Variation of p21, P-Gp Expression in K562/A02 Cell Line with Tetrandrine

Blood ◽  
2008 ◽  
Vol 112 (11) ◽  
pp. 5066-5066
Author(s):  
Bao-An Chen ◽  
Jing Li ◽  
Jian Cheng ◽  
Feng Gao ◽  
Wen-lin Xu ◽  
...  
Keyword(s):  
Multidrug Resistance ◽  
Cell Growth ◽  
Cell Line ◽  
Clinical Application ◽  
K562 Cells ◽  
Rt Pcr ◽  
P21 Protein ◽  
Mtt Method ◽  
Mdr1 Mrna

Abstract Object: To study the variation of p21, P-gp expression in reversion of multidrug resistance of K562/A02 leukemic line with different concentration of tetrandrine(TET), to provide new theoretic evidence for the clinical application of TET. Methods: The IC50 (the concentration causing 50% inhibition of cell growth) of DNR was analyzed by MTT method; The Expressions of p21 were assayed by westernblot; The Expressions of P-gp were assayed by FCM; The expressions of mdr1 were assayed by RT-PCR; The variation of p21 was accentuation with the accrescence concentration of TET(P <0.05). Results: The variation of p21 protein in K562/A02 cells was accentuation with the accrescence concentration of TET(p<0.05), Mdr1 mRNA was lowly displayed in K562 cells and highly displayed in K562/A02 cells(p<0.01), the variation of mdr1 was attenuation with the accrescence concentration of TET(p<0.05); P-gp was lowly displayed in K562 cells and highly displayed in K562/A02 cells(p<0.01), the variation of P-gp was attenuation with the accrescence concentration of TET(p<0.05). Conclusion: TET may reverse multidrug resistance of K562/A02 cells by the regulation of p21,P-gp and mdr1.

Role of Transcription Factor HBP1 in Human Leukaemic Cell Proliferation, Apoptosis and Differentiation.

Blood ◽  
2004 ◽  
Vol 104 (11) ◽  
pp. 3556-3556
Author(s):  
Congjun Yao ◽  
Kimberly Works ◽  
Garth E. Austin
Keyword(s):  
Cell Growth ◽  
Cell Line ◽  
Fas Ligand ◽  
Myeloid Cell ◽  
K562 Cells ◽  
Erythroid Differentiation ◽  
S Phase ◽  
Rt Pcr ◽  
Cmv Promoter ◽  
Myeloid Cell Line

Abstract HMG-box containing protein 1 (HBP1) is a recently described member of the high mobility group of transcription factors. We showed that HBP1 is expressed at low levels in immature myeloid cell lines, and at greatly increased levels following induction of differentiation. We also showed that HBP1 protein interacts physically and functionally with the retinoblastoma (RB) protein. We demonstrated that in human myeloid cell lines which express the myeloperoxidase (MPO) gene, HBP1 enhances the activity of the MPO promoter by binding to promoter DNA. However, its role in regulating myeloid development and differentiation remains to be elucidated. To begin to explore this question, we stably transfected the myeloid cell line, K562, with plasmid constructs derived from pBudCE4.1 (Invitrogen), which overexpress HBP1. K562 cells are a myeloid cell line which can be induced to differentiate (by appropriate chemicals) along erythroid or megakaryocytic pathways. Five sets of bulk cultures and multiple clones derived from each of them were obtained: 1) cell only; 2) CAT control; 3) HBP1 driven by CMV promoter (low level overexpression); 4) HBP1 driven by EF1 promoter (high level overexpression); and 5) HBP1 driven by CMV promoter plus RB driven by EF1 promoter. Overexpression of HBP1 with or without co-overexpression of RB resulted in slower cell growth rates compared with control cells. Cell cycle analysis revealed that HBP1 transfectants displayed marked retardation of S-phase progression by a 5-bromo-2-deoxyuridine (BrdU) incorporation method. Real-time RT-PCR showed that expression of cyclin D1 and cyclin D3 mRNAs significantly decreased in HBP1 transfectants. The D-type cyclins (cyclin D1, D2, and D3) promote cell cycle progression from G1 to S phase by binding to and activating the cyclin dependent kinases Cdk4 and Cdk6. HBP1 transfectants underwent increased apoptosis as demonstrated by intracellular DNA fragmentation, and the binding of annexin V to the cell surface. Consistent with this, substantial increases in Fas ligand mRNA levels were noted in HBP1 transfectants suggesting that apoptosis may be occurring by the Fas/Fas ligand pathway. HBP1 overexpression induced terminal, irreversible erythroid differentiation of K562 cells in the absence of hemin and enhanced hemin-induced erythroid differentiation, as evidenced by hemoglobin production and increased expression of glycophorin A on the K562 cell membrane. During this erythroid differentiation, c-Myc and c-Myb transcripts were downregulated whereas JunB transcription was upregulated. HBP1 overexpression increased TPA-induced induction of megakaryocytic markers such as CD41a and increased cell size as determined by flow cytometry. Similar effects were seen in clones derived from bulk cultures of transfected cells. In summary, overexpression of HBP1 in the myeloid cell line K562 resulted in reduced cell growth rates, increased rates of apoptosis, and increased differentiation of cells toward erythroid or megakaryocytic lineages. Real-time RT-PCR studies suggested that these changes resulted, at least in part, from changes in transcription of critical genes which control cell growth, apoptosis, and differentiation in myeloid cells. Our results support the hypothesis that HBP1 is intimately involved in the control of cell growth, apoptosis, and terminal differentiation in developing myeloid cells.

Variation of Sorcin’s Expression in the Reversion of Multidrug Resistance of K562/A02 Leukemic Line with Tetrandrine.

Blood ◽  
2007 ◽  
Vol 110 (11) ◽  
pp. 4176-4176
Author(s):  
Bao-An Chen Chen ◽  
Jing Li ◽  
Jia-Hua Ding ◽  
Chong Gao ◽  
Yun-Yu Sun ◽  
...  
Keyword(s):  
Multidrug Resistance ◽  
Time Dependence ◽  
Concentration Dependence ◽  
Clinical Application ◽  
Incubation Time ◽  
Calcium Binding ◽  
K562 Cells ◽  
Calcium Binding Protein ◽  
Pcr Analysis ◽  
Rt Pcr

Objective This paper aims to investigate the reversal multiple of daunomycin(DNR) with different concentration of tetrandrine(tet) at different time, to study the variation of Soluble resistance related calcium binding protein (sorcin)’s expression in the reversion of multidrug resistance of K562/A02 leukemic line with different concentration of tet at different time, and to provide new theoretic evidence for the clinical application of tet as resistence modifying agents. Method The reversal multiple of DNR with different concentration of tet at different time was assayed by MTT (concentration of tet is 0.5mg/l or1mg/l or 2mg/l, incubation time is 48h or 72h). The variation of the gene’s expression of sorcin with different concentration of tet at different time wasassayed by RT-PCR(grouping like MTT). Result MTT analysis demonstrated that the reversal concentration was 1.81(0.5mg/l,48h),3.62(1.0mg/l,48h),6.14(2.0mg/l,48h),2.8(0.5mg/l,72h),(1.0mg/l,48h),7.12(2.0mg/l,72h) respectively. RT-PCR analysis demonstrated that sorcin gene was lowly displayed in K562 cells and highly displayed in K562/A02 cells. The variation was first accentuation and then attenuation with the concentration accrescence of tet, this tendency had no obviously difference between 48h and 72h. Conclusion 1 The result of the experiment shows that tet may reverse multidrug resistance of K562/A02 cells by the down regulation of the expression of sorcin gene and proteinum; 2. It may have the concentration dependence and the time dependence in the reversion of multidrug resistance of K562/A02 cells with tet.

Growth Suppressors IFI-204 and IFI-205 Inhibit Primitive Hematopoietic Cell Proliferation In Vitro and in Vivo.

Blood ◽  
2004 ◽  
Vol 104 (11) ◽  
pp. 1691-1691
Author(s):  
Kimberly Klarmann ◽  
Daniel Gough ◽  
Benyam Asefa ◽  
Chris Clarke ◽  
Katie Renn ◽  
...  
Keyword(s):  
Stem Cell ◽  
Cell Growth ◽  
Cell Line ◽  
Constitutive Expression ◽  
Rt Pcr ◽  
Hematopoietic Stem ◽  
Inhibit Cell Growth ◽  
Stem And Progenitor Cells

Abstract Members of the interferon inducible-200 (IFI-200) family of proteins inhibit cell growth and may be important mediators of differentiation. We examined IFI-204 and IFI-205 mRNA expression in purified populations of hematopoietic stem and progenitor cells at different stages of maturation using quantitative RT-PCR and found that their expression markedly increased during myeloid maturation. To evaluate the effect of IFI-205 and IFI-204 on hematopoietic stem cell (HSC) growth, we transduced these genes into mouse bone marrow cells (BMC) using retroviral vectors. The presence IFI-204 or IFI-205 resulted in a decrease in cell growth in response to hematopoietic growth factors. Further analysis revealed the infected cells were 98% c-Kit+ Sca-1+, indicative of the stem cell surface phenotype, suggesting they may be blocked in a primitive stage of maturation. When transplanted, BMC transduced with IFI-204 or IFI-205 failed to engraft lymphoid, myeloid, or erythroid lineages in both short and long term reconstitution assays, suggesting that constitutive expression of IFI-204 and IFI-205 inhibited HSC development both in vitro and in vivo. However, based on the quantitative RT-PCR results, which show that IFI-205 increased during myeloid differentiation, we know its endogenous, regulated expression must permit the cells to mature. Therefore, to study of the effects of these genes on differentiation we transduced the mulitpotential EML (erythroid, myeloid, lymphoid) cell line with IFI-204 and IFI-205 to circumvent severe growth inhibition caused by expression of IFI-204 and Ifi-205 in normal cells. Single cell analysis of EMLs transduced with IFI-205 demonstrated that expression of IFI-205 in this cell line did not significantly inhibit cell growth. We have isolated EML clones from the transduced cells and verified IFI-205 expression. In addition, we generated transgenic mice that express IFI-205 under control of the Vav and MRP8 promoters, and we identified transgenic lines that express IFI-205 at higher levels compared to wild type controls. Analysis of hematopoiesis in these animals is currently in progress. Altogether, our data demonstrate 3 findings: 1) IFI-204 and IFI-205 expression increases during myeloid development based on quantitative RT-PCR analysis, 2) constitutive expression of IFI-204 and -205 results in potent inhibition of growth and maturation of normal hematopoietic stem and progenitor cells in vivo and in vitro and 3) these genes did not significantly inhibit the proliferation of the EML cell line, which provides us with a means to study the mechanism by which these molecules regulate myeloid maturation. Finally, the considerable inhibitory effects of these family members on normal hematopoietic cell growth suggest their potential as therapeutic modalities for treatment of leukemia.

Methanolic Extract of Cynara Cardunculus L. Inhibits Cell Proliferation and Bcr/Abl Expression in K562 Cell Line

Blood ◽  
2008 ◽  
Vol 112 (11) ◽  
pp. 4247-4247
Author(s):  
Antonio Russo ◽  
Filomena Conforti ◽  
Maria Cristina Caroleo ◽  
Roberta Ionà ◽  
Giancarlo Statti ◽  
...  
Keyword(s):  
Cell Growth ◽  
Western Blot ◽  
Cell Line ◽  
Blot Analysis ◽  
Proliferative Activity ◽  
Methanolic Extract ◽  
Mrna Levels ◽  
Cynara Cardunculus ◽  
Rt Pcr ◽  
K562 Cell Line

Abstract Introduction: Chronic myeloid leukaemia (CML) is a myeloid neoplasm defined by the Bcr/Abl oncoprotein that is considered essential for leukaemogenesis and accumulation of neoplastic cells. Evidence exists showing that extracts of antichoke Cynara cardunculus L. (CCE) are able to inhibit cancer cell growth in vitro (1). In the present study we have investigated the antiproliferative effect of methanolic extract of CEE on K562 Bcr-Abl positive leukemia cell line. In addition we evaluated whether the extract of CEE also affects the mRNA levels of Bcr-Abl and p210 expression in this cell line. Materials and Methods: Preparation of methanolic extract of CEE. The aerial parts of CEE were air dried until dryness at room temperature, cut into small pieces and then extracted with methanol through maceration (48 h for 3 times). The resultant total extracts were dried under reduced pressure and their weight was determined. Cell culture. The K562 cells were grown in RPMI 1640 with L-glutamine supplemented with 10% (v/v) heat-inactivated FBS, 1% penicillin/streptomycin in humidified atmosphere of 5% CO2 at 37°C. In all experiments growing cells at optimal concentration were placed in 24 or 96 well plate and then treated with vehicle or 5–100–200 μg/ml methanolic extract of CEE. 48h after the treatment cultures were tested for proliferative activity, mRNA level of Bcr-Abl by RT-PCR and p210 protein expression by western blotting analysis. Proliferative activity. Proliferative activity was determined using the MTT technique according to the method described by Tubaro et al. (1996). The assay was performed in triplicate and absorbance values at 550 nm were measured using a microplate reader. RT-PCR Analysis. The total cellular mRNA was isolated from treated and control cells using an silica coloumns. Using equal amounts of the RNA from each sample, the cDNA was synthesized by Superscript VILO™ cDNA kit. PCR was performed using Platinum® Taq DNA polymerase and specific primers for t(9;22) p210 transcripts (b3a2): GAAGTGTTTCAGAAGCTTTCC (sense) and GTTTGGGCT-TCACACCATTCC (antisense). 35 amplification cycles were performed at 94°C for 30s, 55°C for 30s and 72°C for 1min. Gel electrophoresis and ethidium bromide staining was used to visualize the PCR products. Western Blot Analysis. Cell pellets from control and treated cultures were lysed using lysis buffer with protease and phosphatase inhibitors. The proteins were then quantified and equal amounts (30 ug) were separated by SDS-PAGE and electro-blotted to nitrocellulose. After blocking procedure the blots were incubated with specific primary antibody against p210 protein and then challenged with specific horseradish peroxidase-conjugated secondary antibody. The reactive protein was visualized using an enhanced chemiluminescence detection system. Results: The results have shown that treatment of K562 cell line with methanolic extract of CEE reduced cell viability in a dose-dependent fashion (IC50=41.7 μg/ml) as demonstrated by MTT assay. PCR and Western blot analysis revealed that the cell growth inhibition was associated to a dramatic decrease of mRNA levels of Bcr-Abl and to a significant reduction of p210 protein expression suggesting that the antiproliferative effect of methanolic extract of CEE likely due to the inhibition at transcriptional level of Bcr-Abl oncoprotein. Further studies are needed to better elucidate this mechanisms and to identify the compound of crude extract which is responsible of cancer growth suppression.

scholarly journals Quantitative Analysis of a MDR1 Transcript for Prediction of Drug Resistance in Acute Leukemia

2002 ◽  
Vol 48 (6) ◽  
pp. 811-817 ◽  
Author(s):  
Shin-ichi Fujimaki ◽  
Tadao Funato ◽  
Hideo Harigae ◽  
Junko Fujiwara ◽  
Junichi Kameoka ◽  
...  
Keyword(s):  
Drug Resistance ◽  
Multidrug Resistance ◽  
Quantitative Analysis ◽  
Acute Leukemia ◽  
Mtt Assay ◽  
Rt Pcr ◽  
Biological Resistance ◽  
Copy Numbers ◽  
Mdr1 Mrna ◽  
Fcm Analysis

Abstract Background: Assessing the drug resistance of leukemic cells is important for treatment of leukemia. We developed a quantitative reverse transcription (RT)-PCR method for multidrug resistance 1 (MDR1) and multidrug resistance-related protein 1 (MRP1) transcripts to evaluate drug resistance, and applied it to clinical samples. Methods: The cutoffs for copy numbers of MDR1 and MRP1 transcripts were defined based on copy numbers in healthy bone marrow mononuclear cells. To confirm that the cutoffs reflected biological resistance, we established vincristine (VCR)-resistant K562 sublines that showed various degrees of drug resistance and examined the correlation between the copy numbers of these transcripts and the biological resistance of these clones. In addition, we compared the sensitivity and specificity of quantitative RT-PCR to a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay and flow cytometric (FCM) analysis. Results: The defined cutoff for copy numbers of MDR1 transcripts corresponded with the degree of biological resistance of VCR-resistant K562 sublines. Clinical study revealed that the concentrations of MDR1 mRNA in all relapsed patients with acute myelogenous leukemia (AML) were above the cutoff. Moreover, both AML and acute lymphoblastic leukemia patients with high MDR1 mRNA expression at diagnosis tended to show a low remission rate and short remission periods. No association was observed between the amounts of MRP1 transcripts and clinical outcomes. The specificity and sensitivity of quantitative RT-PCR for MDR1 were superior to the MTT assay and FCM analysis. Conclusion: These results suggest the efficacy of this quantitative analysis of MDR1 transcripts for the prediction of clinical drug resistance in acute leukemia.

Study on RNA Interference Reversing Multidrug Resistance in K562/A02 Resistant Leukemia Cell.

Blood ◽  
2006 ◽  
Vol 108 (11) ◽  
pp. 4362-4362 ◽  
Author(s):  
Yuping Gong ◽  
Ling Gu ◽  
Ting Liu
Keyword(s):  
Multidrug Resistance ◽  
Rna Interference ◽  
Cell Line ◽  
Mtt Assay ◽  
Efflux Pump ◽  
Gene Transfection ◽  
Leukemia Cell ◽  
Expression Vectors ◽  
Transcriptional Gene Silencing ◽  
Mdr1 Mrna

Abstract Multidrug-resistance (MDR) is a major hindrance to successful chemotherapy. Among different mechanisms responsible for MDR, cellular over-expression of P-glycoprotein (Pgp) plays an important role. Pgp is an energy dependent drug efflux pump that effectively transports a broad of commonly used chemotherapeutic drug out of the cells and leads to resistance to the chemotherapeutic drugs. Use of modulators is main approach to overcome MDR. Although, in vitro and in vivo preclinical studies have yielded encouraging results, the clinical reversal of resistance by common modulators such as verapamil, quinine, and cyclosporine A has been difficult due to the toxic side effects. Antisense technology offers an alternative approach to overcome MDR. RNA interference (RNAi) is the best one of all antisense technologies. RNAi acts through a post-transcriptional targeting of mRNA for degradation, resulting in sequence-specific post-transcriptional gene silencing. Short hairpin RNA (shRNA) vectors can be transfected into the cells to stably express siRNA. In our preliminary study, eukaryotic shRNA expression vectors aimed at mdr1 mRNA target sequences were cloned and transfected into drug resistance cell line K562/A02 by liposome-induced gene transfection. The mdr1 mRNA was identified by real time RT-PCR, the function of P-gp was measured by a daunorubicin (DNR) efflux assay, and the sensitivity of cell lines to doxorubicin (ADM) was detected by an MTT assay. Our results showed that two mdr1-targeted shRNAs could down-regulate mdr1 mRNA and P-gp expression, with mdr1 mRNA reduced by 86% and 88%. The intracellular DNR increased after RNAi treatment, with the daunorubicin efflux ratio at 60min were 13% and 22%, compared with control (40%~45%) (P<0.05). The MTT assay demonstrated the relative reversing efficiency to doxorubicin to be 84% and 77%. Conclusion: RNA interference can effectively reverse mdr1-mediated multidrug resistance in resistant leukemic cell line.

Mechanism of Tetrandrine in Combination with Droloxifen To Reverse Multidrug Resistance in Leukemia.

Blood ◽  
2007 ◽  
Vol 110 (11) ◽  
pp. 4172-4172
Author(s):  
Bao-An Chen ◽  
Ai-ling Su ◽  
Feng Gao ◽  
Jian Cheng ◽  
Jia-Hua Ding ◽  
...  
Keyword(s):  
Multidrug Resistance ◽  
Protein Expression ◽  
Cell Line ◽  
Cell Lines ◽  
K562 Cells ◽  
Nuclear Factor Kappab ◽  
Nuclear Factor ◽  
Single Drug ◽  
Resistance Reversal ◽  
Reversal Mechanism

Objective: The study aims to investigate the effect of Tetrandrine (Tetrandrine, Tet) in combination with Droloxifen (Droloxifen, DRL) on the expression of NF-κB(nuclear factor kappaB) of K562 and K562/A02 cell lines and the reversal mechanism of this combination. Method: The activation of NF-κB in K562 and K562/A02 cell lines and the effect of Tet,DRL alone or in combination on NF-κB were determined with Immunocytochemistry and Western blotting respectively. Results: K562/A02 cells displayed higher level of NF-κB protein expression than their parental K562 cells; The application of Tet or DRL alone or in combination had no effect on NF-κB expression in K562 cells at 6h and 12h; Tet and DRL used alone or in combination could significantly down-regulate NF-κB protein expression in nucleaus of K562/A02 cells. The effect was more significant in combination of Tet and DRL than the application of single drug. This decrease became more significant at 12h than at 6h. Conclusions: Activation of NF-κB may be involved in the mechanism of MDR of K562/A02 cell line; Inhibition of NF-κB activation may be involved in the mechanism of multidrug resistance reversal to K562/A02 line of Tet and DRL.

Effect of Tetrandrine and Toremifene on the Reversion of Multidrug Resistance of K562/A02 Cell Line

Blood ◽  
2008 ◽  
Vol 112 (11) ◽  
pp. 5063-5063
Author(s):  
Bao-An Chen ◽  
Qiu-xia Zhao ◽  
Jian Cheng ◽  
Feng Gao ◽  
Wen-lin Xu ◽  
...  
Keyword(s):  
Multidrug Resistance ◽  
Cell Line ◽  
K562 Cells ◽  
Mrna Levels ◽  
Survivin Mrna ◽  
Glycoprotein P ◽  
Reversal Effect ◽  
Protein Levels ◽  
Reversal Mechanism

Abstract Objective: To study the reversal effect of Tetrandrine(Tet) and the estrogen-receptor inhibitor,toremifene(Tor),on multidrug resistance cell line K562/A02 and to investigate the reversal mechanism of this combination. Methods: ADM accumulation and the apoptosis percentage of K562 and K562/A02 cells were analyzed by fluorospectrophotometry, respectively. The protein levels of P-glycoprotein (P-gp) were detected by fluorospectrophotometry. The mRNA levels of mdr1 and Survivin were determined by RT-PCR. Results: The IC50 of ADM for K562/A02 and K562 cells were 57.43±4.55mg/L and 1.16±0.05mg/L respectively. Pretreating K562/A02 cells with toremifene(2.5μmol/L) or Tet(1μmol/L) for 72 hours partially restored the sensitivity of K562/A02 cells to ADM (IC50 were 20.74±1.62mg/L and 14.12±1.20mg/L respectively) but had no effect on K562 cells; IC50 of combined tetrandrine and toremifene was 9.14±1.03mg/L;K562/A02 showed apoptotic characteristics after treated with tetrandrine, toremifene (alone or combination);tetrandrine and toremifene (alone or combination) elevated the intracellular ADM accumulation in K562/A02; P-gp, mdr1 and Survivin mRNA were down regulated. Conclusion: Tetrandrine, toremifene (alone or combination) showed significant MDR reversal activity in vitro The reversal activity may be related to the inhibition of P-gp overexpression and down regulation the expression of mdr1 and Survivin mRNA to increase the intracellular accumulation of anticancer drugs, which lead to more K562/A02 cells apoptosis; Multidrug resistance (MDR) can be partially reversed by Tet or Tor of which the combination shows a great synergistic reversal effect.

The Transcription Factor SCL/TAL-1 Plays a Positive Role in the Erythropoietic Differentiation Via MEK/ERK Pathway in EPO-Induced K562 Cell Line

Blood ◽  
2011 ◽  
Vol 118 (21) ◽  
pp. 4799-4799
Author(s):  
Yuping Gong ◽  
Ruiqing Zhou ◽  
Ting Niu
Keyword(s):  
Transcription Factor ◽  
Cell Line ◽  
K562 Cell ◽  
K562 Cells ◽  
Erythroid Differentiation ◽  
Mrna Levels ◽  
Erk Pathway ◽  
Rt Pcr ◽  
K562 Cell Line ◽  
Positive Role

Abstract Abstract 4799 Objective In the present study, EPO-induced K562 cell line was used to be the cell model of erythroid differentiation, the role and mechanism of transcript factor SCL/TAL-1 in the erythropoiesis was investigated. Methods Three plasmids, which included pTRIPdU3-RNAiTALh -EF1a-GFP (SCL/TAL1 shRNA to reduce the expression of SCL/TAL-1), pTRIP-EF1a-TAL1 (SCL/TAL-1 cDNA to enhance the expression of SCL/TAL-1) and control plasmid pTRIP-dU3-RNAiluc-EF1-GFP expressing EGFP gene, were transfected into K562 cell line via lentiviral vector system, and K562 SCL/TAL-1low, K562 SCL/TAL-1high and K562 LUC (control) were established and the effect of reducing or enhancing the expression of SCL/TAL-1 on the erythropoiesis of these three cell lines was investigated. After incubated with EPO-RPMI1640 medium in which EPO induced K562 cell line into erythropoiesis for 5 day, the mRNA levels of SCL/TAL-1 and erythroid related RhD, GPA, CD47 were detected by RT-PCR assay and erythroid antigen CD71, CD235a were examined by flow cytometry in the three cell lines. Effect of SCL/TAL-1 on key phosphorylated proteins, including p-PTEN, p-Akt, p-mTOR, p-P70 and p-4EBP-1 from PI3K/Akt/mTOR pathway and p-c-Raf, p-MEK and p-ERK1/2 from Raf/MEK/ERK pathway, in the downstream of EGFR signaling pathway were checked by Western Blot assay. Effect of MEK-ERK 1/2 inhibitor U0126 on the expression of SCL/TAL1 also examined. Results 1. After 48h of transfect, more than 95% of K562 cells were GFP positive under the fluorescence microscope, indicating that infection rate of the plasmids in the K562 cells was more than 95%. 2. The results of RT-PCR showed SCL/TAL-1 mRNA expression in the K562 SCL/TAL-1low was significantly lower than that in the K562 LUC control (P <0.05). The mRNA levels of CD47 and RhD was also significantly lower and however, GPA just decreased slightly in comparison with the control. The mRNA levels of above erythroid antigens increased a little in K562-SCL/TAL-1high. 3. The FCM results showed the expression of CD71, CD235a obviously reduced in the K562 SCL/TAL-1low and positive rates were 10.4% and 76.5%, while the positive rates in the LUC control were 94.3% and 83.6%. The expression of CD71 and CD235a in K562-SCL/TAL-1high was similar to the control. 4. The level of p-MEK and p-ERK1/2 increased with transfect of SCL/TAL-1 cDNA and decreased after SCL/TAL-1 RNA interference. However, there were no obvious changes to be observed in PI3K-Akt-mTOR pathway, another important signal pathway. 5. There was no obvious alteration in SCL/TAL-1 level after treatment of MEK-ERK1/2 inhibitor, although MEK-ERK1/2 level reduced. Conclusion Our findings suggest that transcription factor SCL/TAL-1 plays a positive role in erythroid differentiation in EPO-induced K562 cell line. SCL/TAL-1 is located in the upstream of MEK-ERK1/2 and may regulate erythroid differentiation by affecting the phosphorylation levels of MEK-ERK1/2 pathway. Grant support: National Natural Science Foundation of China (No.30770912), Foundation of the Science & Technology Department of Sichuan Province (No.2008SZ0017). Disclosures: No relevant conflicts of interest to declare.

Anti-Leukemic Activity of Phosphoinositide 3-Kinase Inhibitor, Copanlisib in ABL Tyrosine Kinase Resistant Leukemia Cells

Blood ◽  
2014 ◽  
Vol 124 (21) ◽  
pp. 3127-3127
Author(s):  
Seiichi Okabe ◽  
Tetsuzo Tauchi ◽  
Yuko Tanaka ◽  
Seiichiro Katagiri ◽  
Kazuma Ohyashiki
Keyword(s):  
Cell Growth ◽  
Growth Inhibition ◽  
Cell Line ◽  
Kinase Inhibitor ◽  
K562 Cells ◽  
Leukemia Cells ◽  
Cell Growth Inhibition ◽  
Abl Tyrosine Kinase ◽  
Primary Sample ◽  
Resistant Cells

Abstract Introduction: Chronic myelogenous leukemia (CML) is characterized by cytogenetic aberration (Philadelphia chromosome: Ph) and chimeric oncoprotein BCR-ABL. ABL tyrosine kinase inhibitor (TKI) therapy such as imatinib, nilotinib and dasatinib has improved the survival of Ph-positive leukemia patients. Although impressive clinical responses are obtained in the majority of CML patients, increasing evidence of acquired resistance to TKIs have been documented in clinically. Moreover, ABL TKIs cannot eradicate leukemia stem cells, thus, TKIs do not appear to lead to a cure the diseases. Therefore, new approach against BCR-ABL mutant cells and leukemia stem cells may improve the outcome of Ph-positive leukemia patients. Phosphoinositide 3-kinase (PI3K) pathway regulates cell metabolism, proliferation and survival. Furthermore, aberrant activation of PI3K signaling pathway has been shown to be important in initiation maintenance of human cancers. Copanlisib, also known as BAY80-6946 is a PI3K inhibitor with potential antineoplastic activity. Copanlisib is being investigated in a pivotal phase 2 clinical trial against hematological malignancies such as malignant lymphoma. We hypothesized that targeting PI3K, in combination with ABL TKI, would result in enhanced therapeutic activity in Ph-positive leukemia cells including T315I mutation and ABL TKI resistant. Materials and methods: We investigated the combination therapy with a copanlisib and an ABL TKIs (imatinib, nilotinib and ponatinib) by using the BCR-ABL positive cell line, K562, murine Ba/F3 cell line which was transfected with T315I mutant, nilotinib resistant K562, ponatinib resistant Ba/F3 cells and primary sample. Results: 72 h treatment of copanlisib exhibits cell growth inhibition against K562 cells in a dose dependent manner. The treatment of imatinib, nilotinib and ponatinib exhibits cell growth inhibition partially against K562 cells co-cultured with feeder cell line, HS-5. We found that the treatment of copanlisib abrogated the protective effects of HS-5 in K562 cells. We examined the intracellular signaling after treatment of copanlisib. High concentration of copanlisib reduced the phosphorylation of BCR-ABL and Crk-L. Activity of caspase 3 and poly (ADP-ribose) polymerase (PARP) was increased. We next investigated the efficacy between ABL TKI and copanlisib by using these cell line. Phosphorylation of BCR-ABL, Crk-L and Akt was reduced after imatinib and copanlisib treatment. We investigated the copanlisib activity against T315I positive cells. Copanlisib potently induced cell growth inhibition of Ba/F3 T315I cells. Combined treatment of Ba/F3 T315I cells with ponatinib and copanlisib caused significantly more cytotoxicity than each drug alone. Phosphorylation of BCR-ABL and Crk-L was reduced and cleaved PARP was increased after ponatinib and copanlisib treatment. To assess the activity of copanlisib and ponatinib, we performed to test on CML tumor formation in mice. We injected nude mice subcutaneously with Ba/F3 T315I mutant cells. A dose of 20 mg/kg/day p.o of ponatinib and 6 mg/kg/three times per week i.p of copanlisib inhibited tumor growth and reduced tumor volume compared with control mice. The treatments were well tolerated with no animal health concerns observed. We also found that the treatment of copanlisib exhibits cell growth inhibition against Ba/F3 ponatinib resistant cells, K562 nilotinib resistant cells and primary sample. Conclusion: These results indicated that administration of the PI3K inhibitor, copanlisib may be a powerful strategy against ABL TKI resistant cells including T315I mutation and enhance cytotoxic effects of ABL TKI against those Ph-positive leukemia cells. Disclosures Ohyashiki: Bristol: Honoraria, Research Funding.

Sign in / Sign up

Export Citation Format

Share Document