scholarly journals First Report of Papaya leaf curl virus Infecting Papaya Plants in Taiwan

Plant Disease ◽  
2003 ◽  
Vol 87 (2) ◽  
pp. 204-204 ◽  
Author(s):  
L.-S. Chang ◽  
Y.-S. Lee ◽  
H.-J. Su ◽  
T.-H. Hung
Keyword(s):  
Dna Sequences ◽  
Amino Acid Sequences ◽  
Reading Frame ◽  
Pcr Product ◽  
Reverse Primer ◽  
Gene Open Reading Frame ◽  
Southern Taiwan ◽  
Leaf Curl Virus ◽  
Papaya Leaf Curl Virus ◽  
Leaf Curl

Papaya leaf curl disease was first reported in India in 1939 (1). Caused by begomovirus, Papaya leaf curl virus (PaLCV) (2), this disease was discovered in the papaya orchards of southern Taiwan in 2002. Infected papaya developed symptoms such as downward curling of leaves, twisted petioles, vein enation, and stunting. Diseased plants produced small and distorted fruits that tend to fall prematurely. Typical twin virion was observed in the diseased papaya cells by electron microscopy. In addition, our whitefly-transmission test demonstrated that the sweet potato whitefly (Bemisia tabaci) could transmit this virus. For further molecular identification, two opposing primers were selected for the polymerase chain reaction (PCR) detection of PaLCV from the published nucleotide sequences of PaLCV (Genbank Accession No. NC004147) (3). The primer pair, composed of the forward primer 5′ -GCT AGA AAT TAT GTC GAA GCG-3′ and the reverse primer 5′-TCA ACT ACA ACC TGA GGA AAG C-3′, was designed to amplify a PaLCV-specific 1,031-bp fragment containing 774 bp of the coat protein gene open reading frame (CP-ORF) using PCR. Five diseased papaya samples with typical leaf-curl symptoms tested positive in the PCR-based assay with this specific primer pair, whereas five healthy papaya samples tested negative. However, the sequencing results of the PCR product from five PaLCV-infected papayas indicated the CP-ORF of PaLCV in Taiwan (PaLCV-Tw) was somewhat different from PaLCV in India (PaLCV-Id). The DNA sequences (Genbank Accession No. AY183472) of CP-ORF of PaLCV-Tw were 80% identical to those of PaLCV-Id, and their translated amino acid sequences were 77% identical. This indicates that PaLCV-Tw and PaLCV-Id are two different species or strains. References: (1) K. M. Thomas and C. S. Krishnaswamy. Curr. Sci. 8:316,1939. (2) S. Saxena et al. Plant Dis. 82:126, 1998. (3) S. Saxena et al. Biochem. Mol. Biol. Int. 45:101, 1998.

scholarly journals First Report of Bougainvillea spectabilis chlorotic vein-banding virus Infecting Bougainvillea Plants in Taiwan

Plant Disease ◽  
2005 ◽  
Vol 89 (12) ◽  
pp. 1363-1363 ◽  
Author(s):  
C.-H. Tsai ◽  
H.-J. Su ◽  
Y.-C. Liao ◽  
T.-H. Hung
Keyword(s):  
Dna Sequences ◽  
Virus Disease ◽  
Amino Acid Sequences ◽  
Electron Microscopic ◽  
Pcr Product ◽  
Bougainvillea Spectabilis ◽  
Reverse Primer ◽  
Sugarcane Bacilliform Virus ◽  
Leaf Distortion ◽  
Severe Leaf

Bougainvillea (Bougainvillea spectabilis), native to Amazonian rainforests in South America, is an important ornamental and landscaping plant that is widely distributed in tropical and subtropical areas. A new virus disease, Bougainvillea chlorotic vein-banding, caused by a Badnavirus, Bougainvillea spectabilis chlorotic vein-banding virus (BsCVBV), was first reported in Brazil in 2001 (1) and recently discovered in Taiwan. Infected bougainvillea developed symptoms such as mottling, chlorosis, vein-banding, and stunting. Severe leaf-distortion symptoms were observed in the susceptible hybrid Taipei Red, the most popular bougainvillea cultivar in Taiwan. In electron microscopic observations, typical bacilliform virions measuring 28 × 130 to 150 nm were observed in infected bougainvillea cells. In addition, our transmission tests demonstrated that the virus could be easily transmitted among different bougainvillea cultivars by bud grafting but not by mechanical inoculation. Bougainvillea plants showed apparent symptoms 1 month after grafting. For molecular identification, viral DNA was extracted from the test plants (2), and polymerase chain reaction (PCR) was performed using the primers selected from the DNA sequences of ORF III of Sugarcane bacilliform virus (GenBank Accession No. M89923). The sequence of the forward primer was 5′-TCA AAG TTT GAT TTG AAG AGC GGG-3′ and the sequence of the reverse primer was 5′-CTT GCA TAC TGC TCC CCA TCC-3′ The primers amplified a 676-bp PCR product (GenBank Accession No. DQ103759). Nucleotide and deduced amino acid sequences were 82 and 90% identical, respectively, to the corresponding region of the Brazilian strain of BsCVBV (GenBank Accession No. AY532653). These data indicate that the bougainvillea disease occurring in Taiwan is caused by a strain of BsCVBV. Reference: (1) C. M. Chagas et al. Virus Rev. Res. 6:153, 2001. (2) H.-J. Su et al. J. Phytopathol. 151:290, 2003.

scholarly journals First Report of Papaya leaf curl virus Associated with Leaf Curl Disease in Cestrum nocturnum in Pakistan

Plant Disease ◽  
2020 ◽  
Vol 104 (11) ◽  
pp. 3089
Author(s):  
Aamir Lal ◽  
Eui-Joon Kil ◽  
Kainat Rauf ◽  
Muhammad Ali ◽  
Sukchan Lee
Keyword(s):  
First Report ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Papaya Leaf Curl Virus ◽  
Leaf Curl

scholarly journals Genomic regions of tomato leaf curl virus DNA satellite required for replication and for satellite-mediated delivery of heterologous DNAs

2007 ◽  
Vol 88 (7) ◽  
pp. 2073-2077 ◽  
Author(s):  
Dongmei Li ◽  
S. A. Akbar Behjatnia ◽  
Ian B. Dry ◽  
John W. Randles ◽  
Omid Eini ◽  
...  
Keyword(s):  
Significant Loss ◽  
Tomato Leaf ◽  
Slight Reduction ◽  
Reading Frame ◽  
Tomato Leaf Curl Virus ◽  
Transient Assays ◽  
Gene Delivery Vectors ◽  
Tomato Leaf Curl ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato leaf curl virus (TLCV) satellite DNA (sat-DNA) is a 682 nt, circular, single-stranded molecule that lacks an open reading frame (ORF) or an apparent promoter. It contains binding motifs for the TLCV replication-associated protein, but these are dispensable for replication. To identify the regions of the sat-DNA critical for replication, the entire sequence was scanned by deletion/replacement mutagenesis. Transient assays using Nicotiana benthamiana revealed that sequences within nt 296–35 (through nt 682) are essential for replication. Sequence deletions and replacements between nt 35 and 296 were tolerated but with a significant loss of infectivity, indicating that genome size strongly influences replication efficiency. Within the permissible region, inserts of 100–700 nt were retained in transient assays although with a slight reduction in replication. In addition, sat-DNA constructs containing short non-viral DNAs replicated and spread in tobacco plants, indicating their potential as gene-delivery vectors.

scholarly journals Tomatillo (Physalis ixocarpa) as a Natural New Host for Tomato yellow leaf curl virus in Sinaloa, Mexico

Plant Disease ◽  
2009 ◽  
Vol 93 (5) ◽  
pp. 545-545 ◽  
Author(s):  
C. Gámez-Jiménez ◽  
J. L. Romero-Romero ◽  
M. E. Santos-Cervantes ◽  
N. E. Leyva-López ◽  
J. Méndez-Lozano
Keyword(s):  
Tomato Yellow Leaf ◽  
Bipartite Begomoviruses ◽  
Yellow Leaf ◽  
New Host ◽  
Pcr Product ◽  
National Production ◽  
Main Production ◽  
Production Areas ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomatillo, also known as husk or green tomato, is cultivated in 29 of 32 states in Mexico, with the main production areas located in the states of Sinaloa, Michoacán, Puebla, Sonora, Guanajuato, Jalisco, and Hidalgo. The national production of tomatillo in 2006 was 805,721 tons with a value of $259 million. Tomato yellow leaf curl virus (TYLCV) is one of the most damaging begomoviruses affecting tomato worldwide. TYLCV was first identified in Mexico in 1999 in Yucatán (1) and most recently identified as infecting tomato in Sinaloa (3). During December of 2006, symptoms including chlorotic margins, yellowing, and interveinal yellowing were observed in tomatillo fields. Symptomatic plants were associated with the presence of whiteflies in many fields, suggesting a begomovirus etiology. Total DNA was extracted from leaves of 77 symptomatic tomatillo plants from Guasave and Ahome counties and amplified by PCR using a degenerate primer pair (2). These primers can differentiate between monopartite and bipartite begomoviruses on the basis of the size of the amplification products, approximately 750 and 650 bp, respectively. A PCR product of 742 bp was obtained from 48 of 97 samples. The PCR product of two representative samples from each county were cloned into pGEM-T Easy Vector (Promega, Madison, WI) and sequenced. The sequences of the four amplicons were identical (GenBank Accession No. EU224314) and were compared with sequences of others begomoviruses in the NCBI/GenBank database using the Clustal V alignment method (MegAlign, DNASTAR software, London). The highest sequence identity of 100% was with a TYLCV isolate from Sinaloa (GenBank Accession No. DQ377367), 99.8% with a TYLCV isolate from Tosa (GenBank Accession No. AB192965), 98.4% with a TYLCV isolate from China (GenBank Accession No. AM282874), 95.8% with a TYLCV isolate from Yucatán (GenBank Accession No. AF168709), and 94.6% with TYLCV-Is (GenBank Accession No. X15656). The genome of tomatillo TYLCV isolate was amplified using PCR and overlapping primer pair (TYLCV NcoI Forward GGCCCATGGCCGCGCAGCGG and Reverse CGGCCATGGAGACCCATAAG). Sequence of a 2,781-bp fragment was obtained (GenBank Accession No. FJ609655) and sequence analysis corroborated that the tomatillo TYLCV has 99.3% identity with two TYLCV isolates from Sinaloa (GenBank Accession Nos. EF5234478 and FJ012358). To our knowledge, this is the first report of tomatillo as a natural host of TYLCV in Mexico. These results suggest that TYLCV has begun to establish itself in others crops since it was first reported to be infecting tomato in Sinaloa, Mexico. References: (1) J. T. Ascencio-Ibañez et al. Plant Dis. 83:1178, 1999. (2) J. T. Ascencio-Ibañez et al. Plant Dis. 86:692, 2002. (3) C. Gámez-Jímenez et al. (Abstr.) Phytopathology 96(suppl.):S38. 2006.

scholarly journals Automatic simulation of RNA editing in plants for the identification of novel putative Open Reading Frames

2017 ◽  
Author(s):  
Fabio Fassetti ◽  
Claudia Giallombardo ◽  
Ofelia Leone ◽  
Luigi Palopoli ◽  
Simona E Rombo ◽  
...  
Keyword(s):  
Rna Editing ◽  
Dna Sequences ◽  
Information Transfer ◽  
Plant Mitochondria ◽  
Amino Acid Sequences ◽  
Open Reading Frames ◽  
Reading Frame ◽  
Novel Proteins ◽  
Gene Search ◽  
Novel Strategy

In plant mitochondria an essential mechanism for gene expression is RNA editing, often influencing the synthesis of functional proteins. RNA editing alters the linearity of genetic information transfer, intro- ducing differences between RNAs and their coding DNA sequences that hind both experimental and computational research of genes. Thus common software tools for gene search, successfully exploited to find canonic genes, often can fail in discovering genes encrypted in the genome of plants. In this work we propose a novel strategy useful to intercept candidate coding sequences resulting from some possible editing substitutions on the start and stop codons of a given input organism DNA. Our method is based on the simulation of the RNA editing mechanism, in order to generate candidate Open Reading Frame (ORF) sequences that could code for some, yet unknown, proteins. Results obtained on the mtDNA of Oryza sativa are promising, since we identified ORF sequences trascripted in Oriza, that do not cor- respond to already known proteins in this organism. Part of the corresponding amino acid sequences present high homologies with proteins already discovered in other organisms, the remaining ones could represent novel proteins not yet discovered in Oryza.

Codiaeum variegatum in Pakistan harbours pedilanthus leaf curl virus and papaya leaf curl virus as well as a newly identified betasatellite

2020 ◽  
Vol 165 (8) ◽  
pp. 1877-1881
Author(s):  
Afzal Akram ◽  
Aqsa Hafeez Khan ◽  
Ghulam Rasool ◽  
Shahid Mansoor ◽  
Peter Moffett ◽  
...  
Keyword(s):  
Codiaeum Variegatum ◽  
Leaf Curl Virus ◽  
Papaya Leaf Curl Virus ◽  
Leaf Curl

scholarly journals First Report of Tomato Yellow Leaf Curl Virus in Réunion Island

Plant Disease ◽  
1999 ◽  
Vol 83 (3) ◽  
pp. 303-303 ◽  
Author(s):  
M. Peterschmitt ◽  
M. Granier ◽  
R. Mekdoud ◽  
A. Dalmon ◽  
O. Gambin ◽  
...  
Keyword(s):  
Tomato Yellow Leaf ◽  
Economic Losses ◽  
Enzyme Linked Immunosorbent Assay ◽  
Yield Reduction ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Capsid Protein Gene ◽  
Pcr Product ◽  
Leaf Curl Virus ◽  
Leaf Curl

In September 1997, stunting, reduced leaf size, leaf curling, and yellow margins were observed on tomato plants on a farm on the south coast of Réunion, a French island belonging to the Mascarenes archipelago. To our knowledge, these symptoms appeared to be characteristic of a tomato yellow leaf curl virus (TYLCV) infection. Diseased plants gave positive reactions with a triple antibody sandwich-enzyme-linked immunosorbent assay (TAS-ELISA), using ADGEN antibodies specific for begomoviruses (1). The serological results were confirmed by polymerase chain reaction (PCR) with a pair of degenerate primers—MP16, 5′-CCTCTAGATAATATTAC(C/T)(G/T)(G/A)(A/T)(T/G)G(G/A)CC-3′ and MP82, 5′-CGGAATTC(T/C)TGNAC(C/T)TT(G/A)CANGGNCC(T/C)T C(G/A)CA-3′—designed by Malla Padidam (ILTAB, San Diego, CA) to amplify a region of the A component of begomoviruses, between the intergenic conserved nonanucleotide sequence (TAATATTAC) and the first 5′ quarter of the capsid protein gene. A 500-bp PCR product was obtained from a symptomatic plant but not from a healthy looking one. After cloning the PCR product in a pGEM-T Easy vector (Promega, Madison, WI) and sequencing it with plasmid-specific primers (SP6, T7), the sequence was compared with the sequences of the NCBI data base, with the use of BLAST. Nineteen sequences among those producing the highest scoring segment pairs were compared with each other and with the 500-bp PCR product from Réunion by the Clustal method of MegAlign (DNASTAR, London). The Réunion sequence (AJ010790) was at least 94% similar to sequences of TYLCV isolates from the Dominican Republic (AF024715), Cuba (AJ223505), and Israel (X15656, X76319 for the mild clone). Based on these results, it appeared that the analyzed tomato plant was infected by a geminivirus isolate belonging to the Israeli species of TYLCV. A preliminary survey was carried out from December 1997 to April 1998 in both outdoor and protected tomato crops. Infected plants were detected by TAS-ELISA in 52 of the 123 locations visited. Severe economic losses were observed: 14 locations with 60 to 100% yield reduction and 11 locations with 40 to 60% yield reduction. All the infected samples were collected in the leeward coast, which is the driest region of the island. Although Bemisia tabaci (Gennadius) has been recorded since 1938 in Réunion (2), it has been observed on tomato crops only since 1997 and population levels were low compared with those of Trialeurodes vaporariorum Westwood. During the first six months of 1998, B. tabaci was found on Euphorbia heterophylla L., Lantana camara L., Solanum melongena L., S. nigrum L., and Phaseolus vulgaris L. These host plants often occur near infected tomato crops. References: (1) S. Macintosh et al. Ann. Appl. Biol. 121:297, 1992. (2) L. Russell and J. Etienne. Proc. Entomol. Soc. Wash. 87:202, 1985.

scholarly journals Presence of Tomato yellow leaf curl virus Infecting Squash (Curcubita pepo) in Cuba

Plant Disease ◽  
2004 ◽  
Vol 88 (5) ◽  
pp. 572-572 ◽  
Author(s):  
Y. Martinez Zubiaur ◽  
D. Fonseca ◽  
M. Quiñones ◽  
I. Palenzuela
Keyword(s):  
Intergenic Region ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Specific Primers ◽  
Cycle Sequencing ◽  
Pcr Product ◽  
Three Samples ◽  
Leaf Curl Virus ◽  
Leaf Curl

In a survey conducted in Havana Province during January and February 2003, symptoms of curling and light yellowing of leaves were found in squash plants (Curcubita pepo). DNA from leaves of six symptomatic squash plants was extracted (1) and hybridized at high stringency with specific probes of the intergenic region of Tomato yellow leaf curl virus (TYLCV, genus begomovirus) isolated in Cuba by using a nonradioactive hybridization kit (AlkPhos Direct Labeling and Detection Systems; Amersham Pharmacia Biotech Inc., Piscataway, NJ). Three samples were positive in the nonradioactive analyses. The same samples were positive using polymerase chain reaction (PCR) when the DNA was analyzed with degenerate primers PAL1v1978/PAR1c715 for DNA-A (5), specific primers, ORITY1/ORITY2, for the intergenic region (2), and overlapping specific primers for TYLCV (3). Fragments of 1.4, 0.750, and 2.8 kb were cloned using pGem-T Easy (Promega, Madison, WI), and the six clones obtained were sequenced using the Terminator Cycle Sequencing Kit in a SEQ 4 × 4 machine (Amersham Pharmacia Biotech Inc.). Sequences of three fragments exhibited 95 to 97% homology with TYLCV (GenBank Accession Nos. AF414089 and AF260331). Additionally, we did not obtain a PCR product when DNA was amplified using degenerate primers PBV1c800/PBC1v2039 for DNA-B (4). These results suggest that TYLCV is present in squash in field plantations, and these plants may serve as a virus reservoir for other crops such a tomatoes. References: (1) S. L. Dellaporta et al. Plant. Mol. Biol. Rep. 1(4):19, 1983. (2) Y. Martínez et al. Rev. Prot. Veg. 18(3):168, 2003. (3) M. K. Nakhla et al. Plant Dis. 78:926, 1994. (4) M. Rojas et al. Plant Dis. 77:340, 1993.

scholarly journals Detection of a Whitefly-Transmitted Geminivirus in Launaea spp. in India

Plant Disease ◽  
2000 ◽  
Vol 84 (5) ◽  
pp. 593-593
Author(s):  
S. K. Raj ◽  
G. Chandra ◽  
B. P. Singh
Keyword(s):  
Virus Transmission ◽  
Pcr Amplification ◽  
African Cassava Mosaic Virus ◽  
Ammonium Bromide ◽  
Pcr Product ◽  
Total Dna ◽  
Cetyl Trimethyl Ammonium ◽  
Tomato Leaf Curl ◽  
Leaf Curl Virus ◽  
Leaf Curl

Launaea acaulis (Roxb.) Babc. Aerr. and L. procumbeus (Roxb.) Ramayya & Rajgopal are weeds that grow near agricultural fields in India during the rainy season. Yellow net symptoms were observed in both species, but not in crops, in 1998 and 1999. Nicotiana tabacum cv. White Burley developed leaf curl symptoms after virus transmission from L. acaulis by whiteflies (Bemisia tabaci). Thus, the involvement of a geminivirus was suspected. Total DNA from infected and uninfected tobacco and Launaea plants was extracted by the cetyl trimethyl ammonium bromide method and precipitated by ethanol. Polymerase chain reaction (PCR), using DNA from infected and uninfected plants as a template and degenerate oli-gonucleotide primers designed from DNA-A of whitefly-transmitted African cassava mosaic virus (ACMV) (1) was performed. An expected ≈500-bp fragment was observed after agarose gel electrophoresis of the PCR product. Total DNA from infected plants gave positive signals and was homologous with the probe from cloned DNA-A of Indian tomato leaf curl virus (2) in high-stringency Southern hybridization tests. No PCR amplification and positive signals were obtained from DNA from uninfected plants. PCR amplification of the 500-bp fragment with primers from DNA-A of whitefly-transmitted ACMV resulted in positive signals, and homology with the probe indicated that L. acaulis and L. procumbens harbor whitefly-transmitted geminivirus infections. This is the first report of geminivirus infection in these Launaea spp. in India. References: (1) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (2) K. M. Srivastava, et al. J. Virol. Methods 51:297, 1985.

Sign in / Sign up

Export Citation Format

Share Document