Oat, wheat and sorghum cultivars for the management of Meloidogyne enterolobii

Nematology ◽  
2018 ◽  
Vol 20 (2) ◽  
pp. 169-173 ◽  
Author(s):  
Andressa Lima de Brida ◽  
Bárbara Monteiro de Castro e Castro ◽  
José Cola Zanuncio ◽  
José Eduardo Serrão ◽  
Silvia Renata Siciliano Wilcken
Keyword(s):  
Sorghum Bicolor ◽  
Crop Rotation ◽  
Avena Sativa ◽  
Nematode Species ◽  
Root Knot Nematode ◽  
Egg Masses ◽  
Meloidogyne Enterolobii ◽  
Reproduction Factor

Meloidogyne enterolobii, reported in different regions of Brazil, is a polyphagous nematode parasitising plants resistant to other root-knot nematode species. This study evaluated the resistance of six cultivars of Avena sativa, seven cultivars of Triticum aestivum and 13 hybrids of Sorghum bicolor to M. enterolobii. The experiment was conducted in a glasshouse. The soil was autoclaved and infested with 5000 eggs of M. enterolobii. The tomato ‘Rutgers’ was used as the susceptible standard to this nematode. The indices of galls, egg masses, and reproduction factor of M. enterolobii were evaluated 60 days after inoculation. This nematode did not reproduce in any of the genotypes considered resistant. The oat, wheat and sorghum cultivars studied may be recommended for crop rotation in areas infested with M. enterolobii.

scholarly journals Reaction of potential guava rootstocks to Meloidogyne enterolobii

Revista CERES ◽  
2018 ◽  
Vol 65 (3) ◽  
pp. 291-295 ◽  
Author(s):  
Fernando Marcelo Chiamolera ◽  
Antonio Baldo Geraldo Martins ◽  
Pedro Luiz Martins Soares ◽  
Tatiana Pagan Loeiro da Cunha-Chiamolera
Keyword(s):  
Root System ◽  
Fusarium Solani ◽  
Root Rot ◽  
System Development ◽  
Control Treatment ◽  
Root Knot Nematode ◽  
Second Stage ◽  
Root System Development ◽  
Meloidogyne Enterolobii ◽  
Reproduction Factor

ABSTRACT Root-knot nematode Meloidogyne enterolobii is the main phytosanitary problem of guava cultivation in Brazil. Among the strategies to manage the problem, the best prospects are in identifying or developing cultivars or rootstocks that are resistant to this nematode. To identify plants with potential as rootstocks for guava, the reaction of araçá (wild guava) to M. enterolobii was assessed in a greenhouse experiment. Seven araçá species were evaluated (Eugenia stipitata, Psidium acutangulum, P. cattleyanum ‘yellow’, P. friedrichsthalianum, P. guajava var. minor, P. guineense, and Psidium sp.). The plants were inoculated with a suspension of 3,000 eggs of M. enterolobii, using eggplant as control treatment. The parameters fresh root mass, number of eggs and second stage juveniles (J2) per root system, the reproduction factor (RF = Pf/Pi), and araçá reaction were determined during the experiment. RF of the araçá species E. stipitata, P. cattleyanum ‘yellow’, and P. friedrichsthalianum was less than one (RP < 1), therefore resistant to M. enterolobii. The araçá trees had good root system development and the susceptible plants showed many root galls, high number of eggs and J2, and Fusarium solani and Rhizoctonia solani root rot. The araçá species, P. cattleyanum ‘yellow’, P. friedrichsthalianum, and E. stipitata are resistant to M. enterolobii and can be tested as potential guava rootstocks.

scholarly journals Do the stage of plant and initial population of root knot nematode influence on sweet pepper development?

O Biológico ◽  
2020 ◽  
Vol 82 (1) ◽  
pp. 1-10
Author(s):  
Samara A. de Oliveira ◽  
Juliana M. O Rosa ◽  
Juliana Eulálio ◽  
Claudio Marcelo G. de Oliveira
Keyword(s):  
Sweet Pepper ◽  
Initial Population ◽  
Root Knot Nematode ◽  
One Pot ◽  
Leaf Pair ◽  
Final Population ◽  
Randomized Design ◽  
Meloidogyne Enterolobii ◽  
Shoot Weight ◽  
Reproduction Factor

The aim of this study was to investigate the response of three different stages (one, three and five leaf pairs) of sweet pepper (Capsicum annuum cv. Orazio) seedlings to five inoculation levels of Meloidogyne enterolobii (zero (control), 300, 1000, 3000 and 10000) under greenhouse conditions. Each plant was cultivated in one pot filled with 3.8 L of substrate. The test was a completely randomized design with four replications. The plants were assessed 60 days after inoculation, plant shoot weight, final population of nematodes, and reproduction factor were measured. The results were fitted to Seinhorst model: Y = m + (1-m). ZPi –T. The results showed a tolerance limit (T) of 2,500 nematodes for plants with one and three leaf pair, and 8,500 nematodes for the five-leaf pair plant.

scholarly journals Resistance sources to root-knot nematode Meloidogyne enterolobii in Solanum species

2020 ◽  
pp. 303
Author(s):  
Jadir Borges Pinheiro ◽  
Giovani Olegario da Silva ◽  
Jhenef Gomes de Jesus ◽  
Danielle Biscaia ◽  
Raphael Augusto de Castro e Melo
Keyword(s):  
Solanum Species ◽  
Experimental Unit ◽  
Egg Mass ◽  
Root Knot Nematode ◽  
Sources Of Resistance ◽  
Second Stage ◽  
Randomized Design ◽  
Meloidogyne Enterolobii ◽  
Plant Grown ◽  
Reproduction Factor

The objective of this work was to prospect sources of resistance to root-knot nematode Meloidogyne enterolobii in Solanum species with potential to be used as rootstocks for cultivated Solanaceae. Nine accessions of Solanum sessiliflorum, 27 accessions of S. lycocarpum, 21 accessions of S. acanthodes, 22 accessions of S. scinericum and 26 accessions of S. scuticum for resistance to M. enterolobii. Rutgers and Nemadoro tomatoes were used as susceptible and resistant controls, respectively. The experiment was conducted in a greenhouse at Embrapa Vegetables, Brasília-DF, Brazil, in a completely randomized design with six replications. The experimental unit was a represented by a single plant grown in a plastic pot containing 3 L of substrate. 4000 eggs and eventual juveniles of second stage M. enterolobii were inoculated per pot. At 119 days after inoculation, gall index (Gi), egg mass index (EMI), number of eggs per root gram (NE) and reproduction factor (Fr) were evaluated. Data were subjected to analysis of variance and grouping of treatments by Scott-Knott. It was verified that S. acanthodes and S. Lycocarpum are species with high resistance to M. enterolobii, with accessions being classified identified as immune. S. scuticum also has great potential, as several resistant accessions were identified, although some accessions were quite susceptible; whereas for S. subinerme only 4 resistant accessions were identified, although all others presented a reproduction factor much lower than tomato cv. Nemadoro as control; and all evaluated S. sessiliflorum accessions were susceptible.

scholarly journals REACTION OF PSIDIUM SPP. ACCESSIONS TO DIFFERENT LEVELS OF INOCULATION WITH MELOIDOGYNE ENTEROLOBII

2019 ◽  
Vol 32 (2) ◽  
pp. 419-428
Author(s):  
PATRÍCIA GOMES DE OLIVEIRA ◽  
MANOEL ABILIO DE QUEIRÓZ ◽  
JOSÉ MAURO DA CUNHA E CASTRO ◽  
JULIANA MARTINS RIBEIRO ◽  
RONALDO SIMÃO DE OLIVEIRA ◽  
...  
Keyword(s):  
Yield Loss ◽  
State University ◽  
Fresh Weight ◽  
Root Knot Nematode ◽  
Second Stage ◽  
Meloidogyne Enterolobii ◽  
Positive Results ◽  
Different Levels ◽  
Reproduction Factor ◽  
Main Factor

ABSTRACT Meloidogyne enterolobii associated with Fusarium solani causes the guava decay, which is the main factor of yield loss in guava crops and limits guava production in Brazil. Therefore, searching for guava genotypes (Psidium spp.) with resistance to M. enterolobii is important to control this root-knot nematode. The objective of the present work was to evaluate the reaction of Psidium spp. accessions from the Germplasm Bank of the Bahia State University (UNEB) to different levels of inoculation with M. enterolobii. Guava seedlings were inoculated with 600, 1,600, and 2,000 eggs + J2 second stage juveniles of M. enterolobii and the root fresh weight, total number of eggs (TNE), and reproduction factor (RF) were evaluated. The results were subjected to ANOVA and means were clustered using the Scott-Knott test at 5% probability. The diversity of accessions was estimated using the Tocher's clustering and UPGMA methods. The nematode RF reduced in some accessions with increasing inoculation levels of the nematode. However, the RF increased in some accessions with high levels of inoculation. Plants of the Y50 accession were immune or resistant to M. enterolobii, indicating variability of reaction of plants to the nematode within the Psidium genus. The resistance of Psidium accessions to M. enterolobii needs to be measured with different inoculation levels to verify the existence of false-positive results, since the evaluated accessions, including the Paluma cultivar, presented distinct reactions regarding RF in the three levels of inoculation used.

Meloidogyne enterolobii (= M. mayaguensis): profile of an emerging, highly pathogenic, root-knot nematode species

Nematology ◽  
2012 ◽  
Vol 14 (2) ◽  
pp. 133-138 ◽  
Author(s):  
Philippe Castagnone-Sereno
Keyword(s):  
Control Strategies ◽  
Nematode Species ◽  
Root Knot Nematode ◽  
Huge Amount ◽  
Highly Pathogenic ◽  
Specific Identification ◽  
Meloidogyne Enterolobii ◽  
Efficient Control ◽  
Mediterranean Regions ◽  
Tropical Areas

Meloidogyne enterolobii (= M. mayaguensis), the root-knot nematode of the pacara earpod tree, belongs to the group of tropical root-knot nematodes and is considered as one of the most damaging species, due to its wide host range, pathogenicity and ability to develop and reproduce on several crops carrying resistance genes. Moreover, recent reports indicate that the geographic distribution of the parasite tends to extend beyond tropical areas, and the risk of its establishment and spread in Mediterranean regions and southern Europe is now highly probable. Recently, molecular markers have been developed that allow the specific identification of this pest, a prerequisite for the implementation of efficient control strategies. In that respect, plant resistance and biological control are currently being actively investigated but a huge amount of research and development is still required to ensure the successful use of such methods in the field.

Effect of the Mi gene on reproduction of Meloidogyne hispanica on tomato genotypes

Nematology ◽  
2011 ◽  
Vol 13 (8) ◽  
pp. 939-949 ◽  
Author(s):  
Maria Clara Vieira dos Santos ◽  
Rosane H.C. Curtis ◽  
Isabel M. de O. Abrantes ◽  
Carla M. Maleita ◽  
Stephen J. Powers
Keyword(s):  
Nematode Species ◽  
Nematode Resistance ◽  
Management Programme ◽  
Root Knot Nematode ◽  
Rf Values ◽  
Gall Index ◽  
Mi Gene ◽  
Gene Status ◽  
Reproduction Factor ◽  
Tomato Genotypes

AbstractThe root-knot nematode resistance (Mi) gene was screened in 25 tomato genotypes of Solanum lycopersicum, by amplification of REX-1 and Mi23 markers. Ten heterozygous tomato genotypes (Mimi), nine homozygous (MiMi) at the Mi locus and six lacking the Mi gene for resistance to root-knot nematode were identified using the marker REX-1. The results obtained with Mi23 marker confirmed the Mi gene status of the tomato genotypes, except for genotype Valouro RZ F1 that was homozygous (MiMi) and heterozygous (Mimi) at the Mi locus when using the REX-1 and Mi23 markers, respectively. The pathogenicity of Meloidogyne hispanica on the 25 tomato genotypes was assessed 60 days after inoculation with 5000 eggs on the basis of root gall index (GI) and reproduction factor (Rf). All the tomato genotypes were susceptible (excellent or good hosts), with GI > 4 and Rf > 2, except the genotype Rapit (Mimi), considered as resistant/hypersensitive (poor host). In this genotype, the nematode induced galls (GI = 4) on its roots and a small number of eggs were produced (Pf = 3085 ± 485). Significant differences in reproduction were detected between the Mi allelic conditions and genotypes within Mi allelic conditions. The increasing number of Mi alleles (0, 1 or 2) is associated with decreasing Rf, which suggests a possible dosage effect of the Mi gene. The variability observed in the Rf values for MiMi tomato genotypes may reflect an influence of the genetic background of the plants containing the Mi gene. Ten of the 25 tomato genotypes with Mi gene are commercially available. However, only Rapit can be used to control the three most common Meloidogyne spp. and inhibit the increasing of M. hispanica populations, and may have potential to be included in an integrated pest management programme. However, it is advisable to evaluate the pathogenicity of local populations of this nematode species associated with different environmental factors.

Screening Sweetpotato Genotypes for Resistance to a North Carolina Isolate of Meloidogyne enterolobii

Plant Disease ◽  
2020 ◽  
Author(s):  
Tanner Schwarz ◽  
Eric Davis ◽  
G. Craig Yencho ◽  
Kenneth Pecota ◽  
Chunying Li ◽  
...  
Keyword(s):  
North Carolina ◽  
Ipomoea Batatas ◽  
Post Inoculation ◽  
State University ◽  
Root Knot Nematode ◽  
Soil Mixture ◽  
Initial Inoculum ◽  
Meloidogyne Enterolobii ◽  
Nematode Eggs ◽  
Reproduction Factor

Potential resistance to the guava root-knot nematode, Meloidogyne enterolobii, in ninety-one selected sweetpotato [Ipomoea batatas (L.) Lam.] genotypes was evaluated in six greenhouse experiments. Ten thousand eggs of M. enterolobii were inoculated on each sweetpotato genotype grown in a 3:1 sand to soil mixture. Sixty days post inoculation, percent of total roots with nematode-induced galls was determined, and nematode eggs were extracted from roots. Significant differences (P ˂ 0.001) among sweetpotato genotypes were found in all six tests for gall rating, total eggs, and eggs per gram of root. Resistant sweetpotato genotypes were determined by final eggs per root system divided by the initial inoculum where Pf/Pi < 1 (reproduction factor; final egg count divided by initial inoculum of 10,000 eggs), and statistical mean separations were confirmed by Fisher’s LSD t test. Our results indicated that 19 out of 91 tested sweetpotato genotypes were resistant to M. enterolobii. Some of the susceptible genotypes included ‘Covington’, ‘Beauregard’, ‘NCDM04-001’, and ‘Hernandez’. Some of the resistant sweetpotato genotypes included ‘Tanzania’, ‘Murasaki-29’, ‘Bwanjule’, ‘Dimbuka-Bukulula’, ‘Jewel’, and ‘Centennial’. Most of the 19 resistant sweetpotato genotypes supported almost no M. enterolobii reproduction with less than 20 eggs/g root of M. enterolobii. A number of segregants from a ‘Tanzania’ x ‘Beauregard’ cross demonstrated strong resistance to M. enterolobii observed in the ‘Tanzania’ parent. In collaboration with NC State University sweetpotato breeding program, several of the genotypes evaluated in these tests are now being used to incorporate the observed resistance to M. enterolobii into commercial sweetpotato cultivars.

scholarly journals First Report of the Root-Knot Nematode Meloidogyne enterolobii Infecting Jujube in China

Plant Disease ◽  
2014 ◽  
Vol 98 (10) ◽  
pp. 1451-1451 ◽  
Author(s):  
H. B. Long ◽  
C. Bai ◽  
J. Peng ◽  
F. Y. Zeng
Keyword(s):  
Morphological Characteristics ◽  
Nematode Species ◽  
First Record ◽  
Reproduction Rate ◽  
Root Knot Nematode ◽  
Mt Dna ◽  
First Report ◽  
Intergenic Spacers ◽  
Traditional Chinese Herbal Medicine ◽  
Meloidogyne Enterolobii

Jujube (Ziziphus jujuba Mill.) is an economically-important fruit crop grown in Europe, Australia, and southern/eastern Asia. In China, it is often called red date and the fruit is used in traditional Chinese herbal medicine and wine. In February 2014, jujube plants growing in a sandy soil in Sanya, Hainan Province, China, were observed exhibiting symptoms of decline, including stunting, wilting, and no flowering or fruit set. Roots systems of sick plants (n = 20) had many galls, the typical symptoms of root-knot nematode infection, and the incidence of infection was 100%. These galls were formed in the primary, secondary, and tertiary roots. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 72 females on average (n = 20). The perineal patterns of females (n = 10) were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. Second-stage juveniles (n = 20) had large and triangular lateral lips and broad, bluntly rounded tail tips. These morphological characteristics are the same as those for Meloidogyne enterolobii Yang & Eisenback 1983 (5). Identification was further confirmed after DNA extraction from 12 nematodes. Part of the rDNA spanning the internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (4). A 764-bp fragment was amplified, which was 100% identical to sequences of M. enterolobii (GenBank Accession Nos. KJ146863, KF418369, JQ082448, and JX024149) in GenBank. Species identification was confirmed by using PCR to amplify mitochondrial (mt) DNA and rDNA intergenic spacers (IGS) 2 with primers C2F3/1108 (GGTCAATGTTCAGAAATTTGTGG/TACCTTTGACCAATCACGCT) (3) and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), respectively (2). The PCR products were approximately 700 bp for mtDNA and 200 bp for rDNA-IGS2, which were also identical to those previously reported for M. enterolobii (2,3). M. enterolobii is considered as one of the most damaging root-knot nematode species due to its wide host range, high reproduction rate, and ability to overcome the resistance genes (Mi-1, Mh, Mir1, N, Tabasco, and Rk) in several crops (1). It is reported that over 20 plant species from eight families (Annonaceae, Apiaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae) in China are hosts for M. enterolobii. To our knowledge, this is the first report of jujube as a host of M. enterolobii and the first record of M. enterolobii as a parasite of a plant in the family Rhamnaceae in China. References: (1) P. Castagnone-Sereno. Nematology 14:133, 2002. (2) H. Long et al. Acta Phytopathol. Sinica 36:109, 2006. (3) T. O. Powers and T. S. Harris. J. Nematol. 25:1, 1993. (4) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Meloidogyne enterolobii (Pacara earpod tree root-knot nematode).

2021 ◽  
Author(s):  
Pablo Castillo ◽  
Philippe Castagnone-Sereno
Keyword(s):  
Plant Material ◽  
Plant Pathogens ◽  
Nematode Species ◽  
Infested Soil ◽  
Vegetable Production ◽  
Root Knot Nematode ◽  
Highly Pathogenic ◽  
Important Species ◽  
Meloidogyne Enterolobii ◽  
Continental Climate

Abstract The risk of introducing nonindigenous plant pathogens or pests into new areas is increasing rapidly due to globalization and the extensive trade and transport network now established within and among continents (Hulme, 2009). Meloidogyne spp. are universally associated with vegetable production across the globe. Meloidogyne enterolobii is a highly pathogenic and aggressive invasive species emerging as an economically important species worldwide. As a root-knot nematode species, M. enterolobii can easily be transmitted with soil and plant material. Infested soil and growing media, plants for planting, bulbs and tubers from countries where M. enterolobii occurs are the most probable pathways of introduction into different regions. Soil attached to machinery, tools, footwear or plant products is also another possible pathway. The recent interception of this pest in several countries in Europe and the Mediterranean region (Germany, The Netherlands, UK) illustrates that it has the potential to enter different regions. In addition, M. enterolobii could survive under glasshouse conditions across regions with a sub-Mediterranean or a continental climate. Once root-knot nematodes have been introduced, it is generally difficult to control or eradicate them. Only in the EPPO region has this nematode been listed as a quarantine pest (EPPO A2 list No.361).

Sign in / Sign up

Export Citation Format

Share Document