scholarly journals Response of Arbuscular Mycorrhizal Fungi to Hydrologic Gradients in the Rhizosphere ofPhragmites australis(Cav.) Trin ex. Steudel Growing in the Sun Island Wetland

2015 ◽  
Vol 2015 ◽  
pp. 1-9 ◽  
Author(s):  
Li Wang ◽  
Jieting Wu ◽  
Fang Ma ◽  
Jixian Yang ◽  
Shiyang Li ◽  
...  
Keyword(s):  
Host Plant ◽  
Mycorrhizal Fungi ◽  
Plant Biomass ◽  
Growth Parameters ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
The Sun ◽  
Vegetative Period ◽  
Hydrologic Gradients ◽  
Mycorrhizal Association

Within the rhizosphere, AM fungi are a sensitive variable to changes of botanic and environmental conditions, and they may interact with the biomass of plant and other microbes. During the vegetative period of thePhragmites australisgrowing in the Sun Island Wetland (SIW), the variations of AM fungi colonization were studied. Root samples of three hydrologic gradients generally showed AM fungi colonization, suggesting that AM fungi have the ability for adaptation to flooded habitats. There were direct and indirect hydrological related effects with respect to AM fungi biomass, which interacted simultaneously in the rhizosphere. Though water content in soil and reed growth parameters were both positively associated with AM fungi colonization, only the positive correlations between reed biomass parameters and the colonization could be expected, or both the host plant biomass and the AM fungi could be beneficial. The variations in response of host plant to the edaphic and hydrologic conditions may influence the effectiveness of the plant-mycorrhizal association. This study included a hydrologic component to better assess the role and distribution of AM fungi in wetland ecosystems. And because of that, the range of AM fungi was extended, since they actually showed a notable adaptability to hydrologic gradients.

scholarly journals Arbuscular Mycorrhizal Fungi (AMF) as Buffer for Heavy Metals Phytoextraction by Cucurbita maxima Duch. Grown on Crude Oil Contaminated Soil

2018 ◽  
Vol 3 ◽  
pp. 1-12
Author(s):  
Okon G. Okon ◽  
J.E. Okon ◽  
G.D.O. Eneh
Keyword(s):  
Heavy Metals ◽  
Heavy Metal ◽  
Crude Oil ◽  
Mycorrhizal Fungi ◽  
Growth Parameters ◽  
Chemical Properties ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Heavy Metal Accumulation ◽  
Cucurbita Maxima

This study evaluated the influence of Arbuscular Mycorrhizal (Rhizophagus irregularis) fungi inoculation (M) on the growth ofCucurbita maximaand as a buffer against phytoextraction of selected heavy metals (HM) (Zn, Cu, Cr, Cd and Pb) from a soil contaminated with crude oil (C). The experiment was set up using four soil treatments, each with three replicates C+ M-, C+ M+, C-M+ and C-M- (control without oil and inoculum). The shoot length, petiole length, number of nodes, leaf area and percentage germination ofC. maximawere significantly (p=0.05) reduced in uninoculated crude oil treatment (C+ M-), unpolluted mycorrhizal inoculated treatments (C-M+) showed remarkable response in growth parameters above the control (C-M-), while the polluted and inoculated treatment (C+ M+) showed significant (p=0.05) increase in growth parameters when compared to the polluted uninoculated treatment (C+ M-). Heavy metals analysis revealed a significant (p=0.05) difference in the heavy metal accumulation ofC. maxima. The heavy metals analyzed in this study are present thus inC. maxima; Zn>Cu>Cr>Pb>Cd. Crude oil polluted uninoculated treatment (C+ M-) recorded the highest concentrations of heavy metals than crude oil polluted inoculated (R. irregularis) treatment (C+ M+). Mycorrhizal inoculated unpolluted treatment (C-M+) and unpolluted uninoculated treatment (C-M-) indicated the lowest heavy metal concentrations. Inoculation withR. irregularissignificantly (p=0.05) reduced heavy metals uptake byC. maximaas observed in this study. Also, the negative effect of crude oil on AMF root colonization ofC. maximabyR. irregulariswas observed in polluted and inoculated treatment. HM often accumulate in the top layer of soil, therefore, are available for uptake by plants via roots, which is a major entry point of HM that ultimately affects different physiological processes. AM fungi can impinge on the chemical properties of heavy metals in the soil, their absorption by the host plant, and their allocation to different plant parts, affecting plant growth and the bioremediation process, thus making the AM fungi a suitable buffer for mitigating heavy metal stress onC. maxima.

scholarly journals First Report of an Arbuscular Mycorrhizal Fungus Funneliformis mosseae Associated with Thuja plicata in an Ectomycorrhizal Forest in Greece

2016 ◽  
Vol 5 (1) ◽  
pp. 53-53
Author(s):  
Antonios Zambounis ◽  
Aliki Xanthopoulou ◽  
Filippos A. Aravanopoulos ◽  
Athanasios Tsaftaris ◽  
Evaggelos Barbas
Keyword(s):  
Mycorrhizal Fungi ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
First Record ◽  
Thuja Plicata ◽  
Allium Porrum ◽  
Northern Greece ◽  
Funneliformis Mosseae ◽  
Mycorrhizal Association

The ability of trees forming arbuscular mycorrhizal (AM) associations to get established in ectomycorrhizal forests is still unknown (Weber et al., 2005). The success of both establishment and adaptation depends on the type of interactions between the plants introduced and the type of indigenous soil microbiota (Fahey et al., 2012). Thuja plicata is an AM forest tree successfully established (since 1962) in an artificial trial plantation in the region of Chalkidiki (northern Greece). The successful adaptation of an AM tree in an ectomycorrhizal forest raises questions about the feasibility, if any of the mycorrhizal association under these conditions, as well as on the kind of this association and the species of mycorrhizal fungi putatively involved. During a survey, roots fragments were excised from three Thuja plicata trees and were co-cultured with leek roots (Allium porrum, var. bleu de solaise) in the greenhouse. The successful colonization of the leeks by AM fungi was confirmed by the presence of arbuscular and vesicular structures in the roots after microscopic examination. Colonized Allium porrum roots have then been harvested, surface disinfected (90% ethanol for 10 seconds, 6% sodium hypochlorite for 5 min) and plated on agar solidified medium in Petri dishes. Molecular identification of the mycorrhizal fungal species involved in this symbiosis, was performed after total nucleic acids were extracted using the DNeasy Plant Mini Kit (Qiagen, Crawley, UK). A portion of the 18S ribosomal RNA region was amplified using the primers AML1 (5’ AACTTTCGATGGTAGGATAGA 3’), AML2 (5’ CCAAACACTTTGGTTTCC 3’). The PCR amplicon was cloned using TOPO TA Cloning Kit (Invitrogen, Paisley, U.K.) and sequenced (GenBank accession Nos. KU365383 - KU365385). All partial sequences revealed 99% nucleotide homology with the 18S rRNA sequence of a Funneliformis mosseae fungus isolate (KP144312). To our knowledge, this is the first record of Thuja plicata associated with Glomeromycetes AM fungal communities in an ectomycorrhizal forest in Greece

scholarly journals Morpho-Physiological Responses of Abelmoschus esculentus (L.) Moench to Arbuscular Mycorrhizal Fungi Inoculation under Drought Stress

2019 ◽  
pp. 1-8
Author(s):  
Okon, Okon Godwin ◽  
Uyon, Peter Paul ◽  
Nyahette, Enobong Monday
Keyword(s):  
Drought Stress ◽  
Arbuscular Mycorrhizal Fungi ◽  
Photosynthetic Pigments ◽  
Mycorrhizal Fungi ◽  
Biomass Yield ◽  
Plant Biomass ◽  
Growth Parameters ◽  
Arbuscular Mycorrhizal ◽  
Experimental Plant ◽  
Experimental Soil

Aims: To assess the potential impacts of arbuscular mycorrhizal fungi (AMF) (G. geosporum) inoculation on the survival of A. esculentus under drought stress. Study Design: This experiment was set up in a completely randomized design (CRD) with all treatments replicated thrice. This gave a total of 7 treatments, 21 replicates. Place and Duration of Study: The experimental soil used for this study was collected from the Botanical Garden of the Department of Biological Sciences, Ritman University (Latitude 5º11’44ºN and Longitude 7º42’12ºE), Akwa Ibom State, Nigeria. All analysis was carried out in Soil Science Laboratory and Botany Laboratory, Akwa Ibom State University, between January and march 2019. Methodology: Soil samples were analyzed following the standard procedures outlined for wet acid digestions. Growth parameters were determined using standard methods. At Leaf chlorophyll meter was employed in the assessment of the photosynthetic pigments of the experimental plant. Biomass yield were calculated using standard formulas. Results: The physicochemical analysis of the experimental soil used in this study revealed the physical and chemical properties of the soil; pH (6.12), EC (0.06dS/m), organic matter (2.90%), Av. P (44.62 mg/kg) and textural class of the soil was described as loamy sandy soil. Shoot length, petiole length, internode length, number of leaves and leaf area as well as the total photosynthetic pigments (TPP) contents of A. esculentus were significantly (P =.05) reduced (from 38.77±3.01 mg/kg to 29.83±1.89 mg/kg) by drought stress. There was also significantly (P = .05) reduction in N, P, K, Ca and Mg composition of A. esculentus as well as its biomass yield. However, the inoculation of A. esculentus roots with AMF (G. geosporum) in this study through several morphological and physiological processes exhibited remarkable improvement in growth morphology, total photosynthetic pigments, macronutrients composition as well as biomass yield. Conclusion: The results of this work have shown that AMF can enhance the ability of A. esculentus to resist drought stress possibly through some morphological and physiological changes which improves water and nutrients uptake.

scholarly journals Influence of drought and salt stress on the growth of young Populus nigra ‘Italica’ plants and associated mycorrhizal fungi and non-mycorrhizal fungal endophytes

New Forests ◽  
2021 ◽  
Author(s):  
Magdalena Kulczyk-Skrzeszewska ◽  
Barbara Kieliszewska-Rokicka
Keyword(s):  
Salt Stress ◽  
Soil Salinity ◽  
Mycorrhizal Fungi ◽  
Growth Parameters ◽  
Fungal Endophytes ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Populus Nigra ◽  
Stress Factors ◽  
Symbiotic Associations

AbstractPopulus nigra ‘Italica’ (Lombardy poplar) is a breeding cultivar of black poplar, widely used as a street tree or windbreak, often exposed to salinity and limited water availability. Populus roots can develop dual mycorrhizal associations with ectomycorrhizal (ECM) and arbuscular mycorrhizal (AM) fungi, and with non-mycorrhizal fungal endophytes (FE). The symbiotic fungi may alleviate the effects of adverse environmental conditions. We investigated the performance (growth and symbiotic associations) of one-year-old Populus nigra ‘Italica’ grown from woody cuttings in soil from natural poplar habitat and subjected to water scarcity and soil salinity (50 mM NaCl, 150 mM NaCl, 250 mM NaCl). With increasing soil salinity, a decrease in the growth parameters of the aboveground parts of the poplar plantlets and their fine roots were found; however, the roots were more resistant to the stress factors analyzed than the shoots. ECMF, AMF, and non-mycorrhizal FE were all tolerant to increased salt levels in the soil, and the ECM abundance was significantly higher under conditions of mild salinity (50 mM NaCl, 150 mM NaCl) compared to the control plants and those treated with 250 mM NaCl. Our results indicated that enhanced soil salinity increased the content of sodium and chlorine in leaves, but did not affect significantly the concentrations potassium, magnesium, calcium, phosphorus, or nitrogen. Significant accumulation of proline in leaves suggest salt stress of P. nigra ‘Italica’ treated with 250 mM NaCl and contribution of proline to the plant defense reactions.

scholarly journals Hormonomic Changes Driving the Negative Impact of Broomrape on Plant Host Interactions with Arbuscular Mycorrhizal Fungi

2021 ◽  
Vol 22 (24) ◽  
pp. 13677
Author(s):  
Kiril Mishev ◽  
Petre I. Dobrev ◽  
Jozef Lacek ◽  
Roberta Filepová ◽  
Bistra Yuperlieva-Mateeva ◽  
...  
Keyword(s):  
Host Plant ◽  
Mycorrhizal Fungi ◽  
Negative Impact ◽  
Dominant Role ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Parasitic Plants ◽  
Plant Roots ◽  
Plant Host ◽  
Mycorrhizal Roots

Belowground interactions of plants with other organisms in the rhizosphere rely on extensive small-molecule communication. Chemical signals released from host plant roots ensure the development of beneficial arbuscular mycorrhizal (AM) fungi which in turn modulate host plant growth and stress tolerance. However, parasitic plants have adopted the capacity to sense the same signaling molecules and to trigger their own seed germination in the immediate vicinity of host roots. The contribution of AM fungi and parasitic plants to the regulation of phytohormone levels in host plant roots and root exudates remains largely obscure. Here, we studied the hormonome in the model system comprising tobacco as a host plant, Phelipanche spp. as a holoparasitic plant, and the AM fungus Rhizophagus irregularis. Co-cultivation of tobacco with broomrape and AM fungi alone or in combination led to characteristic changes in the levels of endogenous and exuded abscisic acid, indole-3-acetic acid, cytokinins, salicylic acid, and orobanchol-type strigolactones. The hormonal content in exudates of broomrape-infested mycorrhizal roots resembled that in exudates of infested non-mycorrhizal roots and differed from that observed in exudates of non-infested mycorrhizal roots. Moreover, we observed a significant reduction in AM colonization of infested tobacco plants, pointing to a dominant role of the holoparasite within the tripartite system.

scholarly journals Microplastic fiber and drought effects on plants and soil are only slightly modified by arbuscular mycorrhizal fungi

2020 ◽  
Author(s):  
Anika Lehmann ◽  
Eva F. Leifheit ◽  
Linshan Feng ◽  
Joana Bergmann ◽  
Anja Wulf ◽  
...  
Keyword(s):  
Global Change ◽  
Mycorrhizal Fungi ◽  
Plant Biomass ◽  
Soil Aggregates ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Soil System ◽  
Plant Soil ◽  
Greenhouse Study ◽  
Drought Conditions

Abstract Microplastics are increasingly recognized as a factor of global change. By altering soil inherent properties and processes, ripple-on effects on plants and their symbionts can be expected. Additionally, interactions with other factors of global change, such as drought, can influence the effect of microplastics. We designed a greenhouse study to examine effects of polyester microfibers, arbuscular mycorrhizal (AM) fungi and drought on plant, microbial and soil responses. We found that polyester microfibers increased the aboveground biomass of Allium cepa under well-watered and drought conditions, but under drought conditions the AM fungal-only treatment reached the highest biomass. Colonization with AM fungi increased under microfiber contamination, however, plant biomass did not increase when both AM fungi and fibers were present. The mean weight diameter of soil aggregates increased with AM fungal inoculation overall but decreased when the system was contaminated with microfibers or drought stressed. Our study adds additional support to the mounting evidence that microplastic fibers in soil can affect the plant-soil system by promoting plant growth, and favoring key root symbionts, AM fungi. Although soil aggregation is usually positively influenced by plant roots and AM fungi, and microplastic promotes both, our results show that plastic still had a negative effect on soil aggregates. Even though there are concerns that microplastic might interact with other factors of global change, our study revealed no such effect for drought.

scholarly journals EXOTIC ARBUSCULAR MYCORRHIZAL FUNGI AND NATIVE DARK SEPTATE ENDOPHYTES ON THE INITIAL GROWTH OF Paspalum millegrana GRASS

2019 ◽  
Vol 32 (3) ◽  
pp. 607-615
Author(s):  
LARISSA DE SOUZA GOIS ◽  
JOHNY DE JESUS MENDONÇA ◽  
JUAN LOPES TEIXEIRA ◽  
CAROLINA MANGIERI DE OLIVEIRA PRADO ◽  
FRANCISCO SANDRO RODRIGUES HOLANDA ◽  
...  
Keyword(s):  
Arbuscular Mycorrhizal Fungi ◽  
Host Plant ◽  
Mycorrhizal Fungi ◽  
Plant Biomass ◽  
Arbuscular Mycorrhizal ◽  
Plant Colonization ◽  
Initial Growth ◽  
Climate Conditions ◽  
Growth And Survival ◽  
Grass Growth

ABSTRACT Arbuscular mycorrhizal fungi (AMF) and dark septate endophytic fungi (DSE) promote increase in plant biomass, depending on the soil and climate conditions and the interactions with the host plant. The objective of this study was to evaluate the interaction of exotic arbuscular mycorrhizal fungi and native DSE fungi on the initial growth of P. millegrana. A completely randomized experimental design comprising the Paspallum millegrana cutilvar with the following treatments: control - without AMF, and three exotic AMF isolates (UFLA351 - Rhizoglomus clarum, UFLA372 - Claroideoglomus etunicatum and UFLA401 - Acaulospora morrowiae), with four replications each. P. millegrana grass was colonized by exotic AMF by R. clarum (UFLA351, 11.9%), C. etunicatum (UFLA372, 39.6%), and A. morrowiae (UFLA401, 51.2%). P. millegrana was also colonized by native DSE fungi, but these did not interfere with the colonization by exotic AMF and plant development. P. millegrana is responsive to the inoculation of UFLAs isolates of exotic AMF, which may contribute to the grass growth and survival under field conditions. The process of surface disinfestation of seeds does not eliminate endophytic microorganisms, whose presence may influence plant colonization by AMF, as well as development of the host plant.

Long-term effect of heavy metal loads on the mycorrhizal colonization and metal uptake of barley

2010 ◽  
Vol 59 (1) ◽  
pp. 175-184
Author(s):  
B. Biró ◽  
A. Füzy ◽  
K. Posta
Keyword(s):  
Host Plant ◽  
Root System ◽  
Biomass Production ◽  
Contaminated Soils ◽  
Mycorrhizal Fungi ◽  
Root Biomass ◽  
Infection Intensity ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi

A pot experiment was designed to study the colonization of indigenous arbuscular mycorrhizal fungi (AMF) on barley ( Hordeum vulgare L.) host plant. Soils of the pots were collected from a long-term field microelement loading experiment on calcareous chernozem soil twelve years after 13 heavy metals (Al, As, Ba, Cd, Cr, Cu, Hg, Mo, Ni, Pb, Se, Sr and Zn) were applied once in four doses (0, 30, 90 and 270 mg element·kg -1 d.w.). The biomass production and element accumulation of the host plant, the various colonization values of the arbuscular mycorrhiza fungi (AMF) – such as colonization intensity (M %), arbusculum richness (A %) in the root system and the sporulation intensity (g -1 dry soil) in the rhizosphere – were measured. When considering the twelve-year adaptation process of the AM fungal populations at the various metal loads, a relatively balanced inside mycorrhiza colonization was found, suggesting the potentials for the selection of tolerant fungi in metal contaminated soils. The balanced infection intensity (M %) of the AM fungi and their common strategies with the host plant have resulted a nonsignificant shoot and root biomass production of barley in general. Mycorrhiza sporulation in the root system proved to be much variable and indicated the toxicity of metals and metal rates. Cd, Pb and Sr elements significantly reduced spore numbers, while a value of 34 spores·g -1 soil was counted in the case of Ni in comparison to the control’s 22 spores·g -1 soil value. Stress-defending strategies of the fungal–plant symbiosis, such as the increased arbusculum richness (A %) could be established for the Hg and Pb rates. In the case of Cd an increased root biomass production became a tool for stress alleviation and reduced the metal allocation towards the shoots. Mycorrhiza fungi are part of the common plant–microbe interactions and appropriate defending mechanisms in metal contaminated soils.

scholarly journals Effects of arbuscular mycorrhizal fungi on rice-herbivore interactions are soil-dependent

2019 ◽  
Vol 9 (1) ◽  
Author(s):  
Lina Bernaola ◽  
Michael J. Stout
Keyword(s):  
Mycorrhizal Fungi ◽  
Plant Biomass ◽  
Fall Armyworm ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Nutrient Concentrations ◽  
P Availability ◽  
Soil P ◽  
Rice Plants ◽  
Rice Water

Abstract The effect of soil type on establishment of arbuscular mycorrhizal (AM) fungi, and their effects on plant growth and resistance to rice pests are poorly understood. We investigated the effects of inoculation with AM fungi on rice plants in two different unsterilized field soils under greenhouse and field conditions in two consecutive years in Louisiana, United States. We tested whether inoculation with AM fungi in the two soils changed plant biomass, nutrient concentration, resistance to pests, and yields. Inoculation with a commercial formulation of AM fungi increased root colonization by fungi in all soils, regardless of soil P availability; it also increased densities of root-feeding rice water weevil larvae and growth of leaf-feeding fall armyworm larvae, but these effects were soil-dependent. Inoculation with AM fungi had no effect on N and P concentrations or rice yields. The effect on plant biomass was also soil-dependent. Our study provides evidence for the first time that inoculation with AM fungi can increase colonization of roots of rice plants, but the effects of colonization on resistance to pests and plant biomass appear to be soil dependent. Moreover, the increased susceptibility to pests of rice colonized by AM fungi does not appear to be related to nutrient concentrations.

Sign in / Sign up

Export Citation Format

Share Document