scholarly journals First record of a mermithid nematode (Nematoda: Mermithidae) parasitizing winged females of gall-forming aphids (Hemiptera: Aphididae: Eriosomatinae)

2021 ◽  
Author(s):  
Xin Tong ◽  
Natsumi Kanzaki ◽  
Shin-ichi Akimoto
Keyword(s):  
Phylogenetic Tree ◽  
18S Rdna ◽  
Morphological Characteristics ◽  
First Record ◽  
28S Rdna ◽  
Mermithid Nematode

Juvenile mermithid nematodes were found to parasitize winged females (sexuparae) of Eriosoma auratum and Tetraneura radicicola. The morphological characteristics of mermithid nematodes are briefly described. The 18S rDNA and 28S rDNA extracted from one nematode were sequenced and used to construct a Bayesian phylogenetic tree, on which the host ranges of mermithid nematodes were represented. Our study indicated that mermithid parasitism of sexuparae led to fewer and smaller sexual female embryos. This is the first record of a mermithid in relation to eriosomatine aphids and the fourth record with respect to Aphididae.

scholarly journals First record of Pseudoterranova decipiens (Nematoda, Anisakidae) infecting the Red spot emperor Lethrinus lentjan in the Red Sea

2019 ◽  
Vol 28 (4) ◽  
pp. 625-631 ◽  
Author(s):  
Saleh Al Quraishy ◽  
Rewaida Abdel-Gaber ◽  
Mohamed Abdel Monem Dkhil
Keyword(s):  
Red Sea ◽  
18S Rdna ◽  
Morphological Characteristics ◽  
First Record ◽  
Gene Region ◽  
Present Species ◽  
Helminth Parasites ◽  
Rdna Gene ◽  
Pseudoterranova Decipiens ◽  
18S Rdna Gene

Abstract The current parasitological study was carried out to investigate helminth parasites infecting the Red spot emperor Lethrinus lentjan inhabiting Hurghada City at the Gulf of Suez, Red Sea, Egypt. Third-stage larvae of nematode parasite was isolated from the intestine as well as body cavity of the examined fish. Light and scanning electron microscopy revealed that this parasite belonged to Anisakidae family within the genus Pseudoterranova. The present species is named Pseudoterranova decipiens based on the presence of triangular mouth aperture with prominent boring teeth and soft swellings of the cuticle, long muscular esophagus, ventrally excretory pore, and narrow transverse slit of anal opening followed by a short mucron. The morphological characteristics of this species were confirmed by molecular analysis of 18S rDNA gene region of the present parasite. It demonstrated a close identity ≥89% with taxa under family Anisakidae, 85% with Raphidascarididae, and 79-84% with Toxocaridae. A preliminary genetic comparison between gene sequence of the present parasite and other oxyurid species placeed it as a putative sister taxon to other Pseudoterranova decipiens described previously. This study demonstrated that the 18S rDNA gene region of Pseudoterranova decipiens yielded a unique sequence that confirmed its taxonomic position in Anisakidae.

First record of the genus Sakia Khan, 1964 (Nematoda: Tylenchidae) from Iran, with proposal of Sakia arboris n. sp.

Nematology ◽  
2018 ◽  
Vol 20 (5) ◽  
pp. 449-460 ◽  
Author(s):  
Yousef Panahandeh ◽  
Ebrahim Pourjam ◽  
Ali Roshan-Bakhsh ◽  
Majid Pedram
Keyword(s):  
New Species ◽  
Ribosomal Dna ◽  
18S Rdna ◽  
Phylogenetic Analyses ◽  
Large Subunit ◽  
First Record ◽  
Small Subunit ◽  
28S Rdna ◽  
Northern Iran ◽  
Body Contour

Summary The genus Sakia is recorded from Iran for the first time and Sakia arboris n. sp., recovered from two geographical points in northern Iran, is described. The new species is characterised by its smooth cuticle under light microscopy (LM), absence of lateral fields, head continuous with body contour, flattened lip region, 9.3 (9.0-10.0) μm long stylet, vulva at 60.2 (59.3-61.3)%, bilobed spermatheca, 117 (102-128) μm long tail, and 14.3 (14-15) μm long spicules. By lacking lateral fields, the new species comes close to three known species of the genus, namely: S. alii, S. castori and S. indica. Molecular phylogenetic analyses using sequences of the near full-length fragment of the small subunit of ribosomal DNA (18S rDNA) and the D2-D3 expansion segments of the large subunit ribosomal DNA (28S rDNA) were performed using Bayesian inference (BI) and maximum likelihood (ML) methods. In the reconstructed Bayesian tree using the 18S rDNA sequence of the type population, the new species occupied a position in a clade including two isolates of Sakia sp. and some species of Lelenchus, with maximal BPP and high ML BS values (1.00/99%). In the reconstructed 28S rDNA phylogenetic tree, two newly sequenced isolates of S. arboris n. sp. formed a well-supported clade with Lelenchus spp.

The First Record of Parthenitae and Cercariae of Plagiorchis Multiglandularis (Trematoda, Plagiorchiidae) in Lymnaea Stagnalis in Ukraine

2018 ◽  
Vol 52 (4) ◽  
pp. 289-294
Author(s):  
E. P. Zhytova
Keyword(s):  
Lymnaea Stagnalis ◽  
Morphological Characteristics ◽  
First Record ◽  
Morphometric Data ◽  
Diagnostic Characters ◽  
Plagiorchis Elegans

Abstract Parthenitae and cercariae of Plagiorchis. multiglandularis Semenov, 1927 are recorded in Lymnaea stagnalis (Linnaeus, 1758) for the fi rst time in Ukraine; their morphological characteristics are specifi ed. Diagnostic characters of P. multiglandularis parthenitae and cercariae found in Ukrainian Polissia are compared with those from other regions. To confi rm the validity of the species, a comparison of the morphometric data of this trematode larvae with the cercariae of Plagiorchis elegans (Rudolphi, 1802) Braun, 1902, found in molluscs L. stagnalis, L. ralustris and L. corvuses, was performed. It was determined that P. multiglandularis cercariae diff er from those of P. elegans in size and position of the penetration glands.

Phylogenetic Relations of Rhizoplaca Zopf. from Anatolia Inferred from ITS Sequence Data

2006 ◽  
Vol 61 (5-6) ◽  
pp. 405-412 ◽  
Author(s):  
Demet Cansaran ◽  
Sümer Aras ◽  
İrfan Kandemir ◽  
Gökhan Halıcı
Keyword(s):  
Genetic Variability ◽  
Phylogenetic Tree ◽  
Sequence Data ◽  
Volcanic Rocks ◽  
Morphological Characteristics ◽  
Its Rdna ◽  
Its Sequence ◽  
Phylogenetic Relations ◽  
Rdna Sequences

Like many lichen-forming fungi, species of the genus Rhizoplaca have wide geographical distributions, but studies of their genetic variability are limited. The information about the ITS rDNA sequences of three species of Rhizoplaca from Anatolia was generated and aligned with other species from other countries and also with the data belonging to Lecanora species. The examined species were collected from the volcanic rocks of Mount Erciyes which is located in the middle of Anatolia (Turkey). The sequence data aligned with eight other samples of Rhizoplaca and six different species of Lecanora were obtained from GenBank. The results support the concept maintained by Arup and Grube (2000) that Rhizoplaca may not be a genus separate from Lecanora. According to the phylogenetic tree, Rhizoplaca melanopthalma from Turkey with two different samples of R. melanopthalma from Arizona (AF159929, AF159934) and a sample from Austria formed a group under the same branch. R. peltata and R. chrysoleuca samples from Anatolia located in two other branches of the tree formed sister groups with the samples of the same species from different countries. Although R. peltata remained on the same branch with other samples of the same species from other countries it was placed in a different branch within the group. When the three species from Anatolia were considered alone, it was noticed that Rhizoplaca melanopthalma and Rhizoplaca peltata are phylogenetically closer to each other than Rhizoplaca chrysoleuca; the morphological characteristics also support this result.

scholarly journals Andrena Florivaga Eversmann , 1852 (Hymenoptera: Apoidea: Andrenidae) - A New Bee Species of the Genus Andrena in Poland

2013 ◽  
Vol 57 (1) ◽  
pp. 45-50
Author(s):  
Józef Banaszak ◽  
Ewelina Motyka ◽  
Katarzyna Szczepko
Keyword(s):  
National Park ◽  
Morphological Characteristics ◽  
First Record ◽  
General Distribution ◽  
Baikal Lake ◽  
The West ◽  
Central Siberia ◽  
Lake Region ◽  
Time Period ◽  
Pan Traps

Summary The first record of Andrena florivaga Eversmann, 1852 is reported from Poland on the basis of specimens collected in the Kampinos National Park (Mazovian Lowland). Diagnosis, data on localities, biology, and general distribution of the species are provided. One female and five males were caught on a mowed fresh meadow and fallow fields with the use of water pan-traps (Moericke traps), during the 2003 - 2004 time period. The main morphological characteristics distinguishing Andrena florivaga from the very similar Andrena dorsalis Brullé, 1832 species and from the other species of the subgenus Lepidandrena are: in the case of females - the width of facial foveae and colouration of legs, and in the case of males - the length of the first flagellar segment, colouration of clypeus, and pubescence of gonostyles. Andrena florivaga can be found from France in the west, to Central Siberia (Baikal lake region) in the east, and Turkey in the south. Poland is the northernmost locality of the species.

scholarly journals First Report of Meloidogyne enterolobii on Carrot in China

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 1019-1019 ◽  
Author(s):  
Y. F. Wang ◽  
S. Xiao ◽  
Y. K. Huang ◽  
X. Zhou ◽  
S. S. Zhang ◽  
...  
Keyword(s):  
Morphological Characteristics ◽  
Severe Infection ◽  
Original Description ◽  
First Record ◽  
Vegetable Crops ◽  
Species Identity ◽  
Fujian Province ◽  
First Report ◽  
Lateral Lines ◽  
Meloidogyne Sp

Carrot (Daucus carota var. sativus) is one of the 10 most economically important vegetable crops in the world. Recently, stunted and yellowing carrots grown on sandy soil in several commercial fields were observed in Dongshan County, Fujian Province, China. Many round to irregular shaped lumps and swellings were present on the surface of tap and fibrous roots, often with secondary roots emerging from the galls on taproots. Severe infection caused short, stubby, forked taproots leading to losses in quality and marketability. Meloidogyne sp. females and egg masses were dissected from the galls. The perineal patterns from 20 females were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. The second-stage juvenile mean body length (n = 20) was 416 (390 to 461) μm; lateral lips were large and triangular in face view; tail was thin and length was averaged 56.1 (49.8 to 62.1) μm, with a broad, bluntly rounded tip. These morphological characteristics matched the original description of M. enterolobii (5). Species identity was further explored by sequencing the mitochondrial DNA (mtDNA) region between COII and the lRNA genes using primers C2F3/MRH106 (GGTCAATGTTCAGAAATTTGTGG/AATTTCTAAAGACTTTTCTTA GT) (4). A DNA fragment of ~840 bp was obtained and the sequence (GenBank Accession No. KJ146864) was compared with those in GenBank using BLAST and was 100% identical to the sequences of M. enterolobii and M. mayaguensis, a synonym of M. enterolobii (4). Part of the rDNA spanning ITS1, 5.8S gene, ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (3), and the sequence obtained (KJ146863) was 99 to 100% identical to sequences of M. enterolobii (KF418369.1, KF418370.1, JX024149.1, and JQ082448.1). For further confirmation, M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) (2) were used for amplification of the rDNA-IGS2 sequences of eight populations of the nematode from three localities. A 200-bp amplification product was produced by each population, whereas no product was amplified from control populations of M. incognita or M. javanica. A single product of ~320 bp was obtained using primers 63VNL/63VTH (GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC ) (1) from the mtDNA 63-bp repeat region for these populations, and the sequence (KJ146861) showed 100% identity with sequences of M. enterolobii (AJ421395.1, JF309159.1, and JF309160.1). Therefore, the population of Meloidogyne sp. on carrot was confirmed to be M. enterolobii. This nematode has been reported to infect more than 20 plant species belonging to seven families, including Annonaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae in China. To our knowledge, this is the first report of infection of carrot by M. enterolobii and the first record of M. enterolobii parasitizing a plant in the family Apiaceae in China. M. enterolobii has been reported in Guangdong and Hainan provinces, China. This is the first report of M. enterolobii in Fujian Province, in southeast China. References: (1) V. C. Blok et al. Nematology 4:773, 2002. (2) H. Long et al. Acta Phytopathol. Sin. 36:109, 2006. (3) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (4) J. Xu et al. Eur. J. Plant Pathol. 110:309, 2004. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

scholarly journals First record of intersexuality in Porcellana platycheles (Pennant, 1777) (Decapoda: Anomura: Porcellanidae)

2017 ◽  
Vol 41 (3) ◽  
pp. 606-610
Author(s):  
Luciane Ferreira ◽  
Guillermo Guzmán
Keyword(s):  
Morphological Characteristics ◽  
First Record ◽  
Genetic Variations ◽  
The Third ◽  
The Family

This paper reports the first record of intersexuality from Porcellana platycheles, a member of the family Porcellanidae. Intersex individuals were identified by the presence of both pairs of genital openings on the coxae of the third and fifth pereiopods respectively, and by morphological characteristics of the abdomen and pleopods. The low occurrence of this condition suggests that intersexuality is due to genetic variations in the population rather than other possible causes of intersexuality previously reported in other decapods.

scholarly journals First Report of Myrothecium roridum Causing Leaf Spot on Zantedeschia aethiopica in China

Plant Disease ◽  
2014 ◽  
Vol 98 (6) ◽  
pp. 854-854 ◽  
Author(s):  
B.-J. Li ◽  
H.-Y. Ben ◽  
Y.-X. Shi ◽  
X.-W. Xie ◽  
A.-L. Chai
Keyword(s):  
Leaf Spot ◽  
Morphological Characteristics ◽  
Its Region ◽  
First Record ◽  
Conidial Suspension ◽  
Isolation And Identification ◽  
Zantedeschia Aethiopica ◽  
Calla Lily ◽  
Initial Symptoms ◽  
Myrothecium Roridum

Zantedeschia aethiopica (L.) Spreng. (calla lily), belonging to family Araceae, is a popular ornamental plant in China. In the summer of 2010, leaves of calla lily with typical symptoms of necrotic lesions were observed in a commercial glasshouse in Beijing, China (116°20′ E, 39°44′ N). The initial symptoms were circular to subcircular, 1 to 3 mm, and dark brown lesions on the leaf lamina. Under high humidity, lesions expanded rapidly to 5 to 10 mm with distinct concentric zones and produced black sporodochia, especially on the backs of leaves. Later, the infected leaves were developing a combination of leaf lesions, yellowing, and falling off; as a result, the aesthetic value of the plant was significantly impacted. Leaf samples were used in pathogen isolation. Symptomatic leaf tissues were cut into small pieces and surface sterilized with 70% ethanol for 30 s and then in 0.1% mercuric chloride solution for 1 to 3 min. After being washed in sterile distilled water three times, the pieces were plated on potato dextrose agar (PDA) and incubated at 25°C in darkness for 7 days (5). Initial colonies of isolates were white, floccose mycelium and developed dark green to black concentric rings that were sporodochia bearing viscid spore masses after incubating 5 days. Conidiophores branched repeatedly. Conidiogenous cells were hyaline, clavate, and 10.0 to 16.0 × 1.4 to 2.0 μm. Conidia were hyaline, cylindrical, both rounded ends, and 6.0 to 8.2 × 1.9 to 2.4 μm. Morphological characteristics of the fungus were consistent with the description of Myrothecium roridum Tode ex Fr. (3,4). To confirm the pathogenicity, three healthy plants of calla lily were inoculated with a conidial suspension (1 × 106 conidia per ml) brushed from a 7-day-old culture of the fungus. Control plants were sprayed with sterile water. The inoculated plants were individual with clear plastic bags and placed in a glass cabinet at 25°C. After 7 days, all inoculated leaves developed symptoms similar to the original samples, but control plants remained disease free. Re-isolation and identification confirmed Koch's postulates. For molecular identification, genomic DNA of a representative isolate (MTL07081001) was extracted by modified CTAB method (1), and the rDNA-ITS region was amplified by using primers ITS1 (5-TCCGTAGGTGAACCTGCGG-3) and ITS4 (5-TCCTCCGCTTATTGATATGC-3). The 465-bp amplicon (GenBank Accession No. KF761293) was 100% identity to the sequence of M. roridum (JF724158.1) from GenBank. M. roridum has an extensive host range, covering 294 host plants (2). To our knowledge, this is the first record of leaf spot caused by M. roridum on calla lily in China. References: (1) F. M. Ausubel et al. Current Protocols in Molecular Biology. John Wiley & Sons Inc, New York, 1994. (2) D. F. Farr and A. Y. Rossman, Fungal Databases. Syst. Mycol. Microbiol. Lab., ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , October 2013. (3) M. T. Mmbaga et al. Plant Dis. 94:1266, 2010. (4) Y. X. Zhang et al. Plant Dis. 95:1030, 2011. (5) L. Zhu et al. J. Phytopathol. 161:59, 2013.

scholarly journals First record of the semi-slug Omalonyx unguis (d’Orbigny, 1837) (Gastropoda, Succineidae) in the Misiones Province, Argentina

Check List ◽  
2018 ◽  
Vol 14 (4) ◽  
pp. 705-712
Author(s):  
Leila B. Guzmán ◽  
Enzo N. Serniotti ◽  
Roberto E. Vogler ◽  
Ariel A. Beltramino ◽  
Alejandra Rumi ◽  
...  
Keyword(s):  
Dna Sequences ◽  
Morphological Characteristics ◽  
First Record ◽  
Coi Gene ◽  
Cytochrome Oxidase Subunit ◽  
Specific Identification ◽  
Molluscan Fauna ◽  
Misiones Province ◽  
Species Specific ◽  
Northeastern Argentina

Omalonyx unguis (d’Orbigny, 1837) is a semi-slug inhabiting the Paraná river basin. This species belongs to Succineidae, a family comprising a few representatives in South America. In this work, we provide the first record for the species from Misiones Province, Argentina. Previous records available for Omalonyx in Misiones were identified to the genus level. We examined morphological characteristics of the reproductive system and used DNA sequences from cytochrome oxidase subunit I (COI) gene for species-specific identification. These new distributional data contribute to consolidate the knowledge of the molluscan fauna in northeastern Argentina.

New data on gastropod genus Hirsuticyclus (Caenogastropoda, Cyclophoridae) from mid-Cretaceous Kachin amber

2021 ◽  
pp. SP521-2021-127
Author(s):  
Tingting Yu
Keyword(s):  
New Species ◽  
Type Species ◽  
Morphological Characteristics ◽  
Morphological Diversity ◽  
First Record ◽  
Land Snail ◽  
Generic Diagnosis ◽  
Burmese Amber ◽  
New Material ◽  
A New Species

AbstractThe genus Hirsuticyclus Neubauer, Xing & Jochum, 2019 was the first record of an exceptionally preserved land snail with dense periostracal hairs from mid-Cretaceous Kachin (Burmese) amber. Here we document four newly-discovered shells from Kachin amber, one belonging to the type species Hirsuticyclus electrum Neubauer, Xing & Jochum, 2019 and the remaining three shells belonging to a new species, Hirsuticyclus canaliculatus sp. nov. Well-preserved morphological characteristics of these two species could be clearly demonstrated under light microscopy combined with modern micro-CT scans with computer 3D reconstructions. Our new material of the type species amends the generic diagnosis based on a better-preserved shell including the peristome and operculum. The new species shows distinctive shell characteristics such as numerous spiral keels and a flaring, folded peristome interrupted by two canals. These excellently preserved fossils contribute to our understanding of the morphological diversity and evolution of these ancient members of cyclophoroids.

Sign in / Sign up

Export Citation Format

Share Document