scholarly journals Isolation and Identification of Novel Microcystin-Degrading Bacteria

2009 ◽  
Vol 75 (21) ◽  
pp. 6924-6928 ◽  
Author(s):  
Pathmalal M. Manage ◽  
Christine Edwards ◽  
Brajesh K. Singh ◽  
Linda A. Lawton
Keyword(s):  
Phylogenetic Analysis ◽  
16S Rrna ◽  
Bacterial Isolates ◽  
Isolation And Identification ◽  
First Report ◽  
Degrading Bacteria

ABSTRACT Of 31 freshwater bacterial isolates screened using the Biolog MT2 assay to determine their metabolism of the microcystin LR, 10 were positive. Phylogenetic analysis (16S rRNA) identified them as Arthrobacter spp., Brevibacterium sp., and Rhodococcus sp. This is the first report of microcystin degraders that do not belong to the Proteobacteria.

scholarly journals Isolation and Identification of Hydrocarbon-Degrading Bacteria that Tolerant to Saponin of Sapindus Rarak Plant

2019 ◽  
Vol 4 (1) ◽  
pp. 79-88
Author(s):  
Evi Octaviany ◽  
Suharjono Suharjono ◽  
Irfan Mustafa
Keyword(s):  
Crude Oil ◽  
16S Rdna ◽  
Bacterial Isolates ◽  
High Concentration ◽  
Isolation And Identification ◽  
Rdna Sequences ◽  
Degrading Bacteria ◽  
16S Rdna Sequences ◽  
Petroleum Contaminated Soil ◽  
Cell Densities

A commercial saponin as biosurfactant can reduce the surface tension of water and increase of hydrocarbon degradation. However, this saponin can be toxic to some hydrocarbonoclastic bac-teria. This study aimed to obtain bacterial isolates that were tolerant and incapable to degrade saponin, and to identify them based on 16S rDNA sequence. Bacteria were isolated from petroleum contaminated soil in Wonocolo Village, Bojonegoro Regency, East Java, Indonesia. The soil samples were acclimated using Bushnell-Haas (BH) broth with 0.5% crude oil at room temperature for 3 weeks. The culture was spread onto BH agar incubated at 30°C for 7 days. The first screened, isolates were grown in nutrient broth with addition of sap-onin 0%, 8%, and 12% (v/v) then incubated at 30°C for three days. The bacterial cell density was measured using a spectrophotometer. Second screened, the isolates were grown on BH broth with addition of 0.5% saponin as a sole carbon source, and their cell densities were measured. The selected isolates were identified based on 16S rDNA sequences. Among 34 bacterial isolates, nine isolates were tol-erant to 12% saponin. Three bacterial isolates IHT1.3, IHT1.5, and IHT3.24 tolerant to high concentration of saponin and did not use this substance as growth nutrition. The IHT1.3, IHT1.5, and IHT3.24 isolates were identified as Ochrobactrum pseudogrignonense (99% similarity), Pseudomonas mendocina (99%), and Ochrobactrum pi-tuitosum; (97%), respectively. Those three selected isolates are good candidates as hydrocarbon-degrading bacteria to bioremediation of soil contaminated crude oil. However, the combined activity of bacteria and saponin to degrade hydrocarbon needs further study. 

scholarly journals Isolation and Identification of Resistant Bacteria from Petroleum Producing Vicinity by Gene Amplification and Sequencing

2021 ◽  
pp. 1-8
Author(s):  
O. Aleruchi ◽  
O. Obire
Keyword(s):  
16S Rrna ◽  
Phylogenetic Study ◽  
Resistant Bacteria ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Antibiotic Resistant Bacteria ◽  
Isolation And Identification ◽  
Antibiotic Resistant ◽  
Disinfection Process ◽  
Adaptive Mechanisms

This investigation focuses on molecular identification of antibiotic resistant bacteria isolated from petroleum producing vicinity using 16S rRNA sequencing based technique. The bacterial 16s rRNA gene sequences were amplified using polymerase chain reaction, sequenced,  characterized and compared by using primers which has been compared to national center for biotechnology information (NCBI) sequence database. The presence of the plasmid mediated antibiotic resistance determinants CTX-M and QNRB genes in the bacterial isolates were analyzed. A total of four bacterial isolates that were resistant to all the antibiotic agents used were identified molecularly. The BLAST results showed 100 % similarity and phylogenetic study indicated that the genes were evolutionarily related to Morganella morganii, Pseudomonas xiamenensis, Chryseobacterium cucumeris and Staphylococcus sp., respectively. The genes obtained were submitted to the NCBI gene bank and were assigned accession number; MN094330, MN094331, MN094332 and MN094333, respectively. CTX-M and QNRB genes were however absent in the bacterial isolates. The result identified some peculiar abilities of the bacterial isolates to be resistant to antibiotics and suggests a correlation with resistance and hydrocarbon utilizing bacteria. The level of resistance could be as a result of the disinfection process during wastewater treatment procedure or the same adaptive mechanisms possessed by the isolates to control the hydrocarbon concentration in their cell. The study also clearly indicates that these wastewaters, when discharged into the environment directly may pose a risk for the spread of antibiotic resistant bacteria.

scholarly journals Census of the Viral Metagenome within an Activated Sludge Microbial Assemblage

2010 ◽  
Vol 76 (8) ◽  
pp. 2673-2677 ◽  
Author(s):  
Larissa C. Parsley ◽  
Erin J. Consuegra ◽  
Stephen J. Thomas ◽  
Jaysheel Bhavsar ◽  
Andrew M. Land ◽  
...  
Keyword(s):  
Phylogenetic Analysis ◽  
16S Rrna ◽  
Activated Sludge ◽  
16S Rrna Genes ◽  
Rrna Genes ◽  
Bacterial Isolates ◽  
Microbial Assemblage ◽  
Culture Independent ◽  
Culture Dependent

ABSTRACT The viral metagenome within an activated sludge microbial assemblage was sampled using culture-dependent and culture-independent methods and compared to the diversity of activated sludge bacterial taxa. A total of 70 unique cultured bacterial isolates, 24 cultured bacteriophages, 829 bacterial metagenomic clones of 16S rRNA genes, and 1,161 viral metagenomic clones were subjected to a phylogenetic analysis.

scholarly journals The Isolation and identification of cellulolytic bacteria at fibric, hemic and sapric peat in Teluk Bakung Peatland, Kubu Raya District, Indonesia

2020 ◽  
Vol 21 (5) ◽  
Author(s):  
Siti Khotimah ◽  
Suharjono Suharjono ◽  
Tri Ardyati ◽  
Yulia Nuraini
Keyword(s):  
Organic Matter ◽  
Oil Palm ◽  
Secondary Forest ◽  
Bacterial Isolates ◽  
Cellulolytic Bacteria ◽  
Isolation And Identification ◽  
Plate Method ◽  
Cellulase Enzyme ◽  
Degrading Bacteria ◽  
Relationship Of

Abstract. Khotimah S, Suharjono, Ardyati T, Nurani Y. 2020. Isolation and identification of cellulolytic bacteria at fibric, hemic, and sapric peat in Teluk Bakung Peatland, Kubu Raya District, Indonesia. Biodiversitas 21: 2103-2112. Cellulose degrading bacteria was one of the microbial removers of organic matter contained in the soil into simpler monomers so that it can be utilized by other organisms. The objective of the research was to obtain cellulose-degrading bacteria found on fibric, hemic, and sapric peat in forest and shrubs (oil palm). The bacteria were isolated by pour plate method on 1% CMC media. Selected isolates were assayed quantitatively based on the activity of cellulase enzyme, identified with 16S rDNA. The density of cellulolytic bacteria in the secondary forest peat of fibric, hemic, sapric were 2.1x103 cfu/g, 5.9x104 cfu/g, and 4.9x104 cfu/g whereas, in the area of shrubs/oil palm peat fibric, hemic and sapric 6.9x104 cfu/g, 8.4x104 cfu/g and 3.4x105 cfu/g respectively. There were 19 bacterial isolates that have clear zones around the colony as degradation of cellulose had highest ability to degrade cellulose with clear zones of 5-7 mm. The strain of SB1.1.1 showed highest activity of cellulase enzyme 11.17 U/mL, followed by HH3.1.1 strain and SB2.3 7.83 U/mL. Based on the phylogeny tree, strain SB1.1.1 and HH3.1.1 have the closest kinship relationship with Bacillus cereus with a kinship relationship of 100%, while SB2.3 has the closest kinship relationship with Bacillus stratosphericus with a relationship of 99.85 %.

scholarly journals Enzymatic activity of endophytic bacterial isolates of Jacaranda decurrens Cham. (Carobinha-do-campo)

2006 ◽  
Vol 49 (3) ◽  
pp. 353-359 ◽  
Author(s):  
Aysha Jussara Ivonilde Carrim ◽  
Edweis Cândida Barbosa ◽  
José Daniel Gonçalves Vieira
Keyword(s):  
Enzymatic Activity ◽  
Endophytic Bacteria ◽  
Bacterial Species ◽  
Bacterial Isolates ◽  
Isolation And Identification ◽  
First Report

The objectives of this work was to isolate endophytic bacteria from Jacaranda decurrens Cham. and screening of some enzymes of biotechnological interest. Ten (10) bacterial species were isolated and identified from the leaves and steams. All the isolates presented enzymatic activity, which was ranked as follows: proteolytic (60%) and amilolytic activity (60%), lipolytic (40%), esterasic (40%). However, cellulolytic and pectinolytic activities were not detected. This is the first report on the isolation and identification of endophytic bacteria from Jacaranda decurrens Cham.

scholarly journals First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States

Plant Disease ◽  
2013 ◽  
Vol 97 (10) ◽  
pp. 1375-1375 ◽  
Author(s):  
B. Dutta ◽  
R. D. Gitaitis ◽  
F. H. Sanders ◽  
C. Booth ◽  
S. Smith ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Leaf Spot ◽  
Pathogenic Bacteria ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Pcr Assay ◽  
First Report ◽  
The 16S Rrna Gene

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds. References: (1) N. W. Schaad et al. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, third edition. APS Press. St. Paul, MN, 2001. (2) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (3) Leu et al. Plant Pathol. Bull. 19:137, 2010. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

scholarly journals Isolation and Identification of Hydrocarbons- Degrading Bacteria from Panteka Stream, Kaduna, Nigeria, and Assessment of their Potential for Bioremediation

2021 ◽  
Vol 37 (2) ◽  
pp. 84-94
Author(s):  
E.C Nwagwu ◽  
V.M Yilwa ◽  
N.E Egbe ◽  
G.B Onwumere
Keyword(s):  
Streptococcus Pyogenes ◽  
Salmonella Enterica ◽  
Spare Parts ◽  
Hydrocarbon Contamination ◽  
Engine Oil ◽  
Local Alignment ◽  
Bacterial Isolates ◽  
Isolation And Identification ◽  
Degrading Bacteria ◽  
Spent Engine Oil

Water bodies become hydrocarbon-polluted when petroleum and other toxic organic matters are discharged into them. Panteka, located in northern Kaduna, Nigeria, is home to Panteka market, which is an industrial hub where different kinds of automobile spare parts are sold and mechanic workshops are situated. The Panteka stream flows through an entry point at Rafin guza, through Panteka market and towards the National Eye Centre. The indiscriminate disposal of spent engine oils and the discharge of other untreated effluents from car servicing workshops into the Panteka stream can lead to hydrocarbon contamination. Consequently, there is a need to identify these hydrocarbons and determine the capability of bacteria isolated from the stream to degrade the hydrocarbon pollutants. Using the pour plate method, and Bushnell Haas agar supplemented with 1% used engine oil, five bacterial isolates with the potential to degrade hydrocarbons were identified as Streptococcus pnuemoniae, Klebsiella pneumoniae, Shigella dysenteriae, Streptococcus pyogenes and Salmonella enterica. Salmonella enterica was confirmed by 16S rRNA gene sequencing and Basic Local Alignment search tool (BLAST) with a similarity index of 99%. The ability of the bacterial isolates to tolerate the spent engine oil was determined by turbidi metry. The results show that all the five bacterial isolates were able to tolerate the 1% (v/v) concentration of the spent engine oil. The highest growth rates (O.D 0.565 and O.D 0.695) were obtained from the pure cultures of Streptococcus pyogenes and the mixed bacterial consortium, respectively. The potentials of the bacteria to degrade hydrocarbons in the stream was analysed using Gas Chromatography Flame Ionization Detector (GC-FID), and the results showed reduction of the Total Petroleum Hydrocarbon (TPH) content from 6,056 mg/ml to 100.17 mg/ml (98.3% degradation) after 28 days of treatment with the mixed bacterial culture. The hydrocarbon fractions degraded were n-Nonane, n-Decane, n-Undecane, n- Dodecane, n-Tridecane, n-Tetradecane, n-Heptadecane, Pristane, n-octadecane, Phytane, n-Eicosane, n-Tricosane, n-Tetracosane, n-Octacosane, n-Triacontane, n-Dotriacontane, n-Tritriacontane, n-Heptriacontane; while n-Pentadecane, n-Hexadecane, n-Nonadecane, n-Heneicosane, n-Docosane, n-Pentacosane, n-Hexacosane, n-Heptacosane, n-Nonacosane, n-Hentriacontane, n-Tetratriacontane, n-Pentatriacontane, and n-Hexatriacontane were not degraded. This study shows that these bacterial strains isolated from the Panteka stream have great potential for bioremediation of the hydrocarbons found in the stream. Keywords: Bioremediation, Panteka stream, Automobile workshop, Hydrocarbon pollution, Bacteria isolates

scholarly journals First Report of Alder Yellows Phytoplasma Infecting Common and Grey Alder (Alnus glutinosa and A. incana) in Montenegro

Plant Disease ◽  
2013 ◽  
Vol 97 (5) ◽  
pp. 686-686 ◽  
Author(s):  
S. Radonjić ◽  
S. Hrnčić ◽  
O. Krstić ◽  
T. Cvrković ◽  
M. Mitrović ◽  
...  
Keyword(s):  
Phylogenetic Analysis ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
Alnus Glutinosa ◽  
Rrna Gene ◽  
Gene Sequences ◽  
First Report ◽  
Group Members ◽  
Different Strains ◽  
The Town

Alder yellows phytoplasmas (AldYp) of the 16SrV-group associated with common alder (Alnus glutinosa) and grey alder (A. incana) are closely related to the grapevine yellows (GY)-associated quarantine phytoplasma Flavescence dorée (FDp). AldYp have been reported in several countries where epidemic appearance of FDp has been confirmed (France, Italy, and Serbia) (1,2). To date, the presence of 16SrV-group of phytoplasmas has not been reported in Montenegro; however, the main vector of FD phytoplasma, Scaphoideus titanus, has been identified in Montenegrin vineyards since 2008. During a survey in September 2011, in the northern part of Montenegro, 12 symptomatic alder trees showing symptoms of leaf discoloration, ranging from yellow to light green, were sampled. Six samples, each comprising several symptomatic leaves, were collected from A. glutinosa at streamside in woodlands near the town Kolašin and other six samples from A. incana close to the river Lim near the town of Bijelo Polje. Leaves of six young A. glutinosa seedlings were used as controls. Total DNA was extracted from fresh leaf midribs and petioles using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany). Nested PCR assay was conducted on 16S rRNA gene using phytoplasma generic primers P1/P7 and F2n/R2 followed by RFLP with MseI endonuclease (Fermentas, Vilnius, Lithuania) (3). Confirmation of identification and characterization of phytoplasma positive samples was performed by amplifying the non-ribosomal metionine aminopeptidase (map) gene using FD9f5/MAPr1 and FD9f6/MAPr2 primer set (1), specific for the members of the 16SrV group phytoplasmas. Amplification products were sequenced and deposited in GenBank (KC188998 through 9001). Comparison of the map gene sequences was performed by phylogenetic analysis along with 20 reference sequences of the 16SrV-group members (1), using the neighbor-joining method in MEGA5 software (4). 16S rRNA gene amplification revealed the presence of phytoplasmas in 11 out of 12 symptomatic samples, while Mse I restriction analysis and comparison with reference strains (AldYp and FDp from Serbia) enabled affiliation of detected phytoplasmas to the 16SrV-group. None of the controls were positive for any phytoplasma. Phylogenetic analysis of the Montenegrin AldYp map gene sequences revealed presence of four different strains clustering within the previously defined clusters of the 16SrV-group members (1). Three different strains associated with symptomatic A. glutinosa were identified and they clustered either within the FD1, FD2, or PGY-C cluster, while a single detected strain from A. incana proved to be identical with PGY-A isolate of AldY phytoplasma infecting grapevine in Germany (AM384892). To our knowledge, this is the first report of the association of 16SrV-group phytoplasmas with common and grey alder in Montenegro, as well as the first report of FD-related phytoplasmas in Montenegro. Since alder trees are considered as a possible natural reservoir of the FD phytoplasmas (1), the finding of alders naturally infected with strains related to the FDp (FD1 and FD2 clusters) indicate a possible threat of economic importance to the grape production in Montenegro, which should be addressed in further research. References: (1) G. Arnaud et al. Appl. Environ. Microbiol. 73:4001, 2007. (2) T. Cvrkovic et al. Plant Pathol. 57:773, 2008. (3) I-M. Lee et al. Int. J. Syst. Evol. Bacteriol. 48:1153, 1998. (4) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011.

scholarly journals Isolation and Identification of Protease Enzyme Producing Bacteria from Fermentation of Gonad Sea Urchin (Echinothrix calamaris)

2019 ◽  
Vol 23 (4) ◽  
pp. 187
Author(s):  
Siani La Jamaludin ◽  
Johanis Fritzgal Rehena ◽  
Cecilia Anna Seumahu ◽  
Dominggus Rumahlatu
Keyword(s):  
16S Rrna ◽  
Sea Urchin ◽  
Enzyme Characterization ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Isolation And Identification ◽  
16S Rrna Sequence ◽  
Spontaneous Fermentation ◽  
Fermentation Products ◽  
Protease Enzyme

Bekasang of gonad sea urchin is one of the traditional fermentation products which generally involves microorganism spontaneous fermentation. Fermented paste products have a long shelf life and are processed quite easily using protease enzymes. Good exploration of producing protease from bakasang is needed to obtain the protease enzyme-producing microorganism with different characters. The method used in this research is screening with clear zone, measuring the activity of crude extract of protease enzyme characterization of bacteria through gram staining. Identification of potential microorganisms through 16S rRNA sequence. The results showed that there were eight isolates of protease enzyme-producing bacteria (G1, G2, G3, G4, G5, G6, G7, and G8) indicated by clear zones around single-colonic bacterial streaks. Only five bacterial isolates (G1, G4, G6, G7, and G8) were tested for the enzyme activity. These isolates have characteristics of positive gram bacteria. The interpretation of the results of molecular analysis using PCR and BLASTN sequences of 16S rRNA gene from five bacterial isolates, showed the identity of bacteria as: G1 was Staphylococcus piscifermentans strain CIP103958 with 99% similarity; Isolate G4 was Staphylococcus saprophyticus strain ATCC 15305 with 99% similarity; Isolate G6 was Staphylococcus condimenti F-2 strain with 99% similarity; Isolate G7 was Bacillus amyloliquefaciens subsp. plantarum strain FZB42 with 99% similarity; And G8 isolates was Lactobacillus plantarum strain JCM 1149 with 99% similarity.

Sign in / Sign up

Export Citation Format

Share Document