the RNA samples were subjected to RT-PCR with ToCV- or CCYV-specific primers (Sun et al. 2016; Gan et al. 2019). Of the 66 zucchini samples, 54 tested positive by the degenerate crinivirus primer pair; and among them, 10 tested positive for ToCV only, 40 positive for CCYV only, and 4 positive for both viruses. Interestingly, while both viruses were detected in all B. tabaci samples, only ToCV was detected in the tomato samples (n = 4). To confirm the identity of the viruses, the amplicons of ToCV (four samples each of tomato, B. tabaci and zucchini) and CCYV (four samples each of B. tabaci and zucchini) were Sanger sequenced (Tsingke Biotechnology Co., Ltd., Beijing, China) after cloning into pMD18-T vectors (Takara, Shiga, Japan). BLASTn analysis demonstrated that all sequences were identical to their respective amplicons. The ToCV sequences (GenBank accession numbers: tomato, MN944406; B. tabaci, MN944404; zucchini, MN944405) shared 100% sequence identity with isolates from Beijing (KT751008, KC887999, KR184675, and KP335046), Hebei (KP217196), and Shandong (KX900412). The CCYV sequence (GenBank accession number MT396249) shared 99.9% sequence identity with isolates China (JN126046, JQ904629, KP896506, KX118632, KY400633, and MK568545), Greece (LT716000, LT716001, LT716002, LT716005, and LT716006), and Cyprus (LT992909, LT992910, and LT992911). To assess the transmissibility of ToCV and CCYV, virus-free B. tabaci (n = 30) were placed in ToCV or CCYV-infected zucchini plants for one day for virus acquisition. Thereafter, the whiteflies were transferred into virus-free zucchini seedlings (cv. ‘Zaoqingyidai’, 4-leaf-stage, n = 6 for each of the control, ToCV and CCYV treatment) for one day. Three weeks after inoculation, all plants that were inoculated with either ToCV or CCYV displayed same symptoms as those observed in the greenhouses, whereas plants in the control group remained symptom free. RT-PCR analysis using ToCV- and CCYV-specific primers confirmed the infection of the plants with the respective virus, whereas control plants were free from the viruses. CCYV has been previously reported on zucchini in Algeria (Kheireddine et al. 2020), Iran (LR585225), and Cyprus (LT992910). To our knowledge, this is the first report of CCYV infection in zucchini in China, and moreover the first report of ToCV infection in zucchini in the world. Clearly, stringent management is needed to minimize the losses caused by these viruses in greenhouse operations in the region.

Download Full-text

First Report of Tomato chlorosis virus in Tomato in Costa Rica

Plant Disease ◽

10.1094/pdis-93-9-0970a ◽

2009 ◽

Vol 93 (9) ◽

pp. 970-970 ◽

Cited By ~ 4

Author(s):

R. M. Castro ◽

E. Hernandez ◽

F. Mora ◽

P. Ramirez ◽

R. W. Hammond

Keyword(s):

Costa Rica ◽

Sequence Analysis ◽

Nucleotide Sequence Analysis ◽

Rt Pcr ◽

Greenhouse Whitefly ◽

Specific Primers ◽

First Report ◽

Sequence Identity ◽

Pcr Products ◽

Tomato Chlorosis Virus

In early 2007, severe yellowing and chlorosis symptoms were observed in field-grown and greenhouse tomato (Solanum lycopersicum L.) plants in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies, including the greenhouse whitefly Trialeurodes vaporariorum (Westwood), were observed in the fields and on symptomatic plants. Total RNA was extracted from silica gel-dried tomato leaf tissue of 47 representative samples (all were from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription (RT)-PCR reactions were performed separately with each of the four primer sets with the Titan One-Tube RT-PCR Kit (Roche Diagnostics Corp., Chicago IL). Specific primers used for the detection of the criniviruses, Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV), were primer pair ToCV-p22-F (5′-ATGGATCTCACTGGTTGCTTGC-3′) and ToCV-p22-R (5′-TTATATATCACTCCCAAAGAAA-3′) specific for the p22 gene of ToCV RNA1 (1), primer pair ToCVCPmF (5′-TCTGGCAGTACCCGTTCGTGA-3′) and ToCVCPmR (5′-TACCGGCAGTCGTCCCATACC-3′) designed to be specific for the ToCV CPm gene of ToCV RNA2 (GenBank Accession No. AY903448) (2), primer pair ToCVHSP70F (5′-GGCGGTACTTTCGACACTTCTT-3′) and ToCVHSP70R (5′-ATTAACGCGCAAAACCATCTG-3′) designed to be specific for the Hsp70 gene of RNA2 of ToCV (GenBank Accession No. EU284744) (1), and primer pair TICV-CP-F and TICV-CP-R specific for the coat protein gene of TICV (1). Amplified DNA fragments (582 bp) were obtained from nine samples, four from the greenhouse and five from the open field, with the ToCV-p22 specific primers and were cloned into the pCRII TOPO cloning vector (Invitrogen, Carlsbad, CA). Nucleotide sequence analysis of all purified RT-PCR products verified their identity as ToCV, sharing 99.5 to 100% sequence identity among themselves and 96% to 98% sequence identity with previously reported ToCV p22 sequences from Florida (Accession No. AY903447), Spain (Accession No. DQ983480), and Greece (Accession No. EU284745). The presence of ToCV in the samples was confirmed by additional amplification and sequence analysis of the CPm (449-bp fragment) and Hsp70 (420-bp fragment) genes of ToCV RNA2 and sharing 98 to 99% sequence homology to Accession Nos. AY903448 and EU284774, respectively. One representative sequence of the p22 gene of the Costa Rican isolate was deposited at GenBank (Accession No. FJ809714). No PCR products were obtained using either the TICV-specific primers nor from healthy tomato tissue. The ToCV-positive samples were collected from a region in the Central Valley around Cartago, Costa Rica. To our knowledge, this is the first report of ToCV in Costa Rica. The economic impact on tomato has not yet been determined. Studies are underway to determine the incidence of ToCV in Costa Rica field-grown and greenhouse tomatoes. References: (1) A. R. A. Kataya et al. Plant Pathol. 57:819, 2008. (2) W. M. Wintermantel et al. Arch. Virol. 150:2287, 2005.

Download Full-text

First report of cucurbit chlorotic yellows virus (CCYV) infecting pumpkin in India

Plant Disease ◽

10.1094/pdis-07-21-1473-pdn ◽

2021 ◽

Author(s):

Ashwini Kumar ◽

Bichhinna Maitri Rout ◽

Shakshi Choudhary ◽

Amish K. Sureja ◽

V. K. Baranwal ◽

...

Keyword(s):

Amino Acid ◽

Amino Acid Sequence ◽

Amino Acid Sequence Identity ◽

Rt Pcr ◽

Specific Primers ◽

First Report ◽

Virus Particles ◽

Sequence Identity ◽

Cp Gene ◽

Cucurbit Chlorotic Yellows Virus

Pumpkin (Cucurbita moschata), a member of the family Cucurbitaceae, is widely cultivated throughout the world including India. During August 2020 to January 2021, stunted pumpkin plants (cv. Pusa Vishwas), showing chlorotic patches, mosaic, and vein banding on leaves (e-Xtra Fig.1), were observed in the experimental fields of the Indian Agricultural Research Institute (IARI), New Delhi, India. Leaf-dip electron microscopy (EM) of the symptomatic plants (12 out of 37 samples) revealed the association of long flexuous virus particles measuring 650-950nm×10-12nm, suggestive of the presence of either crinivirus or potyvirus or both. Subsequently, a reverse transcription-polymerase chain reaction (RT-PCR) was performed on RNA extracted from the samples that had long flexuous virus particles using generic primers for criniviruses i.e. CriniPol-F: GCY CCS AGR GTK AAT GA and CriniPol-R: ACC TTG RGA YTT RTC AAA targeting partial RNA-dependent RNA polymerase coding region (Martin et al. 2003) and specific primers for papaya ringspot virus (PRSV) targeting a part of 3’ NIb and full coat protein (CP) gene (Basavaraj et al., 2019) separately. All tested samples were positive for both crinivirus and PRSV as expected size amplicons were obtained, accounting for about 32% prevalence. As PRSV is a well-studied virus infecting cucurbits, further work was not carried on this virus and only the RT-PCR amplicon indicative of crinivirus (~515 bp) was cloned into the pGEM-T easy cloning vector (Promega, Madison, WI) and sequenced for further confirmation of the virus presence. The obtained sequence (GenBank accession No MZ318672) shared up to 90% nucleotide and 100% amino acid sequence identity with the corresponding genomic region of a cucurbit chlorotic yellows virus (CCYV) isolate from Greece (LT841297). To confirm the identity of the crinivirus species present in the same pumpkin sample, the CP gene (753bp) was amplified and sequenced using CCYV CP gene-specific primers CP-F (5’-ATG GAG AAG ACY GAC AAT AAA CAA AAT GAT GA-3’) and CP-R (5’-TTA TTT ACT ACA ACC TCC CGG TGC CAA C-3’) (modified from Kheireddine et al. 2020). Sequence analysis using the BioEdit tool (version 2.0) revealed that the crinivirus present in pumpkin (KC577202) shared 95 to 100% nucleotide (and 98 to 100% amino acid) sequence identity with the corresponding gene sequences of CCYV isolates originating from cucurbitaceous hosts from diverse locations. The presence of CCYV was further validated by a whitefly transmission-based bioassay followed by RT-PCR confirmation. The bioassay was performed by the whitefly species Bemisia tabaci (biotype Asia II7) using the acquisition access period and inoculation access period of 24 hours each. Six whitefly individuals per plant were used for inoculating ten pumpkin plants (cv. Pusa Vishwas) at the first true leaf stage grown in pots containing soilrite as the medium in insect-proof cages. All ten plants inoculated using whiteflies exhibited chlorosis and stunting symptoms 12-15 days post-inoculation (e-Xtra Fig.2) and were found positive for CCYV in RT-PCR assay performed using CCYV CP gene-specific primers. Though CCYV had been reported worldwide (Tzanetakis et al. 2013), its occurrence had not been reported from India. Results of the present study confirm the infection of pumpkin plants by CCYV and constitute the first report of its presence in India. Further, there is a need to investigate the extent of its spread and impact of this virus on the production of cucurbitaceous crops in the country.

Download Full-text

First Report of Tomato chlorosis virus Infecting Tomato in Single and Mixed Infections with Tomato yellow leaf curl virus in Cuba

Plant Disease ◽

10.1094/pdis-92-5-0836c ◽

2008 ◽

Vol 92 (5) ◽

pp. 836-836 ◽

Cited By ~ 9

Author(s):

Y. Martínez-Zubiaur ◽

E. Fiallo-Olivé ◽

J. Carrillo-Tripp ◽

R. Rivera-Bustamante

Keyword(s):

Tomato Yellow Leaf ◽

Pcr Analysis ◽

Mixed Infections ◽

Yellow Leaf ◽

Rt Pcr ◽

Specific Primers ◽

First Report ◽

Tomato Chlorosis Virus ◽

Leaf Curl Virus ◽

Leaf Curl

Whitefly-transmitted viruses have caused severe losses in tomato crops (Solanum lycopersicum) in Cuba. In 2006 and 2007, tomato greenhouses across eastern Cuba exhibited high levels of Bemisia tabaci (B biotype) infestation. Some plants showed interveinal chlorosis and a severe yellow mosaic, combined with leaf brittleness. These symptoms were different from those induced by Tomato yellow leaf curl virus (TYLCV-IL(CU)). Only 12 of 31 symptomatic samples resulted in positive PCR assays with TYLCV-specific primers (CTGAATGTTTGGATGGAAATGTGC and GCTCGTAAGTTTCCTCAACGGAC). A reverse transcription (RT)-PCR analysis for Tomato chlorosis virus (ToCV) with generic (HS-11/HS-12) and specific primers (ToC-5/ToC-6) was also carried out (2). Sequence analysis of the cloned RT-PCR products (463 bp) confirmed the presence of ToCV in Cuba. The fragment had 97 to 98% identity with GenBank isolates from Spain (DQ136146), Florida (AY903448), and Reunion Island, France (AJ968396). Cloned TYLCV and ToCV amplicons were used as probes to reanalyze the selected 31 samples by a dot-blot hybridization assay in search of mixed infections (1). The assay showed 16 samples to be positive for ToCV, 4 for TYLCV, 8 for both, and 3 samples were negative. To our knowledge, this is the first report of ToCV and TYLCV/ToCV mixed infections in Cuba. References: (1) Y. Abou-Jawdha et al. Plant Dis. 90:378, 2006. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002.

Download Full-text

First Report of Mosaic Disease Caused by Colombian datura virus on Solanum lycopersicum Plants Commercially Cultivated in Japan

Plant Disease ◽

10.1094/pdis-06-13-0668-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 698-698 ◽

Cited By ~ 1

Author(s):

Y. Tomitaka ◽

T. Usugi ◽

R. Kozuka ◽

S. Tsuda

Keyword(s):

Nucleotide Sequence ◽

Solanum Lycopersicum ◽

Mosaic Disease ◽

Causal Agent ◽

Cultivated Plants ◽

Rt Pcr ◽

Degenerate Primers ◽

Specific Primers ◽

Tomato Plants ◽

First Report

In 2009, some commercially grown tomato (Solanum lycopersicum) plants in Chiba Prefecture, Japan, exhibited mosaic symptoms. Ten plants from a total of about 72,000 cultivated plants in the greenhouses showed such symptoms. To identify the causal agent, sap from leaves of the diseased plants was inoculated into Chenopodium quinoa and Nicotiana benthamiana plants. Local necrotic lesions appeared on inoculated leaves of C. quinoa, but no systemic infection was observed. Systemic mosaic symptoms were observed on the N. benthamiana plants inoculated. Single local lesion isolation was performed three times using C. quinoa to obtain a reference isolate for further characterization. N. benthamiana was used for propagation of the isolate. Sap from infected leaves of N. benthamiana was mechanically inoculated into three individual S. lycopersicum cv. Momotaro. Symptoms appearing on inoculated tomatoes were indistinguishable from those of diseased tomato plants found initially in the greenhouse. Flexuous, filamentous particles, ~750 nm long, were observed by electron microscopy in the sap of the tomato plants inoculated with the isolate, indicating that the infecting virus may belong to the family Potyviridae. To determine genomic sequence of the virus, RT-PCR was performed. Total RNA was extracted from the tomato leaves experimentally infected with the isolate using an RNeasy Plant Mini kit (QIAGEN, Hilden, Germany). RT-PCR was performed by using a set of universal, degenerate primers for Potyviruses as previously reported (2). Amplicons (~1,500 bp) generated by RT-PCR were extracted from the gels using the QIAquick Gel Extraction kit (QIAGEN) and cloned into pCR-BluntII TOPO (Invitrogen, San Diego, CA). DNA sequences of three individual clones were determined using a combination of plasmid and virus-specific primers, showing that identity among three clones was 99.8%. A consensus nucleotide sequence of the isolate was deposited in GenBank (AB823816). BLASTn analysis of the nucleotide sequence determined showed 99% identity with a partial sequence in the NIb/coat protein (CP) region of Colombian datura virus (CDV) tobacco isolate (JQ801448). Comparison of the amino acid sequence predicted for the CP with previously reported sequences for CDV (AY621656, AJ237923, EU571230, AM113759, AM113754, and AM113761) showed 97 to 100% identity range. Subsequently, CDV infection in both the original and experimentally inoculated plants was confirmed by RT-PCR using CDV-specific primers (CDVv and CDVvc; [1]), and, hence, the causal agent of the tomato disease observed in greenhouse tomatoes was proved to be CDV. The first case of CDV on tomato was reported in Netherlands (3), indicating that CDV was transmitted by aphids from CDV-infected Brugmansia plants cultivated in the same greenhouse. We carefully investigated whether Brugmansia plants naturally grew around the greenhouses, but we could not find them inside or in proximity to the greenhouses. Therefore, sources of CDV inoculum in Japan are still unclear. This is the first report of a mosaic disease caused by CDV on commercially cultivated S. lycopersicum in Japan. References: (1) D. O. Chellemi et al. Plant Dis. 95:755, 2011. (2) J. Chen et al. Arch. Virol. 146:757, 2001. (3) J. Th. J. Verhoeven et al. Eur. J. Plant. Pathol. 102:895, 1996.

Download Full-text

First Report of Tomato chlorosis virus Infecting Tomato in Georgia

Plant Disease ◽

10.1094/pdis-02-11-0122 ◽

2011 ◽

Vol 95 (7) ◽

pp. 881-881 ◽

Cited By ~ 1

Author(s):

S. Sundaraj ◽

R. Srinivasan ◽

C. G. Webster ◽

S. Adkins ◽

K. Perry ◽

...

Keyword(s):

Nucleic Acid Hybridization ◽

N Gene ◽

Natural Occurrence ◽

Rt Pcr ◽

Specific Primers ◽

Tomato Production ◽

First Report ◽

Interveinal Chlorosis ◽

Cp Gene ◽

Tomato Chlorosis Virus

Tomato yellow leaf curl virus (TYLCV) and Tomato spotted wilt virus (TSWV) are prevalent in field-grown tomato (Solanum lycopersicum) production in Georgia. Typical TYLCV symptoms were observed during varietal trials in fall 2009 and 2010 to screen genotypes against TYLCV at the Coastal Plain Experiment Station, Tifton, GA. However, foliar symptoms atypical of TYLCV including interveinal chlorosis, purpling, brittleness, and mottling on upper and middle leaves and bronzing and intense interveinal chlorosis on lower leaves were also observed. Heavy whitefly (Bemisia tabaci (Gennadius), B biotype) infestation was also observed on all tomato genotypes. Preliminary tests (PCR and nucleic acid hybridization) in fall 2009 indicated the presence of TYLCV, TSWV, Cucumber mosaic virus, and Tomato chlorosis virus (ToCV); all with the exception of ToCV have been reported in Georgia. Sixteen additional symptomatic leaf samples were randomly collected in fall 2010 and the preliminary results from 2009 were used to guide testing. DNA and RNA were individually extracted using commercially available kits and used for PCR testing for ToCV, TYLCV, and TSWV. Reverse transcription (RT)-PCR with ToCV CP gene specific primers (4) produced approximately 750-bp amplicons from nine of the 16 leaf samples. Four of the nine CP gene amplicons were purified and directly sequenced in both directions. The sequences were 99.4 to 100.0% identical with each other (GenBank Accession Nos. HQ879840 to HQ879843). They were 99.3 to 99.5%, 97.2 to 97.5%, and 98.6 to 98.9% identical to ToCV CP sequences from Florida (Accession No. AY903448), Spain (Accession No. DQ136146), and Greece (Accession No. EU284744), respectively. The presence of ToCV was confirmed by amplifying a portion of the HSP70h gene using the primers HSP-1F and HSP-1R (1). RT-PCR produced approximately 900-bp amplicons in the same nine samples. Four HSP70h gene amplicons were purified and directly sequenced in both directions. The sequences were 99.4 to 99.7% identical to each other (Accession Nos. HQ879844 to HQ879847). They were 99.2 to 99.5%, 98.0 to 98.4%, and 98.9 to 99.3% identical to HSP70h sequences from Florida (Accession No. AY903448), Spain (Accession No. DQ136146), and Greece (Accession No. EU284744), respectively. TYLCV was also detected in all 16 samples by PCR using degenerate begomovirus primers PAL1v 1978 and PARIc 496 (3) followed by sequencing. TSWV was also detected in two of the ToCVinfected samples by RT-PCR with TSWV N gene specific primers (2) followed by sequencing. To our knowledge, this is the first report of the natural occurrence of ToCV in Georgia. Further studies are required to quantify the yield losses from ToCV alone and synergistic interactions between ToCV in combination with TSWV and/or TYLCV in tomato production in Georgia. References: (1) T. Hirota et al. J. Gen. Plant Pathol. 76:168, 2010. (2) R. K. Jain et al. Plant Dis. 82:900, 1998. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) L. Segev et al. Plant Dis. 88:1160, 2004.

Download Full-text

First report of cucurbit chlorotic yellows virus infecting cucumber in South Korea

Plant Disease ◽

10.1094/pdis-10-20-2254-pdn ◽

2021 ◽

Author(s):

Hae-Ryun Kwak ◽

Hui-Seong Byun ◽

Hong-Soo Choi ◽

Jong-Woo Han ◽

Chang-Seok Kim ◽

...

Keyword(s):

Coat Protein ◽

South Korea ◽

East Asia ◽

Rna Extraction ◽

Rt Pcr ◽

Specific Primers ◽

Total Rna ◽

First Report ◽

Chlorotic Mottle ◽

Cucurbit Chlorotic Yellows Virus

In October 2018, cucumber plants showing yellowing and chlorotic mottle symptoms were observed in a greenhouse in Chungbuk, South Korea. The observed symptoms were similar to those caused by cucurbit aphid-borne yellows virus (CABYV), which has been detected on cucumber plants in the region since it was reported on melon in Korea in 2015 (Lee et al 2015). To identify the potential agents causing these symptoms, 28 samples from symptomatic leaves and fruit of cucumber plants were subjected to total RNA extraction using the Plant RNA Prep Kit (Biocubesystem, Korea). Reverse transcription polymerase chain (RT-PCR) was performed on total RNA using CABYV specific primers and protocols (Kwak et al. 2018). CABYV was detected in 17 of the 28 samples, while 11 symptomatic samples tested negative. In order to identify the cause of the symptoms, RT-PCR was performed using cucurbit chlorotic yellows virus (CCYV) and cucurbit yellow stunting disorder virus (CYSDV) specific primers (Wintermantel et al. 2019). Eight of the 28 samples were positive using the CCYV specific primers while seven samples were infected with only CCYV and one contained a mixed infection of CABYV with CCYV. None of the samples tested positive for CYSDV. The expected 373 nt amplicons of CCYV were bi-directionally sequenced, and BLASTn analysis showed that the nucleotide sequences shared 98 to 100% identity with CCYV isolates from East Asia, including NC0180174 from Japan. Two pairs of primers for amplification of the complete coat protein and RNA-dependent RNA polymerase (RdRp) genes (Wintermantel et al., 2019) were used to amplify the 753bp coat protein and 1517bp RdRp genes, respectively. Amplicons of the expected sizes were obtained from a CCYV single infection and ligated into the pGEM T- Easy vector (Promega, WI, USA). Three clones from each amplicon were sequenced and aligned using Geneious Prime and found to have identical sequences (Genbank accession nos. MW033300, MW033301). The CP and RdRp sequences demonstrated 99% nucleotide and 100% amino acid identity with the respective genes and proteins of the CCYV isolates from Japan. This study documents the first report of CCYV in Korea. Since CCYV was first detected on melon in Japan, it has been reported in many other countries including those in East Asia, the Middle East, Southern Europe, North Africa, and recently in North America. CCYV has the potential to become a serious threat to production of cucurbit crops in Korea, particularly due to the increasing prevalence of the whitefly, Bemisia tabaci, in greenhouse production systems. It will be important to continue monitoring for CCYV and determine potential alternate hosts in the region to manage and prevent further spread of CCYV in Korea.

Download Full-text

First Report of Cucurbit chlorotic yellows virus Infecting Cucurbits in Taiwan

Plant Disease ◽

10.1094/pdis-94-9-1168b ◽

2010 ◽

Vol 94 (9) ◽

pp. 1168-1168 ◽

Cited By ~ 33

Author(s):

L.-H. Huang ◽

H.-H. Tseng ◽

J.-T. Li ◽

T.-C. Chen

Keyword(s):

Citrullus Lanatus ◽

Bottle Gourd ◽

Insect Vector ◽

Silverleaf Whitefly ◽

Rt Pcr ◽

Specific Primers ◽

Total Rna ◽

First Report ◽

Dna Fragment ◽

Cucurbit Chlorotic Yellows Virus

In April 2009, chlorosis, yellows, and bleaching accompanied with green veins and brittleness on the lower leaves of cantaloupe (Cucumis melo L.) were observed in Lunbei Township, Yunlin County, Taiwan. The same symptoms were also found on cucumber (Cucumis sativus L.), pumpkin (Cucurbita moschata Duchesne), watermelon (Citrullus lanatus (Thunb.) Matsum. & Nakai), bottle gourd (Lagenaria siceraria (Molina) Standl.), and oriental pickling melon planted in other areas of Yunlin and Changhua counties in central Taiwan. Large populations of whiteflies were observed in association with the diseased cucurbit crops, and they were further identified as silverleaf whitefly (Bemisia argentifolii Bellows & Perring) by PCR with specific primers BaBF (5′-CCACTATAATTATTGCTGTTCCCACA-3′) and l2-N-3014R (5′-TCCAATGCACTAATCTGCCATATTA-3′) (3). In June 2009, samples from symptomatic cantaloupe were collected for virus diagnosis. Flexuous filamentous virions of 700 to 900 nm were observed in crude sap of the symptomatic cantaloupe tissues with transmission electron microscopy. On the basis of the suspected insect vector, symptomology, and virus morphology, a Crinivirus species was suspected as the causal agent. A nested reverse transcription (RT)-PCR assay with degenerate deoxyinosine-containing primers developed for detection of Closterovirus and Crinivirus (1) was conducted. Total RNAs extracted from 16 symptomatic cantaloupe samples with a Plant Total RNA Miniprep Purification Kit (Hopegen, Taichung, Taiwan) were analyzed, and a 0.5-kb DNA fragment was amplified from eight of them. The PCR products were sequenced and the sequences were identical among samples. A comparison of the submitted sequence (Accession No. HM120250) with those in GenBank showed that the sequence was identical to the Hsp70h sequences of Cucurbit chlorotic yellows virus (CCYV) isolates from Japan (Accession No. AB523789) (4) and China (Accession Nos. GU721105, GU721108, and GU721110). To identify CCYV infection in the field, the specific primers, Crini-hsp70-f (5′-GCCATAACCATTACGGGAGA-3′) and Crini-hsp70-r (5′-CGCAGTGAAAAACCCAAACT-3′), that amplify a 389-bp DNA fragment corresponding to the nucleotide 1,324 to 1,712 of RNA2 of the original CCYV Japan isolate (Accession No. AB523789) were designed for detection of CCYV. In RT-PCR analyses, CCYV was identified in cantaloupe (305 of 599 samples), watermelon (27 of 93 samples), cucumber (all 15 samples), melon (82 of 92 samples), pumpkin (8 of 10 samples), and bottle gourd (10 of 17 samples) showing chlorosis and yellowing. The 389-bp DNA fragment was also amplified by RT-PCR with the primer pair Crini-hsp70-f/Crini-hsp70-r from total RNA extracts of 29 of 116 silverleaf whitefly individuals collected from the diseased cantaloupe fields in Lunbei Township from August to October, 2009. CCYV is a newly characterized Crinivirus species, first discovered in Japan in 2004 (2) and also found in China in 2009. To our knowledge, this is the first report that CCYV is emerging as a threat to cucurbit productions in Taiwan. References: (1) C. I. Dovas and N. I. Katis. J. Virol. Methods 109:217, 2003. (2) Y. Gyoutoku et al. Jpn. J. Phytopathol. 75:109, 2009. (3) C. C. Ko et al. J. Appl. Entomol. 131:542, 2007. (4) M. Okuda et al. Phytopathology 100:560, 2010.

Download Full-text

First Report of Tomato chlorosis virus in Potato in Brazil

Plant Disease ◽

10.1094/pdis-12-11-1068-pdn ◽

2012 ◽

Vol 96 (4) ◽

pp. 593-593 ◽

Cited By ~ 18

Author(s):

D. M. S. Freitas ◽

I. Nardin ◽

N. Shimoyama ◽

J. A. C. Souza-Dias ◽

J. A. M. Rezende

Keyword(s):

Leaf Roll ◽

Rt Pcr ◽

Specific Primers ◽

Total Rna ◽

First Report ◽

Interveinal Chlorosis ◽

Potato Plants ◽

The World ◽

Tomato Chlorosis Virus ◽

Biotype B

Potato plants (Solanum tuberosum cv. Ágata) exhibiting symptoms of leaf roll and interveinal chlorosis, especially on older leaves, were found in a commercial crop in the County of Cristalina, State of Goiás, Brazil in June 2011. The crop was severely infested by whitefly Bemisia tabaci biotype B. Four potato tubers from symptomatic plants were indexed for the presence of the following viruses: Tomato chlorosis virus (ToCV), Potato leaf roll virus (PLRV), Tomato severe rugose virus (ToSRV), and Potato virus Y (PVY). Total RNA was extracted separately from each tuber and used for reverse transcription (RT)-PCR using the HS-11/HS-12 primer pair, which amplifies a fragment of 587 bp from the highly conserved region of the heat shock protein (HSP-70) homolog gene reported for ToCV. The RT-PCR product was subsequently tested by nested-PCR for detection of ToCV with specific primers ToC-5/ToC-6 (2). Amplicons of 463 bp, amplified from total RNA separately extracted from three tubers, were purified and directly sequenced. Comparisons among the three consensus sequences of 448 bp (GenBank Accession Nos. JQ288896, JQ288897, and JQ288898) revealed respectively, 98, 100, and 100% identity with the reported sequence of a tomato isolate of ToCV from Brazil (GenBank Accession No. EU868927) (1). For ToSRV detection, total DNA was extracted from two tubers and a fragment of approximately 820 bp was amplified by PCR with specific primers (3). PLRV and PVY were indexed in two and three tubers, respectively, by double-antibody sandwich-ELISA (SASA, Edinburg, Scotland). Virus-free B. tabaci biotype B were separately transferred to potato and tomato leaves infected with ToCV for an acquisition access period of 24 h. Groups of 30 viruliferous whitefly were transferred to four, young, sprout-grown potato plants cv. Ágata (two plants per virus isolate) for 24-h inoculation access period. After 37 days of inoculation, one plant inoculated with the potato and tomato isolates of ToCV, respectively exhibited symptoms of leaf roll and interveinal chlorosis on order leaves, which were similar to that induced by PLRV. Experimental infection of potato plants with ToCV, which induced leaf roll symptoms resembling PLRV infection, was reported in the United States by Wisler et al. (4). The potato isolate of ToCV was also transmitted by B. tabaci to one of two inoculated tomato plants. The presence of ToCV in all inoculated plants was detected by nested-RT-PCR as described above. To our knowledge, this is the first report on detection of ToCV in field potato plants in the world. Considering that ToCV occurs in innumerous countries around the world, it is transmitted by a cosmopolitan insect, and it induces symptoms similar to PLRV, this finding triggers an alert to field dependent seed-potato multiplication, virus inspector, and certification system. References: (1) J. C. Barbosa et al. Plant Dis. 92:1709, 2008. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002. (3) F. R. Fernandes et al. Trop. Plant Pathol. 35:43, 2010. (4) G. C. Wisler et al. Plant Dis. 82:270, 1998.

Download Full-text

First Report of Tomato chlorosis virus and Tomato infectious chlorosis virus in Tomato Crops in France

Plant Disease ◽

10.1094/pd-89-1243c ◽

2005 ◽

Vol 89 (11) ◽

pp. 1243-1243 ◽

Cited By ~ 24

Author(s):

A. Dalmon ◽

S. Bouyer ◽

M. Cailly ◽

M. Girard ◽

H. Lecoq ◽

...

Keyword(s):

Protein Gene ◽

The United States ◽

Rt Pcr ◽

Specific Primers ◽

Southern France ◽

Sequence Identity ◽

Two Samples ◽

Dna Fragment ◽

Tomato Chlorosis Virus ◽

Tomato Infectious Chlorosis Virus

Since 2002, yellowing symptoms associated with high levels of white-fly populations have been observed in plants of protected tomato crops in France. Symptomatic plants exhibited interveinal yellowing areas in older leaves, followed by generalized yellowing. Symptoms were not observed in young plants or fruits. Trialeurodes vaporariorum populations were generally abundant in spring, and Bemisia tabaci (established in France for approximately 10 years) became predominant in summer and fall. To check for the presence of Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV), two whitefly-transmitted criniviruses known to induce yellowing symptoms, 696 samples were collected in the major tomato-growing areas; 573 samples from southern France and 123 samples from northern France. Total RNA was extracted from each sample and analyzed using reverse transcription-polymerase chain reaction (RT-PCR). Primers specific to ToCV (2) and TICV (1,3) were used to amplify either part of the heat-shock-like protein gene HSP70h (both viruses) or part of the diverged coat protein gene (CPd), (TICV only). A 439-bp DNA fragment was obtained with ToCV primers in 178 samples from southern France collected mainly from mid-spring to early fall from 2002 to 2004. Three RT-PCR products amplified from samples collected from diverse growing areas were sequenced and showed 99 to 100% sequence identity with published ToCV sequences from Spain (GenBank Accession Nos. AF215818, AF233435, and AF215817), Portugal (GenBank Accession No. AF234029), Sicily (GenBank Accession No. AY048854), and the United States (GenBank Accession No. AF024630). Considering the high frequency of ToCV-infected samples (41 positive samples of 112 samples collected in 2002, 71 of 295 collected in 2003, and 66 of 166 collected in 2004), this virus appears to be well established in southern France but remains absent in the northern regions. The presence of TICV was tested in 485 samples using the CPd-specific primers or the HSP70h-specific primers. The virus was detected in only two samples from Nice (southeastern France) in 2003 with both primer pairs. The CPd DNA fragment (700 bp) from one of these samples was sequenced, showing 98.9% sequence identity with a TICV Japanese isolate (AB085603). Results of these assays suggest that in contrast to ToCV, TICV is not yet broadly established in France. This difference could be associated with the specificity of the vectors, since ToCV is transmitted by B. tabaci and T. vaporariorum, while TICV is transmitted only by T. vaporariorum (4). References: (1) R. H. Li et al. Plant Dis. 82:84, 1998. (2) D. Louro et al. Eur. J. Plant Pathol. 1065:589, 2000. (3) A. M. Vaira et al. Phytoparasitica 30:290, 2002. (4) G. C. Wisler et al. Plant Dis. 82:271, 1998.

Download Full-text

First Report of Tomato chlorosis virus (ToCV) in Tomato Crops in Saudi Arabia

Plant Disease ◽

10.1094/pdis-05-14-0443-pdn ◽

2014 ◽

Vol 98 (11) ◽

pp. 1590-1590 ◽

Cited By ~ 10

Author(s):

M. A. Al-Saleh ◽

I. M. Al-Shahwan ◽

M. T. Shakeel ◽

M. A. Amer ◽

C. G. Orfanidou ◽

...

Keyword(s):

Saudi Arabia ◽

Open Field ◽

Rt Pcr ◽

Degenerate Primers ◽

Crop Losses ◽

Total Rna ◽

Indicator Plants ◽

First Report ◽

Access Period ◽

Tomato Chlorosis Virus

During January 2014, open field and greenhouse tomato (Solanum lycopersicum L.) crops in the peripheral areas of Riyadh region (Al-Aflaj, Al-Kharj, Al-Waseel, and Al-Dalam), Saudi Arabia, were surveyed. In all surveyed tomato crops, yellowing symptoms were observed on the lower leaves, possibly infected by a whitefly transmitted crinivirus (family Closteroviridae) such as Tomato chlorosis virus (ToCV) and/or Tomato infectious chlorosis virus (TICV). Dense population of whiteflies (Bemisia tabaci G.) were present in all affected plants. Incidence of the yellowing disease varied between four greenhouses and three open field tomato crops, but in the majority of the tomato crops surveyed, symptoms typical of Begomovirus infection such as severe stunting, degeneration, upward cupping, distortion and interveinal yellowing of upper leaves, and flower abortion were also observed. Tomato yellow leaf curl virus (TYLCV) is endemic in Saudi Arabia causing severe crop losses (1). Twenty-six leaf samples from 24 symptomatic and two asymptomatic plants from four fields (three greenhouses and one open field crop) were collected and were processed in the lab at King Saud University. Whitefly transmission on tomato indicator plants was carried out using B. tabaci to fulfill Koch's postulates. Two hundred virus-free B. tabaci adults were confined to one of the collected symptomatic tomato sample singly infected with ToCV for a 48-h acquisition access period, followed by a 48-h inoculation access period on five healthy tomato plants Hybrid Super Strain B, using 40 whiteflies per plant. Crinivirus detection following transmission was conducted by RT-PCR. Total RNA was extracted from 26 collected leaf samples using the Total RNA Purification Kit and analyzed by SCRIPT One–Step RT-PCR Kit (Jena Bioscience). First, the degenerate primers HS-11/HS12 were used for amplification of a 587-bp fragment of the HSP70 gene of ToCV and TICV (3). Second, the RT-PCR product was subjected to a nested PCR using specific primers TIC-3/TIC-4 and TOC-5/TOC-6, for the detection of both TICV and ToCV, respectively (2). Finally, degenerate primers (AV494/AC1048) were used for detection of begomoviruses (4). No fragment was amplified by TIC-3/TIC-4 primer whereas TOC-5/TOC-6 amplified a size of 463 bp in all 24 symptomatic tested samples, including one mixed infection with TYLCV detected by AV494/AC1048. Asymptomatic samples did not produce any amplicon regarding TICV, ToCV, and Begomovirus detection. The amplicons of four positive fragments, each from one field, were further sequenced in both directions and all obtained sequences (KJ433488, KJ433489, KJ433490, and KJ433491) analyzed with BLAST and revealed 99% identity with the most closely deposited sequences in NCBI from Japan (AB513442) and Brazil (JQ952601). In the transmission tests, ToCV was detected to all tomato indicator plants which revealed yellowing symptoms 6 weeks post inoculation, whereas no transmission was obtained when non-viruliferous whitefly adults fed on two asymptomatic tomato leaves. To our knowledge, this is the first report of ToCV infecting tomato crops in Saudi Arabia. Further studies are being carried out to study epidemiology and genetic diversity of this virus associated with yellowing diseases of tomato in different regions of Saudi Arabia. This finding is important for the tomato crops and possibly other virus hosts as may cause serious epidemics and crop losses. References: (1) A. M. Ajlan et al. Arab J. Biotech. 10:179, 2007. (3) C. I. Dovas et al. Plant Dis. 86:1345, 2002. (2) J. Navas-Castillo et al. Plant Dis. 84:835, 2000. (4) S. D. Whyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Download Full-text