The Nitrogen Regulator GlnR Directly Controls Transcription of theprpDBCOperon Involved in Methylcitrate Cycle inMycobacterium smegmatis

ABSTRACTMycobacterium tuberculosisutilizes fatty acids of the host as the carbon source. Metabolism of odd-chain fatty acids byMycobacterium tuberculosisproduces propionyl coenzyme A (propionyl-CoA). The methylcitrate cycle is essential for mycobacteria to utilize the propionyl-CoA to persist and grow on these fatty acids. InM. smegmatis, methylcitrate synthase, methylcitrate dehydratase, and methylisocitrate lyase involved in the methylcitrate cycle are encoded byprpC,prpD,and prpB, respectively, in operonprpDBC. In this study, we found that the nitrogen regulator GlnR directly binds to the promoter region of theprpDBCoperon and inhibits its transcription. The binding motif of GlnR was identified by bioinformatic analysis and validated using DNase I footprinting and electrophoretic mobility shift assays. The GlnR-binding motif is separated by a 164-bp sequence from the binding site of PrpR, a pathway-specific transcriptional activator of methylcitrate cycle, but the binding affinity of GlnR toprpDBCis much stronger than that of PrpR. Deletion ofglnRresulted in faster growth in propionate or cholesterol medium compared with the wild-type strain. The ΔglnRmutant strain also showed a higher survival rate in macrophages. These results illustrated that the nitrogen regulator GlnR regulates the methylcitrate cycle through direct repression of the transcription of theprpDBCoperon. This finding not only suggests an unprecedented link between nitrogen metabolism and the methylcitrate pathway but also reveals a potential target for controlling the growth of pathogenic mycobacteria.IMPORTANCEThe success of mycobacteria survival in macrophage depends on its ability to assimilate fatty acids and cholesterol from the host. The cholesterol and fatty acids are catabolized via β-oxidation to generate propionyl coenzyme A (propionyl-CoA), which is then primarily metabolized via the methylcitrate cycle. Here, we found a typical GlnR binding box in theprpoperon, and the affinity is much stronger than that of PrpR, a transcriptional activator of methylcitrate cycle. Furthermore, GlnR repressed the transcription of theprpoperon. Deletion ofglnRsignificantly enhanced the growth ofMycobacterium tuberculosisin propionate or cholesterol medium, as well as viability in macrophages. These findings provide new insights into the regulatory mechanisms underlying the cross talk of nitrogen and carbon metabolisms in mycobacteria.

Download Full-text

Nitrogen regulator GlnR directly controls transcription ofprpDBCoperon involved in methylcitrate cycle inMycobacterium smegmatis

10.1101/353219 ◽

2018 ◽

Cited By ~ 1

Author(s):

Xin-Xin Liu ◽

Wei-Bing Liu ◽

Meng-Jia Shen ◽

Bang-Ce Ye

Keyword(s):

Fatty Acids ◽

Mycobacterium Tuberculosis ◽

Nitrogen Metabolism ◽

Potential Application ◽

Transcriptional Activator ◽

Affinity Constant ◽

Binding Motif ◽

Mobility Shift ◽

Poor Growth ◽

Mobility Shift Assay

AbstractMycobacterium tuberculosisutilizes the fatty acids of the host as the carbon source. While the metabolism of odd chain fatty acids produces propionyl-CoA. Methylcitrate cycle is essential for Mycobacteria to utilize the propionyl-CoA to persist and grow on these fatty acids. InM. smegmatis, methylcitrate synthase, methylcitrate dehydratase, and methylisocitrate lyase involved in methylcitrate cycle were respectively encoded byprpC,prpD,and prpBin operonprpDBC. In this study, we found that the nitrogen regulator GlnR directly binds to the promoter region ofprpDBCoperon and inhibits its transcription. The typical binding sequence of GlnR was identified by bioinformatics analysis and electrophoretic mobility shift assay. The GlnR-binding motif was seperated by 164 bp with the binding site of PrpR which was a pathway-specific transcriptional activator of methylcitrate cycle. Moreover, the affinity constant of GlnR was much stronger than that of PrpR toprpDBC. The deletion ofglnRresulted in poor growth in propionate or cholesterol medium comparing with wild-type strain. The ΔglnRmutant strain also showed a higher survival in macrophages. These results illustrated that the nitrogen regulator GlnR regulated methylcitrate cycle through directly repressing the transcription ofprpDBCoperon. The finding reveals an unprecedented link between nitrogen metabolism and methylcitrate pathway, and provides a potential application for controlling populations of pathogenic mycobacteria.Author SummaryNutrients are crucial for the survival and pathogenicity ofMycobacterium tuberculosis. The success of this pathogen survival in macrophage due to its ability to assimilate fatty acids and cholesterol from host. The cholesterol and fatty acids are catabolized via β-oxidation to generate propionyl-CoA, which is then mainly metabolized via the methylcitrate cycle. The assimilation of propionyl-CoA needs to be tightly regulated to prevent its accumulation and alleviate toxicity in cell. Here, we identified a new regulator GlnR (the nitrogen transcriptional regulator) that repressed the transcription ofprpoperon involved in methylcitrate cycle inM. smegmatis. In this study, we found a typical GlnR binding box inprpoperon, and the affinity is much stronger than that of PrpR which is known as a pathway-specific transcriptional activator of methylcitrate cycle. In addition, deletion ofglnRobviously affect the growth of mutant in propionate or cholesterol medium, and show a better viability in macrophage. The findings not only provide the insights into the regulatory mechanism underlying crosstalk of nitrogen metabolism and carbon metabolism, but also reveal a potential application for controlling populations of pathogenic mycobacteria.

Download Full-text

PbaR, an IclR Family Transcriptional Activator for the Regulation of the 3-Phenoxybenzoate 1′,2′-Dioxygenase Gene Cluster in Sphingobium wenxiniae JZ-1T

Applied and Environmental Microbiology ◽

10.1128/aem.02122-15 ◽

2015 ◽

Vol 81 (23) ◽

pp. 8084-8092 ◽

Cited By ~ 5

Author(s):

Minggen Cheng ◽

Kai Chen ◽

Suhui Guo ◽

Xing Huang ◽

Jian He ◽

...

Keyword(s):

Binding Site ◽

Gene Cluster ◽

Transcriptional Start Site ◽

Transcriptional Activator ◽

Transcriptional Regulators ◽

Mobility Shift ◽

Content Type ◽

Dnase I Footprinting ◽

Dioxygenase Gene ◽

Mobility Shift Assay

ABSTRACTThe 3-phenoxybenzoate (3-PBA) 1′,2′-dioxygenase gene cluster (pbaA1A2Bcluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed inSphingobium wenxiniaestrain JZ-1Tby its substrate 3-PBA. In this study, we identified a transcriptional activator of thepbaA1A2Bcluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 inSphingomonassp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of thepbaA1A2Bcluster in response to 3-PBA in strain JZ-1T. However, PbaR does not regulate the reductase component genepbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in thepbaA1A2Bpromoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the −10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1T, and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators.

Download Full-text

HpdR Is a Transcriptional Activator of Sinorhizobium meliloti hpdA, Which Encodes a Herbicide-Targeted 4-Hydroxyphenylpyruvate Dioxygenase

Journal of Bacteriology ◽

10.1128/jb.01662-06 ◽

2007 ◽

Vol 189 (9) ◽

pp. 3660-3664 ◽

Cited By ~ 6

Author(s):

Suvit Loprasert ◽

Wirongrong Whangsuk ◽

James M. Dubbs ◽

Ratiboot Sallabhan ◽

Kumpanart Somsongkul ◽

...

Keyword(s):

Sinorhizobium Meliloti ◽

Transcriptional Activator ◽

Direct Repeat ◽

Dnase I ◽

Mobility Shift ◽

Intergenic Space ◽

Repeat Sequences ◽

Dnase I Footprinting ◽

Gel Mobility Shift

ABSTRACT Sinorhizobium meliloti hpdA, which encodes the herbicide target 4-hydroxyphenylpyruvate dioxygenase, is positively regulated by HpdR. Gel mobility shift and DNase I footprinting analyses revealed that HpdR binds to a region that spans two conserved direct-repeat sequences within the hpdR-hpdA intergenic space. HpdR-dependent hpdA transcription occurs in the presence of 4-hydroxyphenylpyruvate, tyrosine, and phenylalanine, as well as during starvation.

Download Full-text

Biochemical and Structural Characterization of an Essential Acyl Coenzyme A Carboxylase from Mycobacterium tuberculosis

Journal of Bacteriology ◽

10.1128/jb.188.2.477-486.2006 ◽

2006 ◽

Vol 188 (2) ◽

pp. 477-486 ◽

Cited By ~ 59

Author(s):

Gabriela Gago ◽

Daniel Kurth ◽

Lautaro Diacovich ◽

Shiou-Chuan Tsai ◽

Hugo Gramajo

Keyword(s):

Fatty Acids ◽

Mycobacterium Tuberculosis ◽

Coenzyme A ◽

Physiological Role ◽

Kinetic Properties ◽

Aliphatic Chain ◽

Heterologous Protein Expression ◽

Main Role ◽

Enzyme Complex ◽

Protein Expression And Purification

ABSTRACT Pathogenic mycobacteria contain a variety of unique fatty acids that have methyl branches at an even-numbered position at the carboxyl end and a long n-aliphatic chain. One such group of acids, called mycocerosic acids, is found uniquely in the cell wall of pathogenic mycobacteria, and their biosynthesis is essential for growth and pathogenesis. Therefore, the biosynthetic pathway of the unique precursor of such lipids, methylmalonyl coenzyme A (CoA), represents an attractive target for developing new antituberculous drugs. Heterologous protein expression and purification of the individual subunits allowed the successful reconstitution of an essential acyl-CoA carboxylase from Mycobacterium tuberculosis, whose main role appears to be the synthesis of methylmalonyl-CoA. The enzyme complex was reconstituted from the α biotinylated subunit AccA3, the carboxyltransferase β subunit AccD5, and the ε subunit AccE5 (Rv3281). The kinetic properties of this enzyme showed a clear substrate preference for propionyl-CoA compared with acetyl-CoA (specificity constant fivefold higher), indicating that the main physiological role of this enzyme complex is to generate methylmalonyl-CoA for the biosynthesis of branched-chain fatty acids. The α and β subunits are capable of forming a stable α6-β6 subcomplex but with very low specific activity. The addition of the ε subunit, which binds tightly to the α-β subcomplex, is essential for gaining maximal enzyme activity.

Download Full-text

Transcriptional Activation of Multiple Operons Involved inpara-Nitrophenol Degradation by Pseudomonas sp. Strain WBC-3

Applied and Environmental Microbiology ◽

10.1128/aem.02720-14 ◽

2014 ◽

Vol 81 (1) ◽

pp. 220-230 ◽

Cited By ~ 22

Author(s):

Wen-Mao Zhang ◽

Jun-Jie Zhang ◽

Xuan Jiang ◽

Hongjun Chao ◽

Ning-Yi Zhou

Keyword(s):

Transcriptional Activation ◽

Transcriptional Regulator ◽

Pseudomonas Sp ◽

Mobility Shift ◽

Content Type ◽

High Affinity ◽

Dnase I Footprinting ◽

Nitrophenol Degradation ◽

Transcriptional Start Sites ◽

Electrophoretic Mobility Shift Assays

ABSTRACTPseudomonassp. strain WBC-3 utilizespara-nitrophenol (PNP) as a sole carbon and energy source. The genes involved in PNP degradation are organized in the following three operons:pnpA,pnpB, andpnpCDEFG. How the expression of the genes is regulated is unknown. In this study, an LysR-type transcriptional regulator (LTTR) is identified to activate the expression of the genes in response to the specific inducer PNP. While the LTTR coding genepnpRwas found to be not physically linked to any of the three catabolic operons, it was shown to be essential for the growth of strain WBC-3 on PNP. Furthermore, PnpR positively regulated its own expression, which is different from the function of classical LTTRs. A regulatory binding site (RBS) with a 17-bp imperfect palindromic sequence (GTT-N11-AAC) was identified in allpnpA,pnpB,pnpC, andpnpRpromoters. Through electrophoretic mobility shift assays and mutagenic analyses, this motif was proven to be necessary for PnpR binding. This consensus motif is centered at positions approximately −55 bp relative to the four transcriptional start sites (TSSs). RBS integrity was required for both high-affinity PnpR binding and transcriptional activation ofpnpA,pnpB, andpnpR. However, this integrity was essential only for high-affinity PnpR binding to the promoter ofpnpCDEFGand not for its activation. Intriguingly, unlike other LTTRs studied, no changes in lengths of the PnpR binding regions of thepnpAandpnpBpromoters were observed after the addition of the inducer PNP in DNase I footprinting.

Download Full-text

Negative Regulation of Ectoine Uptake and Catabolism in Sinorhizobium meliloti: Characterization of the EhuR Gene

Journal of Bacteriology ◽

10.1128/jb.00119-16 ◽

2016 ◽

Vol 199 (1) ◽

Cited By ~ 6

Author(s):

Qinli Yu ◽

Hanlin Cai ◽

Yanfeng Zhang ◽

Yongzhi He ◽

Lincai Chen ◽

...

Keyword(s):

Dna Binding ◽

Sinorhizobium Meliloti ◽

Binding Activity ◽

Mobility Shift ◽

Content Type ◽

Reverse Transcription Pcr ◽

Dna Binding Activity ◽

Dnase I Footprinting ◽

Gntr Family

ABSTRACT Ectoine has osmoprotective effects on Sinorhizobium meliloti that differ from its effects in other bacteria. Ectoine does not accumulate in S. meliloti cells; instead, it is degraded. The products of the ehuABCD-eutABCDE operon were previously discovered to be responsible for the uptake and catabolism of ectoine in S. meliloti. However, the mechanism by which ectoine is involved in the regulation of the ehuABCD-eutABCDE operon remains unclear. The ehuR gene, which is upstream of and oriented in the same direction as the ehuABCD-eutABCDE operon, encodes a member of the MocR/GntR family of transcriptional regulators. Quantitative reverse transcription-PCR and promoter-lacZ reporter fusion experiments revealed that EhuR represses transcription of the ehuABCD-eutABCDE operon, but this repression is inhibited in the presence of ectoine. Electrophoretic mobility shift assays and DNase I footprinting assays revealed that EhuR bound specifically to the DNA regions overlapping the −35 region of the ehuA promoter and the +1 region of the ehuR promoter. Surface plasmon resonance assays further demonstrated direct interactions between EhuR and the two promoters, although EhuR was found to have higher affinity for the ehuA promoter than for the ehuR promoter. In vitro, DNA binding by EhuR could be directly inhibited by a degradation product of ectoine. Our work demonstrates that EhuR is an important negative transcriptional regulator involved in the regulation of ectoine uptake and catabolism and is likely regulated by one or more end products of ectoine catabolism. IMPORTANCE Sinorhizobium meliloti is an important soil bacterium that displays symbiotic interactions with legume hosts. Ectoine serves as a key osmoprotectant for S. meliloti. However, ectoine does not accumulate in the cells; rather, it is degraded. In this study, we characterized the transcriptional regulation of the operon responsible for ectoine uptake and catabolism in S. meliloti. We identified and characterized the transcription repressor EhuR, which is the first MocR/GntR family member found to be involved in the regulation of compatible solute uptake and catabolism. More importantly, we demonstrated for the first time that an ectoine catabolic end product could modulate EhuR DNA-binding activity. Therefore, this work provides new insights into the unique mechanism of ectoine-induced osmoprotection in S. meliloti.

Download Full-text

Regulation ofperRExpression by Iron and PerR in Campylobacter jejuni

Journal of Bacteriology ◽

10.1128/jb.05493-11 ◽

2011 ◽

Vol 193 (22) ◽

pp. 6171-6178 ◽

Cited By ~ 17

Author(s):

Minkyeong Kim ◽

Sunyoung Hwang ◽

Sangryeol Ryu ◽

Byeonghwa Jeon

Keyword(s):

Oxidative Stress ◽

Campylobacter Jejuni ◽

Regulatory Region ◽

Transcriptional Level ◽

Mobility Shift ◽

Content Type ◽

Dnase I Footprinting ◽

Transcriptional Changes ◽

Electrophoretic Mobility Shift Assays ◽

Binding Sequence

Campylobacter jejuniis a leading food-borne pathogen causing gastroenteritis in humans. Although OxyR is a widespread oxidative stress regulator in many Gram-negative bacteria,C. jejunilacks OxyR and instead possesses the metalloregulator PerR. Despite the important role played by PerR in oxidative stress defense, little is known about the factors influencingperRexpression inC. jejuni. In this study, aperRpromoter-lacZfusion assay demonstrated that iron significantly reduced the level ofperRtranscription, whereas other metal ions, such as copper, cobalt, manganese, and zinc, did not affectperRtranscription. Notably, aperRmutation substantially increased the level ofperRtranscription and intranscomplementation restored the transcriptional changes, suggestingperRis transcriptionally autoregulated inC. jejuni. In theperRmutant, iron did not repressperRtranscription, indicating the iron dependence ofperRexpression results fromperRautoregulation. Electrophoretic mobility shift assays showed that PerR binds to theperRpromoter, and DNase I footprinting assays identified a PerR binding site overlapping the −35 region of the twoperRpromoters, further supportingperRautoregulation at the transcriptional level. Alignment of the PerR binding sequence in theperRpromoter with the regulatory region of other PerR regulon genes ofC. jejunirevealed a 16-bp consensus PerR binding sequence, which shares high similarities to theBacillus subtilisPerR box. The results of this study demonstrated that PerR directly interacts with theperRpromoter and regulatesperRtranscription and thatperRautoregulation is responsible for the repression ofperRtranscription by iron inC. jejuni.

Download Full-text

Epimerase (Msed_0639) and Mutase (Msed_0638 and Msed_2055) Convert (S)-Methylmalonyl-Coenzyme A (CoA) to Succinyl-CoA in the Metallosphaera sedula 3-Hydroxypropionate/4-Hydroxybutyrate Cycle

Applied and Environmental Microbiology ◽

10.1128/aem.01312-12 ◽

2012 ◽

Vol 78 (17) ◽

pp. 6194-6202 ◽

Cited By ~ 19

Author(s):

Yejun Han ◽

Aaron S. Hawkins ◽

Michael W. W. Adams ◽

Robert M. Kelly

Keyword(s):

Metal Binding ◽

Active Sites ◽

Coenzyme A ◽

Divalent Cations ◽

Growth Conditions ◽

Binding Motif ◽

Sequence Alignments ◽

Content Type ◽

Metallosphaera Sedula ◽

Coenzyme B

ABSTRACTCrenarchaeotal genomes encode the 3-hydroxypropionate/4-hydroxybutyrate (3-HP/4-HB) cycle for carbon dioxide fixation. Of the 13 enzymes putatively comprising the cycle, several of them, including methylmalonyl-coenzyme A (CoA) epimerase (MCE) and methylmalonyl-CoA mutase (MCM), which convert (S)-methylmalonyl-CoA to succinyl-CoA, have not been confirmed and characterized biochemically. In the genome ofMetallosphaera sedula(optimal temperature [Topt], 73°C), the gene encoding MCE (Msed_0639) is adjacent to that encoding the catalytic subunit of MCM-α (Msed_0638), while the gene for the coenzyme B12-binding subunit of MCM (MCM-β) is located remotely (Msed_2055). The expression of all three genes was significantly upregulated under autotrophic compared to heterotrophic growth conditions, implying a role in CO2fixation. Recombinant forms of MCE and MCM were produced inEscherichia coli; soluble, active MCM was produced only if MCM-α and MCM-β were coexpressed. MCE is a homodimer and MCM is a heterotetramer (α2β2) with specific activities of 218 and 2.2 μmol/min/mg, respectively, at 75°C. The heterotetrameric MCM differs from the homo- or heterodimeric orthologs in other organisms. MCE was activated by divalent cations (Ni2+, Co2+, and Mg2+), and the predicted metal binding/active sites were identified through sequence alignments with less-thermophilic MCEs. The conserved coenzyme B12-binding motif (DXHXXG-SXL-GG) was identified inM. sedulaMCM-β. The two enzymes together catalyzed the two-step conversion of (S)-methylmalonyl-CoA to succinyl-CoA, consistent with their proposed role in the 3-HP/4-HB cycle. Based on the highly conserved occurrence of single copies of MCE and MCM inSulfolobaceaegenomes, theM. sedulaenzymes are likely to be representatives of these enzymes in the 3-HP/4-HB cycle in crenarchaeal thermoacidophiles.

Download Full-text

Multiple Propionyl Coenzyme A-Supplying Pathways for Production of the Bioplastic Poly(3-Hydroxybutyrate-co-3-Hydroxyvalerate) in Haloferax mediterranei

Applied and Environmental Microbiology ◽

10.1128/aem.03915-12 ◽

2013 ◽

Vol 79 (9) ◽

pp. 2922-2931 ◽

Cited By ~ 49

Author(s):

Jing Han ◽

Jing Hou ◽

Fan Zhang ◽

Guomin Ai ◽

Ming Li ◽

...

Keyword(s):

Metabolic Flux ◽

Coenzyme A ◽

Molar Fraction ◽

Carbon Sources ◽

Bioinformatic Analysis ◽

Flux Analysis ◽

The Novel ◽

Haloferax Mediterranei ◽

Content Type ◽

First Time

ABSTRACTHaloferax mediterraneiis able to accumulate the bioplastic poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV) with more than 10 mol% 3-hydroxyvalerate (3HV) from unrelated carbon sources. However, the pathways that produce propionyl coenzyme A (propionyl-CoA), an important precursor of 3HV monomer, have not yet been determined. Bioinformatic analysis ofH. mediterraneigenome indicated that this strain uses multiple pathways for propionyl-CoA biosynthesis, including the citramalate/2-oxobutyrate pathway, the aspartate/2-oxobutyrate pathway, the methylmalonyl-CoA pathway, and a novel 3-hydroxypropionate pathway. Cofeeding of pathway intermediates and inactivating pathway-specific genes supported that these four pathways were indeed involved in the biosynthesis of 3HV monomer. The novel 3-hydroxypropionate pathway that couples CO2assimilation with PHBV biosynthesis was further confirmed by analysis of13C positional enrichment in 3HV. Notably,13C metabolic flux analysis showed that the citramalate/2-oxobutyrate pathway (53.0% flux) and the 3-hydroxypropionate pathway (30.6% flux) were the two main generators of propionyl-CoA from glucose. In addition, genetic perturbation on the transcriptome of the ΔphaECmutant (deficient in PHBV accumulation) revealed that a considerable number of genes in the four propionyl-CoA synthetic pathways were significantly downregulated. We determined for the first time four propionyl-CoA-supplying pathways for PHBV production in haloarchaea, particularly including a new 3-hydroxypropionate pathway. These results would provide novel strategies for the production of PHBV with controllable 3HV molar fraction.

Download Full-text

RegR Virulence Regulon of Rabbit-Specific Enteropathogenic Escherichia coli Strain E22

Infection and Immunity ◽

10.1128/iai.01325-12 ◽

2013 ◽

Vol 81 (4) ◽

pp. 1078-1089 ◽

Cited By ~ 7

Author(s):

Yogitha N. Srikhanta ◽

Dianna M. Hocking ◽

Judyta Praszkier ◽

Matthew J. Wakefield ◽

Roy M. Robins-Browne ◽

...

Keyword(s):

Escherichia Coli ◽

Regulatory Protein ◽

Bioinformatic Analysis ◽

Coli Strain ◽

Mobility Shift ◽

Gene Encoding ◽

Gene Target ◽

Content Type ◽

E Coli ◽

Genes Encoding

ABSTRACTAraC-like regulators play a key role in the expression of virulence factors in enteric pathogens, such as enteropathogenicEscherichia coli(EPEC), enterotoxigenicE. coli, enteroaggregativeE. coli, andCitrobacter rodentium. Bioinformatic analysis of the genome of rabbit-specific EPEC (REPEC) strain E22 (O103:H2) revealed the presence of a gene encoding an AraC-like regulatory protein, RegR, which shares 71% identity to the global virulence regulator, RegA, ofC. rodentium. Microarray analysis demonstrated that RegR exerts 25- to 400-fold activation on transcription of several genes encoding putative virulence-associated factors, including a fimbrial operon (SEF14), a serine protease, and an autotransporter adhesin. These observations were confirmed by proteomic analysis of secreted and heat-extracted surface-associated proteins. The mechanism of RegR-mediated activation was investigated by using its most highly upregulated gene target,sefA. Transcriptional analyses and electrophoretic mobility shift assays showed that RegR activates the expression ofsefAby binding to a region upstream of thesefApromoter, thereby relieving gene silencing by the global regulatory protein H-NS. Moreover, RegR was found to contribute significantly to virulence in a rabbit infection experiment. Taken together, our findings indicate that RegR controls the expression of a series of accessory adhesins that significantly enhance the virulence of REPEC strain E22.

Download Full-text