Identification of a transcription factor, an 80-kDa protein that interacts with the HLH recognition motif of the rat p53 promoter

2001 ◽  
Vol 79 (2) ◽  
pp. 153-158 ◽  
Author(s):  
Haisun Song ◽  
Minhyung Lee ◽  
Sunhee Yu ◽  
Jong-sang Park
Keyword(s):  
Transcription Factor ◽  
In Vitro Transcription ◽  
Mobility Shift ◽  
P53 Expression ◽  
Dnase I Footprinting ◽  
E Box ◽  
Molecular Masses ◽  
Mobility Shift Assay ◽  
Stimulating Factor

The p53 promoter has been shown to contain a number of potential regulatory motifs. It was previously reported that the upstream stimulating factor (USF) played a central role in regulating the p53 expression. The USF binding site, E-box, is located around 40 bp upstream of the major transcription start site. In this study, it was confirmed that the E-box binds to proteins by DNase I footprinting assay. In the electrophoretic mobility shift assay (EMSA), two retarded bands were detected. One band was abolished by the competition of USF consensus oligonucleotide, but the other band was not. This result indicated that a factor, other than USF, was bound to the E-box. The molecular masses of the binding proteins were determined by a Southwestern-blotting assay. As a result, 46- and 80-kDa proteins were detected. The 46-kDa protein was eliminated by the competition of USF consensus oligonucleotide. Also, the Southwestern-blotting assay with 32P-labeled USF consensus oligonucleotide showed only a 46-kDa protein. Therefore, the 46-kDa protein was USF. These results showed that USF and the 80-kDa protein were bound to the E-box. In addition, it was proved by in vitro transcription assay that this 80-kDa protein had a basal transcriptional activity.Key words: E-box, HLH, rat p53 promoter, transcription factor, upstream stimulating factor (USF).

scholarly journals Transcriptional activation of the H-ferritin gene in differentiated Caco-2 cells parallels a change in the activity of the nuclear factor Bbf

1995 ◽  
Vol 311 (3) ◽  
pp. 769-773 ◽  
Author(s):  
M A Bevilacqua ◽  
M C Faniello ◽  
P D′Agostino ◽  
B Quaresima ◽  
M T Tiano ◽  
...  
Keyword(s):  
Transcription Factor ◽  
Transcriptional Activation ◽  
Mobility Shift ◽  
Differentiated Cells ◽  
Binding Factor ◽  
H Gene ◽  
Ferritin Gene ◽  
Mobility Shift Assay ◽  
Promoter Interaction

In this paper, we examine the mechanisms that regulate the expression of the heavy (H) ferritin subunit in the colon carcinoma Caco-2 cell line allowed to differentiate spontaneously in vitro. The differentiation process of these cells in continuous culture is accompanied by an accumulation of the mRNA coding for the apoferritin H chain. The analysis of Caco-2 subclones stably transfected with an H-chain promoter-chloramphenicol acetyltransferase (CAT) construct revealed that the mRNA increase is paralleled by an enhanced transcription of the H gene, driven by the -100 to +4 region of the H promoter. The H gene transcriptional activation seems to be a specific feature of differentiated Caco-2 cells, since the activity of other promoters did not change upon differentiation. The -100 to +4 region of the H promoter binds a transcription factor called Bbf (B-box binding factor); electrophoretic-mobility-shift-assay analyses showed that the retarded complex due to Bbf-H promoter interaction is significantly increased in the differentiated cells. We propose that the activation of H-ferritin gene expression may be associated with the establishment of a differentiated phenotype in Caco-2 cells, and that the H-ferritin gene transcriptional up-regulation is accompanied by a modification in the activity of the transcription factor Bbf.

scholarly journals A detailed and radioisotope-free protocol for electrophoretic mobility shift assay (EMSA)

2021 ◽  
Author(s):  
NGUYEN HOAI NGUYEN
Keyword(s):  
Transcription Factor ◽  
Electrophoretic Mobility Shift Assay ◽  
Electrophoretic Mobility ◽  
Chromatin Immunoprecipitation ◽  
Direct Interaction ◽  
Luciferase Reporter ◽  
Mobility Shift ◽  
Dna Fragment ◽  
Mobility Shift Assay

Abstract To comprehensively characterize the functions of a transcription factor (TF), it is required to analyze the interaction of this TF with its targeted loci. Several methods such as β-glucuronidase (GUS) or luciferase reporter, yeast one-hybrid (Y1H), chromatin-immunoprecipitation (ChIP), and electrophoretic mobility shift assay (EMSA) assays have been developed. Of these, EMSA is an in vitro method which can prove the direct interaction between TF and targeted DNA fragment. This protocol is to provide a detailed procedure for a safe EMSA assay (without using any radioisotope).

scholarly journals Transcription factor Sp1 binds to and activates a human hsp70 gene promoter.

1989 ◽  
Vol 9 (9) ◽  
pp. 4099-4104 ◽  
Author(s):  
W D Morgan
Keyword(s):  
Transcription Factor ◽  
Constitutive Expression ◽  
Gene Promoter ◽  
In Vitro Transcription ◽  
Transcription Factor Sp1 ◽  
Dnase I Footprinting ◽  
Proximal Site ◽  
Human Hsp70

I investigated the binding of purified transcription factor Sp1 from HeLa cells to the human hsp70 promoter by DNase I footprinting. Three binding sites were detected within the upstream promoter region, including one located 46 base pairs upstream of the transcription start, between the TATA box and the proximal CCAAT box element. In vitro transcription demonstrated that the proximal site is capable of responding to Sp1-dependent stimulation. These results suggest that Sp1 might contribute to constitutive expression in vivo and might also be involved in the various regulatory responses that affect this gene.

Transcription factor Sp1 binds to and activates a human hsp70 gene promoter

1989 ◽  
Vol 9 (9) ◽  
pp. 4099-4104
Author(s):  
W D Morgan
Keyword(s):  
Transcription Factor ◽  
Constitutive Expression ◽  
Gene Promoter ◽  
In Vitro Transcription ◽  
Transcription Factor Sp1 ◽  
Dnase I Footprinting ◽  
Proximal Site ◽  
Human Hsp70

I investigated the binding of purified transcription factor Sp1 from HeLa cells to the human hsp70 promoter by DNase I footprinting. Three binding sites were detected within the upstream promoter region, including one located 46 base pairs upstream of the transcription start, between the TATA box and the proximal CCAAT box element. In vitro transcription demonstrated that the proximal site is capable of responding to Sp1-dependent stimulation. These results suggest that Sp1 might contribute to constitutive expression in vivo and might also be involved in the various regulatory responses that affect this gene.

scholarly journals PcaO Positively Regulates pcaHG of the β-Ketoadipate Pathway in Corynebacterium glutamicum

2010 ◽  
Vol 192 (6) ◽  
pp. 1565-1572 ◽  
Author(s):  
Ke-Xin Zhao ◽  
Yan Huang ◽  
Xi Chen ◽  
Nan-Xi Wang ◽  
Shuang-Jiang Liu
Keyword(s):  
Corynebacterium Glutamicum ◽  
Dnase I ◽  
Transcriptional Analysis ◽  
Target Sequence ◽  
Mobility Shift ◽  
Directed Mutation ◽  
Reverse Transcription Pcr ◽  
Dnase I Footprinting ◽  
Mobility Shift Assay

ABSTRACT We identified a new regulator, PcaO, which is involved in regulation of the protocatechuate (PCA) branch of the β-ketoadipate pathway in Corynebacterium glutamicum. PcaO is an atypical large ATP-binding LuxR family (LAL)-type regulator and does not have a Walker A motif. A mutant of C. glutamicum in which pcaO was disrupted (RES167ΔpcaO) was unable to grow on PCA, and growth on PCA was restored by complementation with pcaO. Both an enzymatic assay of PCA 3,4-dioxygenase activity (encoded by pcaHG) and transcriptional analysis of pcaHG by reverse transcription-PCR revealed that PcaO positively regulated pcaHG. A promoter-LacZ transcriptional fusion assay suggested that PcaO interacted with the sequence upstream of pcaHG. Electrophoretic mobility shift assay (EMSA) analysis indicated that an imperfect palindromic sequence (−78AACCCCTGACCTTCGGGGTT−59) that was located upstream of the −35 region of the pcaHG promoter was essential for PcaO regulation. DNase I footprinting showed that this imperfect palindrome was protected from DNase I digestion. Site-directed mutation and EMSA tests revealed that this palindrome sequence was essential for PcaO binding to the DNA fragment. In vitro EMSA results showed that ATP weakened the binding between PcaO and its target sequence but ADP strengthened this binding, while the effect of protocatechuate on PcaO binding was dependent on the protocatechuate concentration.

EpsR Negatively Regulates Streptococcus mutans Exopolysaccharide Synthesis

2021 ◽  
pp. 002203452110006
Author(s):  
J. Chen ◽  
A. Zhang ◽  
Z. Xiang ◽  
M. Lu ◽  
P. Huang ◽  
...  
Keyword(s):  
Transcription Factor ◽  
Dental Caries ◽  
Streptococcus Mutans ◽  
Global Gene Expression ◽  
Mobility Shift ◽  
Expression Of Genes ◽  
Dna Motif ◽  
Dnase I Footprinting ◽  
Global Gene Expression Profiling ◽  
Mobility Shift Assay

Streptococcus mutans is considered the primary etiological agent of human dental caries. Glucosyltransferases (Gtfs) from S. mutans play important roles in the formation of biofilm matrix and the development of cariogenic oral biofilm. Therefore, Gtfs are considered an important target to prevent the development of dental caries. However, the role of transcription factors in regulating gtf expression is not yet clear. Here, we identify a MarR (multiple antibiotic resistance regulator) family transcription factor named EpsR (exopolysaccharide synthesis regulator), which negatively regulates gtfB expression and exopolysaccharide (EPS) production in S. mutans. The epsR in-frame deletion strain grew slowly, aggregated more easily in the presence of dextran, and displayed different colony morphology and biofilm structure. Notably, epsR deletion resulted in altered 3-dimensional biofilm architecture, increased water-insoluble EPS production, and upregulated GtfB protein content and activity. In addition, global gene expression profiling revealed differences in the expression levels of 69 genes in which gtfB was markedly upregulated. The conserved DNA motif for EpsR binding was determined by electrophoretic mobility shift assay and DNase I footprinting assays. Moreover, analysis of β-galactosidase activity suggested that EpsR acted as a repressor and inhibited gtfB expression. Taken together, our findings indicate that EpsR is an important transcription factor that regulates gtfB expression and EPS production in S. mutans. These results add new aspects to the complexity of regulating the expression of genes involved in the cariogenicity of S. mutans, which might lead to novel strategies to prevent the formation of cariogenic biofilm that may favor diseases.

scholarly journals SlyA and H-NS Regulate Transcription of the Escherichia coli K5 Capsule Gene Cluster, and Expression of slyA in Escherichia coli Is Temperature-dependent, Positively Autoregulated, and Independent of H-NS

2007 ◽  
Vol 282 (46) ◽  
pp. 33326-33335 ◽  
Author(s):  
David Corbett ◽  
Hayley J. Bennett ◽  
Hamdia Askar ◽  
Jeffrey Green ◽  
Ian S. Roberts
Keyword(s):  
Escherichia Coli ◽  
Gene Cluster ◽  
Regulation Of Transcription ◽  
Temperature Dependent ◽  
Mobility Shift ◽  
E Coli ◽  
Dnase I Footprinting ◽  
Nucleoprotein Complex ◽  
Electrophoretic Mobility Shift Assays

In this paper, we present the first evidence of a role for the transcriptional regulator SlyA in the regulation of transcription of the Escherichia coli K5 capsule gene cluster and demonstrate, using a combination of reporter gene fusions, DNase I footprinting, and electrophoretic mobility shift assays, the dependence of transcription on the functional interplay between H-NS and SlyA. Both SlyA and H-NS bind to multiple overlapping sites within the promoter in vitro, but their binding is not mutually exclusive, resulting in a remodeled nucleoprotein complex. In addition, we show that expression of the E. coli slyA gene is temperature-regulated, positively autoregulated, and independent of H-NS.

The human RNA polymerase I structure reveals an HMG-like transcription factor docking domain specific to metazoans

2021 ◽  
Author(s):  
Julia L Daiß ◽  
Michael Pilsl ◽  
Kristina Straub ◽  
Andrea Bleckmann ◽  
Mona Höcherl ◽  
...  
Keyword(s):  
Transcription Factor ◽  
Rna Polymerase ◽  
In Vitro Transcription ◽  
Cellular Growth ◽  
Hmg Box ◽  
Transcription Bubble ◽  
Transcription System ◽  
Pol I ◽  
Additional Domain

Transcription of the ribosomal RNA precursor by RNA polymerase (Pol) I is a major determinant of cellular growth and dysregulation is observed in many cancer types. Here, we present the purification of human Pol I from cells carrying a genomic GFP-fusion on the largest subunit allowing the structural and functional analysis of the enzyme across species. In contrast to yeast, human Pol I carries a single-subunit stalk and in vitro transcription indicates a reduced proofreading activity. Determination of the human Pol I cryo-EM reconstruction in a close-to-native state rationalizes the effects of disease-associated mutations and uncovers an additional domain that is built into the sequence of Pol I subunit RPA1. This "dock II" domain resembles a truncated HMG-box incapable of DNA-binding which may serve as a downstream-transcription factor binding platform in metazoans. Biochemical analysis and ChIP data indicate that Topoisomerase 2a can be recruited to Pol I via the domain and cooperates with the HMG-box domain containing factor UBF. These adaptations of the metazoan Pol I transcription system may allow efficient release of positive DNA supercoils accumulating downstream of the transcription bubble.

Abstract 1384: Osteogenic Transcription Factor Runx2 Regulates Expression of RANKL during VSMC Calcification

Circulation ◽  
2008 ◽  
Vol 118 (suppl_18) ◽  
Author(s):  
Chang Hyun Byon ◽  
Jay McDonald ◽  
Yabing Chen
Keyword(s):  
Oxidative Stress ◽  
Transcription Factor ◽  
Molecular Mechanism ◽  
Luciferase Reporter ◽  
Rankl Expression ◽  
Reporter System ◽  
Mobility Shift ◽  
Atherosclerotic Lesions ◽  
Flanking Region

The expression of receptor activator of nuclear factor κ B (RANKL) is up-regulated in calcified atherosclerotic lesions, whereas it is frequently undetectable in normal vessels. The underlying molecular mechanism of increased expression of RANKL in calcified vessels is not known. We have previously demonstrated that oxidative stress induces calcification of vascular smooth muscle cells (VSMC) in vitro . Therefore, we determined whether oxidative stress regulates RANKL expression in VSMC and the underlying molecular mechanism. Consistent with previous observations in vivo , we found that the expression of RANKL in VSMC isolated from mouse. However, hydrogen peroxide (H 2 O 2 ), which induces VSMC calcification, induced a 33-fold increase in the transcripts of RANKL as determined by real-time PCR. Increased expression of RANKL protein was further confirmed by ELISA. Using flow cytometry, we demonstrated that membrane-bound RANKL was increased by oxidative stress. To characterize the molecular mechanism underlying H 2 O 2 -induced RANKL expression, we employed the luciferase reporter system with a series of deletion mutants of the RANKL 5′-flanking region. The H 2 O 2 responsive region is located between −200 to −400 in the 5′-flanking region of RANKL gene. Analyses of the sequence of this region identified multiple binding sites for the key osteogenic transcription factor, Runx2, which we previously reported to be an essential regulator of VSMC calcification. Electrophoretic mobility shift analyses demonstrated increased binding of Runx2 on the RANKL promoter sequence in nuclear extracts from VSMC exposed to H 2 O 2 . To further determine the role of Runx2 in regulating RANKL expression, we generated stable Runx2 knockdown VSMC with the use of lentivirus-carrying shRNA for Runx2 gene. H 2 O 2 -induced RANKL expression was abrogated in VSMC with Runx2 knockdown. In addition, adenovirus-mediated overexpression of Runx2 in VSMC induced the expression of RANKL. In summary, we have demonstrated that H 2 O 2 induces the expression of RANKL in VSMC, which is regulated by the osteogenic transcription factor Runx2. These observations provide novel molecular insights into the regulation of RANKL and its role on the pathogenesis of calcified atherosclerotic lesions.

Intrinsic Fluoride Tolerance Regulated by a Transcription Factor

2020 ◽  
Vol 99 (11) ◽  
pp. 1270-1278
Author(s):  
M. Lu ◽  
Z. Xiang ◽  
T. Gong ◽  
X. Zhou ◽  
Z. Zhang ◽  
...  
Keyword(s):  
Transcription Factor ◽  
Inhibitory Concentration ◽  
Transcriptional Regulator ◽  
Mutant Library ◽  
Mobility Shift ◽  
Binding Motifs ◽  
Dnase I Footprinting ◽  
Dna Binding Motifs ◽  
Dental Hard Tissues ◽  
Planktonic State

Fluoride facilitates the remineralization of dental hard tissues and affects bacterial activities. Therefore, it is extensively used as an anti-caries agent in clinical practice and daily life. Although some studies focused on understanding Streptococcus mutans’ response to fluoride, the mechanism regulating intrinsic fluoride tolerance is not yet clear. Since the TetR family of transcription factors is associated with multidrug resistance, our aim was to evaluate whether they are related to fluoride tolerance in S. mutans. A mutant library including each S. mutans TetR gene was constructed and the transcription factor fluoride related transcriptional regulator (FrtR) was identified. The in-frame deletion of the S. mutans frtR gene resulted in decreased cell viability under fluoride in both the planktonic state and single-/dual-species biofilms. This in-frame frtR mutant was used for RNA-sequencing and the fluoride related permease gene ( frtP) was found as 1 of the downstream genes directly regulated by FrtR. The recombinant FrtR protein was purified, and conserved DNA binding motifs were determined using electrophoretic mobility shift and DNase I footprinting assays. Finally, a series of mutant and complement strains were constructed to perform the minimum inhibitory concentration (MIC) assays, which indicated that frtP upregulation led to the increase of fluoride sensitivity. Collectively, our results indicate that FrtR is an important transcription factor regulating the frtP expression in S. mutans, thus affecting the intrinsic fluoride tolerance. Therefore, this study provides novel insights into a potential target to increase the S. mutans sensitivity to fluoride for a better prevention of dental caries.

Sign in / Sign up

Export Citation Format

Share Document