Nitrogen regulator GlnR directly controls transcription ofprpDBCoperon involved in methylcitrate cycle inMycobacterium smegmatis

AbstractMycobacterium tuberculosisutilizes the fatty acids of the host as the carbon source. While the metabolism of odd chain fatty acids produces propionyl-CoA. Methylcitrate cycle is essential for Mycobacteria to utilize the propionyl-CoA to persist and grow on these fatty acids. InM. smegmatis, methylcitrate synthase, methylcitrate dehydratase, and methylisocitrate lyase involved in methylcitrate cycle were respectively encoded byprpC,prpD,and prpBin operonprpDBC. In this study, we found that the nitrogen regulator GlnR directly binds to the promoter region ofprpDBCoperon and inhibits its transcription. The typical binding sequence of GlnR was identified by bioinformatics analysis and electrophoretic mobility shift assay. The GlnR-binding motif was seperated by 164 bp with the binding site of PrpR which was a pathway-specific transcriptional activator of methylcitrate cycle. Moreover, the affinity constant of GlnR was much stronger than that of PrpR toprpDBC. The deletion ofglnRresulted in poor growth in propionate or cholesterol medium comparing with wild-type strain. The ΔglnRmutant strain also showed a higher survival in macrophages. These results illustrated that the nitrogen regulator GlnR regulated methylcitrate cycle through directly repressing the transcription ofprpDBCoperon. The finding reveals an unprecedented link between nitrogen metabolism and methylcitrate pathway, and provides a potential application for controlling populations of pathogenic mycobacteria.Author SummaryNutrients are crucial for the survival and pathogenicity ofMycobacterium tuberculosis. The success of this pathogen survival in macrophage due to its ability to assimilate fatty acids and cholesterol from host. The cholesterol and fatty acids are catabolized via β-oxidation to generate propionyl-CoA, which is then mainly metabolized via the methylcitrate cycle. The assimilation of propionyl-CoA needs to be tightly regulated to prevent its accumulation and alleviate toxicity in cell. Here, we identified a new regulator GlnR (the nitrogen transcriptional regulator) that repressed the transcription ofprpoperon involved in methylcitrate cycle inM. smegmatis. In this study, we found a typical GlnR binding box inprpoperon, and the affinity is much stronger than that of PrpR which is known as a pathway-specific transcriptional activator of methylcitrate cycle. In addition, deletion ofglnRobviously affect the growth of mutant in propionate or cholesterol medium, and show a better viability in macrophage. The findings not only provide the insights into the regulatory mechanism underlying crosstalk of nitrogen metabolism and carbon metabolism, but also reveal a potential application for controlling populations of pathogenic mycobacteria.

Download Full-text

The Nitrogen Regulator GlnR Directly Controls Transcription of theprpDBCOperon Involved in Methylcitrate Cycle inMycobacterium smegmatis

Journal of Bacteriology ◽

10.1128/jb.00099-19 ◽

2019 ◽

Vol 201 (8) ◽

Cited By ~ 1

Author(s):

Wei-Bing Liu ◽

Xin-Xin Liu ◽

Meng-Jia Shen ◽

Guo-Lan She ◽

Bang-Ce Ye

Keyword(s):

Fatty Acids ◽

Mycobacterium Tuberculosis ◽

Coenzyme A ◽

Transcriptional Activator ◽

Bioinformatic Analysis ◽

Binding Motif ◽

Mobility Shift ◽

Content Type ◽

Dnase I Footprinting ◽

Odd Chain Fatty Acids

ABSTRACTMycobacterium tuberculosisutilizes fatty acids of the host as the carbon source. Metabolism of odd-chain fatty acids byMycobacterium tuberculosisproduces propionyl coenzyme A (propionyl-CoA). The methylcitrate cycle is essential for mycobacteria to utilize the propionyl-CoA to persist and grow on these fatty acids. InM. smegmatis, methylcitrate synthase, methylcitrate dehydratase, and methylisocitrate lyase involved in the methylcitrate cycle are encoded byprpC,prpD,and prpB, respectively, in operonprpDBC. In this study, we found that the nitrogen regulator GlnR directly binds to the promoter region of theprpDBCoperon and inhibits its transcription. The binding motif of GlnR was identified by bioinformatic analysis and validated using DNase I footprinting and electrophoretic mobility shift assays. The GlnR-binding motif is separated by a 164-bp sequence from the binding site of PrpR, a pathway-specific transcriptional activator of methylcitrate cycle, but the binding affinity of GlnR toprpDBCis much stronger than that of PrpR. Deletion ofglnRresulted in faster growth in propionate or cholesterol medium compared with the wild-type strain. The ΔglnRmutant strain also showed a higher survival rate in macrophages. These results illustrated that the nitrogen regulator GlnR regulates the methylcitrate cycle through direct repression of the transcription of theprpDBCoperon. This finding not only suggests an unprecedented link between nitrogen metabolism and the methylcitrate pathway but also reveals a potential target for controlling the growth of pathogenic mycobacteria.IMPORTANCEThe success of mycobacteria survival in macrophage depends on its ability to assimilate fatty acids and cholesterol from the host. The cholesterol and fatty acids are catabolized via β-oxidation to generate propionyl coenzyme A (propionyl-CoA), which is then primarily metabolized via the methylcitrate cycle. Here, we found a typical GlnR binding box in theprpoperon, and the affinity is much stronger than that of PrpR, a transcriptional activator of methylcitrate cycle. Furthermore, GlnR repressed the transcription of theprpoperon. Deletion ofglnRsignificantly enhanced the growth ofMycobacterium tuberculosisin propionate or cholesterol medium, as well as viability in macrophages. These findings provide new insights into the regulatory mechanisms underlying the cross talk of nitrogen and carbon metabolisms in mycobacteria.

Download Full-text

Olf-1-binding site: characterization of an olfactory neuron-specific promoter motif

Molecular and Cellular Biology ◽

10.1128/mcb.13.5.3002-3014.1993 ◽

1993 ◽

Vol 13 (5) ◽

pp. 3002-3014

Author(s):

K Kudrycki ◽

C Stein-Izsak ◽

C Behn ◽

M Grillo ◽

R Akeson ◽

...

Keyword(s):

Nuclear Protein ◽

Consensus Sequence ◽

Binding Motif ◽

Sequence Motif ◽

Olfactory Neuron ◽

Sequence Motifs ◽

Mobility Shift ◽

Specific Expression ◽

Mobility Shift Assay

We report characterization of several domains within the 5' flanking region of the olfactory marker protein (OMP) gene that may participate in regulating transcription of this and other olfactory neuron-specific genes. Analysis by electrophoretic mobility shift assay and DNase I footprinting identifies two regions that contain a novel sequence motif. Interactions between this motif and nuclear proteins were detected only with nuclear protein extracts derived from olfactory neuroepithelium, and this activity is more abundant in olfactory epithelium enriched in immature neurons. We have designated a factor(s) involved in this binding as Olf-1. The Olf-1-binding motif consensus sequence was defined as TCCCC(A/T)NGGAG. Studies with transgenic mice indicate that a 0.3-kb fragment of the OMP gene containing one Olf-1 motif is sufficient for olfactory tissue-specific expression of the reporter gene. Some of the other identified sequence motifs also interact specifically with olfactory nuclear protein extracts. We propose that Olf-1 is a novel, olfactory neuron-specific trans-acting factor involved in the cell-specific expression of OMP.

Download Full-text

PDGF Up-regulates CSF-1 Gene Transcription in Ameloblast-like Cells

Journal of Dental Research ◽

10.1177/154405910808700105 ◽

2008 ◽

Vol 87 (1) ◽

pp. 33-38 ◽

Cited By ~ 3

Author(s):

Y. Wittrant ◽

B. Sriniketan Bhandari ◽

H. Abboud ◽

N. Benson ◽

K. Woodruff ◽

...

Keyword(s):

Dna Synthesis ◽

Binding Motif ◽

Rt Pcr ◽

Mobility Shift ◽

Protein Levels ◽

Macrophage Colony Stimulating Factor ◽

Cellular Pathways ◽

Mobility Shift Assay ◽

Macrophage Colony ◽

Stimulating Factor

Macrophage colony-stimulating factor (CSF-1) is a key regulatory cytokine for amelogenesis, and ameloblasts synthesize CSF-1. We hypothesized that PDGF stimulates DNA synthesis and regulates CSF-1 in these cells. We determined the effect of PDGF on CSF-1 expression using MEOE-3M ameloblasts as a model. By RT-PCR, MEOE-3M expressed PDGFRs and PDGF A- and B-chain mRNAs. PDGF-BB increased DNA synthesis and up-regulated CSF-1 mRNA and protein in MEOE-3M. Cells transfected with CSF-1 promoter deletion constructs were analyzed. A PDGF-responsive region between −1.7 and −0.795 kb, containing a consensus Pea3 binding motif, was identified. Electrophoretic mobility shift assay (EMSA) showed that PDGF-BB stimulated protein binding to this motif that was inhibited in the presence of anti-Pea3 antibody. Analysis of these data provides the first evidence that PDGF-BB is a mitogen for MEOE-3M and increases CSF-1 protein levels, predominantly by transcription. Elucidation of the cellular pathways that control CSF-1 expression may provide novel strategies for the regulation of enamel matrix formation.

Download Full-text

Olf-1-binding site: characterization of an olfactory neuron-specific promoter motif.

Molecular and Cellular Biology ◽

10.1128/mcb.13.5.3002 ◽

1993 ◽

Vol 13 (5) ◽

pp. 3002-3014 ◽

Cited By ~ 74

Author(s):

K Kudrycki ◽

C Stein-Izsak ◽

C Behn ◽

M Grillo ◽

R Akeson ◽

...

Keyword(s):

Nuclear Protein ◽

Consensus Sequence ◽

Binding Motif ◽

Sequence Motif ◽

Olfactory Neuron ◽

Sequence Motifs ◽

Mobility Shift ◽

Specific Expression ◽

Mobility Shift Assay

Download Full-text

HrpS Is a Global Regulator on Type III Secretion System (T3SS) and Non-T3SS Genes in Pseudomonas savastanoi pv. phaseolicola

Molecular Plant-Microbe Interactions ◽

10.1094/mpmi-02-18-0035-r ◽

2018 ◽

Vol 31 (12) ◽

pp. 1232-1243 ◽

Cited By ~ 4

Author(s):

Jingru Wang ◽

Xiaolong Shao ◽

Yingchao Zhang ◽

Yanan Zhu ◽

Pan Yang ◽

...

Keyword(s):

Type Iii Secretion ◽

Type Iii Secretion System ◽

Secretion System ◽

Binding Motif ◽

Global Regulator ◽

Promoter Regions ◽

Mobility Shift ◽

Type Iii ◽

Mobility Shift Assay ◽

The Individual

The type III secretion system (T3SS) is the main machinery for Pseudomonas savastanoi and other gram-negative bacteria to invade plant cells. HrpR and HrpS form a hetero-hexamer, which activates the expression of HrpL, which induces all T3SS genes by binding to a ‘hrp box’ in promoters. However, the individual molecular mechanism of HrpR or HrpS has not been fully understood. Through chromatin immunoprecipitation coupled to high-throughput DNA sequencing, we found that HrpR, HrpS, and HrpL had four, 47, and 31 targets on the genome, respectively. HrpS directly bound to the promoter regions of a group of T3SS genes and non-T3SS genes. HrpS independently regulated these genes in a hrpL deletion strain. Additionally, a HrpS-binding motif (GTGCCAAA) was identified, which was verified by electrophoretic mobility shift assay and lux-reporter assay. HrpS also regulated motility and biofilm formation in P. savastanoi. The present study strongly suggests that HrpS alone can work as a global regulator on both T3SS and non-T3SS genes in P. savastanoi. [Formula: see text] Copyright © 2018 The Author(s). This is an open-access article distributed under the CC BY-NC-ND 4.0 International license .

Download Full-text

PbaR, an IclR Family Transcriptional Activator for the Regulation of the 3-Phenoxybenzoate 1′,2′-Dioxygenase Gene Cluster in Sphingobium wenxiniae JZ-1T

Applied and Environmental Microbiology ◽

10.1128/aem.02122-15 ◽

2015 ◽

Vol 81 (23) ◽

pp. 8084-8092 ◽

Cited By ~ 5

Author(s):

Minggen Cheng ◽

Kai Chen ◽

Suhui Guo ◽

Xing Huang ◽

Jian He ◽

...

Keyword(s):

Binding Site ◽

Gene Cluster ◽

Transcriptional Start Site ◽

Transcriptional Activator ◽

Transcriptional Regulators ◽

Mobility Shift ◽

Content Type ◽

Dnase I Footprinting ◽

Dioxygenase Gene ◽

Mobility Shift Assay

ABSTRACTThe 3-phenoxybenzoate (3-PBA) 1′,2′-dioxygenase gene cluster (pbaA1A2Bcluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed inSphingobium wenxiniaestrain JZ-1Tby its substrate 3-PBA. In this study, we identified a transcriptional activator of thepbaA1A2Bcluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 inSphingomonassp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of thepbaA1A2Bcluster in response to 3-PBA in strain JZ-1T. However, PbaR does not regulate the reductase component genepbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in thepbaA1A2Bpromoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the −10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1T, and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators.

Download Full-text

Wilms tumor suppressor, Wt1, is a transcriptional activator of the erythropoietin gene

Blood ◽

10.1182/blood-2005-07-2889 ◽

2006 ◽

Vol 107 (11) ◽

pp. 4282-4290 ◽

Cited By ~ 48

Author(s):

Christof Dame ◽

Karin M. Kirschner ◽

Katharina V. Bartz ◽

Thomas Wallach ◽

Christiane S. Hussels ◽

...

Keyword(s):

Tumor Suppressor ◽

Molecular Mechanisms ◽

Wilms Tumor ◽

Transcriptional Activator ◽

Mobility Shift ◽

Specific Expression ◽

Tissue Specific ◽

Hek 293 ◽

Mobility Shift Assay ◽

Specific Regulation

AbstractMolecular mechanisms for the developmental stage and tissue-specific regulation of the erythropoietin (EPO) gene are poorly understood. Recent findings indicate a role of the Wilms tumor suppressor, Wt1, in the formation of the hematopoietic system. Herein, we tested the hypothesis that Wt1 is a transcriptional regulator of the EPO gene. Binding of the transcriptionally competent Wt1(–KTS) isoform to the minimal EPO promoter was demonstrated by electrophoretic mobility shift assay and chromatin immunoprecipitation. Under normoxia, EPO expression was significantly increased in HEK 293 and HepG2 cells with forced expression of Wt1(–KTS). A reporter construct harboring the 117-bp minimal human EPO promoter was activated up to 20-fold by transient cotransfection of Wt1(–KTS) in different cell lines. Mutation of the Wt1 binding site in the EPO promoter abrogated this stimulatory effect of the Wt1(–KTS) protein. Hepatic Epo mRNA expression was significantly reduced in embryonic mice with homozygous Wt1 deletion. Furthermore, Wt1 and EPO were colocalized in hepatocytes of the liver and in neuronal cells of the dorsal root ganglia in developing mice. Both proteins were also detected in Sertoli cells of the adult murine testis. In conclusion, we identified Wt1(–KTS) as a novel transcriptional activator for the tissue-specific expression of the EPO gene.

Download Full-text

Of the GATA-binding proteins, only GATA-4 selectively regulates the human interleukin-5 gene promoter in interleukin-5-producing cells which express multiple GATA-binding proteins.

Molecular and Cellular Biology ◽

10.1128/mcb.15.7.3830 ◽

1995 ◽

Vol 15 (7) ◽

pp. 3830-3839 ◽

Cited By ~ 64

Author(s):

T Yamagata ◽

J Nishida ◽

R Sakai ◽

T Tanaka ◽

H Honda ◽

...

Keyword(s):

Binding Proteins ◽

Regulatory Element ◽

Gene Promoter ◽

Nuclear Extract ◽

Proximal Promoter ◽

Binding Motif ◽

Mobility Shift ◽

Cis Acting ◽

Interleukin 5 ◽

Mobility Shift Assay

Interleukin-5 (IL-5) is produced by T lymphocytes and known to support B-cell growth and eosinophilic differentiation of the progenitor cells. Using ATL-16T cells which express IL-5 mRNA, we have identified a region within the human IL-5 gene promoter that regulates IL-5 gene transcription. This cis-acting sequence contains the core binding motif, (A/T)GATA(A/G), for GATA-binding family proteins and thus suggests the involvement of this family members. In this report, we describe the cloning of human GATA-4 (hGATA-4) and show that hGATA-4 selectively interacts with the -70 GATA site within the IL-5 proximal promoter region. By promoter deletion and mutation analyses, we established this region as a positive regulatory element. Cotransfection experiments revealed that both hGATA-4 and phorbol-12-myristate-13-acetate (PMA)-A23187 stimulation are necessary for IL-5 promoter activation. The requirement for another regulatory element called CLE0, which lies downstream of the -70 GATA site, was also demonstrated. ATL-16T cells express mRNAs of three GATA-binding proteins, hGATA-2, hGATA-3, and hGATA-4, and each of them has a potential to bind to the consensus (A/T)GATA(G/A) motif. However, using ATL-16T nuclear extract, we demonstrated that GATA-4 is the only GATA-binding protein that forms a specific DNA-protein complex with the -70 GATA site. An electrophoretic mobility shift assay with extracts of COS cells expressing GATA-binding proteins showed that GATA-4 has the highest binding affinity for the -70 GATA site among the three GATA-binding proteins. When the transactivation abilities were compared among the three, GATA-4 showed the highest activity. These results demonstrate the selective role of GATA-4 in the transcriptional regulation of the IL-5 gene in a circumstance where multiple members of the GATA-binding proteins are expressed.

Download Full-text

Diastereomeric Recognition of 5',8-cyclo-2'-deoxyadenosine Lesions by Human poly(ADP-ribose) Polymerase 1 in Biomimetic Model

10.20944/preprints201812.0293.v1 ◽

2018 ◽

Author(s):

Annalisa Masi ◽

Arianna Sabbia ◽

Carla Ferreri ◽

Francesco Manoli ◽

Yanhao Lai ◽

...

Keyword(s):

Excision Repair ◽

Strand Break ◽

Dna Lesions ◽

Affinity Constant ◽

Mobility Shift ◽

New Finding ◽

Mobility Shift Assay ◽

Low Efficiency ◽

Gel Mobility Shift

Abstract5′,8-Cyclo-2′-deoxyadenosine (cdA), in the 5′R and 5′Sdiastereomeric forms, are typical non strand-break oxidative DNA lesions, induced by hydroxyl radicals, with emerging importance as a molecular marker. These lesions are exclusively repaired by nucleotide excision repair (NER) mechanism with a low efficiency, thus readily accumulating in the genome. Poly(ADP-ribose) polymerase1 (PARP1) acts as an early responder to DNA damage and plays a key role as a nick sensor in the maintenance of the integrity of the genome by recognizing nicked DNA. So far, it was unknown whether the diastereomeric cdA lesions could induce specific PARP1 binding. Here we provide the first evidence of PARP1 to selectively recognize the diastereomeric lesions 5′S-cdA and 5′R-cdA in vitro as compared to deoxyadenosine in model DNA substrates (23-mers) by using circular dichroism,fluorescence spectroscopy, immunoblotting analysis and gel mobility shift assay. Several features of the recognition of the damaged and undamaged oligonucleotides by PARP1were characterized. Remarkably, PARP1 efficiently binds to both cdA lesions in the double stranded (ds)-oligonucleotides. In particular, PARP1 proved to bind 5′S-cdAwith a higher affinity constant for the 5'S lesion in a model of ds DNA than 5′R-cdA, showing different recognition patterns, also compared with undamaged dA. This new finding highlights the ability of PARP1 to recognize and differentiate the distorted DNA backbone in a biomimetic system caused by different diastereomeric forms of a cdA lesion.

Download Full-text

Transcriptional regulation of the l-lactate permease gene lutP by the LutR repressor of Bacillus subtilis RO-NN-1

Microbiology ◽

10.1099/mic.0.079806-0 ◽

2014 ◽

Vol 160 (10) ◽

pp. 2178-2189 ◽

Cited By ~ 4

Author(s):

Kuo-Chin Chiu ◽

Chen-Jyun Lin ◽

Gwo-Chyuan Shaw

Keyword(s):

Bacillus Subtilis ◽

Dna Binding ◽

Binding Site ◽

Repeat Sequence ◽

Full Length ◽

Binding Motif ◽

Mobility Shift ◽

Mobility Shift Assay ◽

Reporter Gene Analysis

The Bacillus subtilis lutABC operon encodes three iron–sulfur-containing proteins required for l-lactate utilization and involved in biofilm formation. The transcriptional regulator LutR of the GntR family negatively controls lutABC expression. The lutP gene, which is situated immediately upstream of lutR, encodes an l-lactate permease. Here, we show that lutP expression can be strongly induced by l-lactate and is subject to partial catabolite repression by glucose. Disruption of the lutR gene led to a strong derepression of lutP and no further induction by l-lactate, suggesting that the LutR repressor can also negatively control lutP expression. Electrophoretic mobility shift assay revealed a LutR-binding site located downstream of the promoter of lutA or lutP and containing a consensus inverted repeat sequence 5′-TCATC-N1-GATGA-3′. Reporter gene analysis showed that deletion of each LutR-binding site caused a strong derepression of lutA or lutP. These results indicated that these two LutR-binding sites can function as operators in vivo. Moreover, deletion analysis identified a DNA segment upstream of the lutP promoter to be important for lutP expression. In contrast to the truncated LutR of laboratory strains 168 and PY79, the full-length LutR of the undomesticated strain RO-NN-1, and probably many other B. subtilis strains, can directly and negatively regulate lutP transcription. The absence or presence of the N-terminal 21 aa of the full-length LutR, which encompass a small part of the predicted winged helix–turn–helix DNA-binding motif, may probably alter the DNA-binding specificity or affinity of LutR.

Download Full-text