Cytogenetic Risk Stratification in Primary Versus Post-Essential Thrombocythemia / Post-Polycythemia Vera Myelofibrosis

Abstract Introduction: The Dynamic International Prognostic Scoring System-Plus (DIPPS-Plus) for primary myelofibrosis (PMF) categorizes cytogenetic abnormalities as "favorable" and "unfavorable." Abnormalities (Abn) -7/7q-; -5/5q-; i(17q), +8; inv(3); 12p-; 11q23; and complex karyotype (CK; >3 Abn) are considered unfavorable. More recently monosomal karyotype (MK), defined as 2 autosomal monosomies or a single monosomy with at least one additional structural Abn, was also recognized as unfavorable (Vaidya, Blood 2011). While the prognostic impact of cytogenetic Abn has been studied in patients with PMF, almost no data exist in patients with post-essential thrombocythemia/polycythemia vera myelofibrosis (PET/PV-MF). Objective: To identify the impact of cytogenetic Abn on prognosis in patients with PMF and PET/PPV-MF referred to our center between 1984 and 2013. Methods: We retrospectively reviewed the charts of 1100 patients with MF. Cytogenetic analysis performed at the time of referral to our institution was reported according to the International System for Human Cytogenetic Nomenclature. Overall survival (OS) was calculated and compared using the Kaplan-Meier method with the log rank test. The impact of each cytogenetic Abn on OS was measured by stepwise Cox regression model by comparing them against patients with diploid karyotype. Analyses were conducted separately for patients with PMF and PET/PPV-MF. Results: Cytogenetic data (≥ 10 metaphases) were available in 981 patients (660 with PMF and 321 with PET/PPV-MF). Median age was similar in both groups (66 years; range, 27-90), and 61% of patients were male. The distribution of DIPSS scores were similar in both groups (overall 7% low, 37% int-1, 41% int-2 and 15% high). OS in each DIPSS category were 134, 65, 33, 19 months in patients with PMF; and 160, 73, 48, 36 in patients with PET/PPV-MF (in both groups P<0.001). The JAK2 mutation was present in 65% of patients in both groups. Overall, 621 (63%) patients had diploid karyotype (DK), 17% had CK (n=62), and 7% had MK (n=26). Abnormal karyotypes present in >10% of patients were single 20q- (n=75, 21%), single 13q- (n=38, 11%), and CK (n=62, 17%). Others Abn (single +8, +9, single -7/7q-, -5/5q-, or various combinations of the two Abn) occurred less frequently. Importantly, Abn of chromosome (chr) 17 occurred only in patients with PMF, while all other Abn were similarly distributed among PMF and PET/PPV-MF. Ninety nine patients (10%) developed AML, 44% of whom had cytogenetic Abn, similar in PMF and PET/PPV-MF. After a median follow-up of 31 months (range, 0.5-251), 548 (56%) of patients have died, with similar rates in both groups. Impact of different cytogenetic Abn on OS is presented in Table 1 and Graph 1 for PMF, and Graph 2 for PET/PPV-MF. We have identified 4 different risk categories in PMF patients with respective median OS of 86, 46, 14 and 6 months (P<0.001, Graph 1A). Only 2 different categories were identified in patients with PET/PPV-MF, with the corresponding OS of 70 and 14 months (P<0.001, Graph 1B); further separation of these patients was not possible due to smaller number of patients with specific Abn. Conclusions: Results from our cohort of 691 PMF and 321 PET/PPV-MF patients differ from those described in DIPSS-Plus. First, we showed that OS in patients with PMF and single +8 Abn, and 1-3 abnormalities (excluding chromosomes 5, 7, 12p and MK) is no different than in those with normal karyotype. Second, OS was the best in patients with single 20q- Abn, which was significantly better than in patients with normal karyotype. Third, we report cytogenetic stratification on the largest cohort of PET/PPV-MF patients, with findings different than in PMF (Table 1). Further validation in larger multicenter studies is warranted. Table Table. Figure Overall survival in PMF [1A] and PET/PPV-MF [1B] patients stratified by cytogenetic groups. Figure. Overall survival in PMF [1A] and PET/PPV-MF [1B] patients stratified by cytogenetic groups. Disclosures Cortes: ARIAD: Consultancy, Research Funding; BMS: Consultancy, Research Funding; Novartis: Consultancy, Research Funding; Pfizer: Consultancy, Research Funding; Teva: Research Funding.

Download Full-text

Complete Remissions (CRs) with Azacitidine Regimens Compared to Crs with 7+3 Induction Chemotherapy and the Effect on Overall Survival

Blood ◽

10.1182/blood.v128.22.1613.1613 ◽

2016 ◽

Vol 128 (22) ◽

pp. 1613-1613 ◽

Cited By ~ 2

Author(s):

Megan Othus ◽

Mikkael A Sekeres ◽

Sucha Nand ◽

Guillermo Garcia-Manero ◽

Frederick R. Appelbaum ◽

...

Keyword(s):

Overall Survival ◽

Prognostic Factors ◽

Research Funding ◽

Cox Regression ◽

Intensive Therapy ◽

Univariate Analysis ◽

Multivariable Analysis ◽

Curative Intent ◽

Kaplan Meier ◽

The Impact

Abstract Background: CR and CR with incomplete count recovery (CRi) are associated with prolonged overall survival (OS) for acute myeloid leukemia (AML) patients (pts) treated with curative-intent, induction therapy. For AML pts treated with azacitidine (AZA), response (CR, partial response, marrow CR, or hematologic improvement) is also associated with prolonged OS. We evaluate whether patients given AZA for myelodysplastic syndromes (MDS) or AML had longer OS if they achieved CR. We also compare the effect size of CR on OS between AZA regimens and 7+3. Patients and Methods: We analyzed four SWOG studies: S1117 (n=277) was a randomized Phase II study comparing AZA to AZA+lenalidomide or AZA+vorinostat for higher-risk MDS and CMML pts (median age 70 years, range 28-93); S0703 (n=133) treated AML pts not eligible for curative-intent therapy with AZA+mylotarg (median age 73 years, range 60-88). We analyzed the 7+3 arms of S0106 (n=301 were randomized to 7+3, median age 48 years, range 18-60) and S1203 (n=261 were randomized to 7+3, median age 48 years, range 19-60). CR was defined per 2003 International Working Group criteria. In S1117 CR was assessed every 16 weeks and patients remained on therapy until disease progression. In S0703, S0106, and S1203 CR was assessed following 1-2 induction cycles; patients not achieving CR (S0106) or CRi (S0703 and S1203) were removed from protocol treatment. OS was measured from date of study registration. To avoid survival by response bias, we performed landmark analyses of OS. We present results based on the study-specific landmark date that 75% of pts who eventually achieved a CR had done so (S1117 144 days, S0703 42 days, S0106 44 days, S1203 34 days). Pts who did not achieve CR by this date were analyzed with pts who never achieved CR. Pts who died or were lost to follow-up before this date were excluded from analyses. As a sensitivity analysis we also analyzed based on the 90% date; results were not materially different. Log-rank tests were used to compare survival curves and Cox regression models were used for multivariable modeling including baseline prognostic factors age, sex, performance status, white blood cell count, platelet count, marrow blast percentage, de novo disease (versus antecedent MDS or therapy-related disease), study arm (for S1117 only), and cytogenetic risk (IPSS criteria for S1117, SWOG criteria for S0703, S0106, and S1203). The following analysis considers morphologic CR only. S0106 treated CR with incomplete count recover (CRi) pts as treatment failures (S0703 and S1203 did not) and CRi was not defined for S1117. Hematologic improvement was only defined for S1117 patients. Results: In univariate analysis, CR was significantly associated with prolonged survival among MDS pts treated with azactidine on S1117 (HR=0.55, p=0.017), confirming the results seen in AML pts treated with azacitidine (and mylotarg, S0703, HR=0.60, p=0.054) and 7+3 (S0106 HR=0.44, p<0.001; S1203 HR=0.32, p<0.0001) (Figure 1). For each study this relationship remained significant in multivariable analysis controlling for baseline prognostic factors (S1117 HR=0.25, p<0.001; S0703 HR=0.64, p=0.049; S0106 HR=0.45, p<0.001; S1203 HR=0.41, p<0.001). There was no evidence that the impact of CR varied across the four cohorts (interaction p-value = 0.76). In the full cohort, the effect of CR was associated with a HR of 0.45 (Table 1). Conclusion: Adjusting for pt characteristics, achievement of morphologic CR was associated with a 60% improvement in OS, on average, compared to that seen in pts who don't achieve a CR, regardless of whether pts were treated with 7+3 or AZA containing regimens, and suggesting that value CR is similar of whether pts receive more or less "intensive" therapy for these high grade neoplasms. Support: NIH/NCI grants CA180888 and CA180819 Acknowledgment: The authors wish to gratefully acknowledge the important contributions of the late Dr. Stephen H. Petersdorf to SWOG and to study S0106. Figure 1 Kaplan-Meier plots of landmark survival by response. Figure 1. Kaplan-Meier plots of landmark survival by response. Table 1 Multivariable analysis, N=878 Table 1. Multivariable analysis, N=878 Disclosures Othus: Glycomimetics: Consultancy; Celgene: Consultancy. Sekeres:Celgene: Membership on an entity's Board of Directors or advisory committees. Erba:Millennium Pharmaceuticals, Inc.: Research Funding; Amgen: Consultancy, Research Funding; Seattle Genetics: Consultancy, Research Funding; Agios: Research Funding; Gylcomimetics: Other: DSMB; Juno: Research Funding; Daiichi Sankyo: Consultancy; Sunesis: Consultancy; Pfizer: Consultancy; Ariad: Consultancy; Jannsen: Consultancy, Research Funding; Incyte: Consultancy, DSMB, Speakers Bureau; Celator: Research Funding; Astellas: Research Funding; Celgene: Consultancy, Speakers Bureau; Novartis: Consultancy, Speakers Bureau.

Download Full-text

The Impact of 20q Deletion on Clinical Presentation, Treatment Response and Survival in Patients with Acute Myeloid Leukemia (AML): The University of Texas MD Anderson Cancer Center Experience

Blood ◽

10.1182/blood.v126.23.1369.1369 ◽

2015 ◽

Vol 126 (23) ◽

pp. 1369-1369

Author(s):

Jad Chahoud ◽

Hagop M. Kantarjian ◽

Farhad Ravandi ◽

Koji Sasaki ◽

Guillermo Garcia-Manero ◽

...

Keyword(s):

Overall Survival ◽

Treatment Response ◽

Research Funding ◽

Objective Response ◽

Normal Karyotype ◽

Prognostic Indicators ◽

Cancer Center ◽

Cytogenetic Abnormalities ◽

Md Anderson ◽

The Impact

Abstract Background: Karyotype classification is one of the strongest independent prognostic indicators in AML. The majority of recurring chromosomal aberrations are associated with an individual prognosis, other less frequent like the Del (20q), have been minimally evaluated and classified as intermediate risk in AML. Multiple studies established isolated 20q deletion as a good prognostic marker in MDS, with lower AML transformation rates and longer median overall survival (OS) in comparison with complex 20q deletion. Objective: The aim of this study is to determine the frequency and the impact on outcome of 20q deletion alone or with additional cytogenetic abnormalities in adult patients with AML. Patients and Methods: AML patients with chromosome 20 abnormalities were identified between 2000 and 2012 through the MD Anderson Cancer Center AML database (n=1741). Collected data included baseline demographics, number and type of additional cytogenetic abnormalities, disease characteristics, treatment and outcome. OS was defined as time from hematological diagnosis to death or last follow-up and relapse-free survival (RFS) was measured from time of hematological response to relapse. The Kaplan-Meier product limit method was used to estimate overall survival and the log-rank tests were employed for statistical comparisons between the OS curves. Results: From a total of 1741 adult AML patients, we identified 35 with Del (20q), representing 2% of our cohort. The distribution of cytogenetic abnormalities was as follows: isolated Del (20q) in 5 (14%), +8 in 3 (9%), +8 complex in 2 (6%), -5 complex in 8 (23%), -7 complex in 5 (14%), -7 not complex in 1 (3%), -5 and -7 complex in 6 (17%), other complex in 1 (3%), and other not complex in 4 (11%). Patients with Del (20q) were older (p=0.04), with lower bone marrow blast numbers (p<0.001), and lower WBC (p=0.001) compared to patients without Del (20q) (Table 1). Median RFS and OS for patients with Del (20q) were 16.8 and 7.5 months (mos), respectively. Objective response rates were 43% and 65% for patients with and without Del (20q), respectively (p=0.04) and the CR rates were 36% and 58%, respectively (p=0.01). Significant benefit was observed for OS in patients without Del (20q) (13.5 mos; 95% CI, 13.45-13.49; p=0.011), but not in RFS (19.52 mos; 95% CI, 19.48-19.55; p=0.376) in comparison with patients with Del (20q) (16.8 mos; 95% CI, 16.41-17.23; and 7.5 mos; 95% CI, 7.26-7.73). Patients with Del (20q) were compared to the remaining patients with leukemia classified as unfavorable cytogenetic status; the median survival for Del (20q) patients was similar by OS (OS 6.9 mos, 95% CI, 6.82-6.91). On the other hand, patients with Del (20q) had a significantly decreased overall survival (7.5 mos; 95% CI, 7.26-7.73, p=0.002) in comparison to patients with normal karyotype (17.7 mos; 95% CI, 17.64-17.71). No difference in survival was observed between patients with isolated Del (20q) and those with additional cytogenetic abnormalities: the median OS were 5 and 7.5 mos, respectively (p=0.964) (Figure 1). Conclusion: Our data demonstrated that Del (20q) occurs in 2% of previously untreated AML patients, with around 63% of these patients showing complex karyotype. Patients with Del (20q) have lower response rate and worse outcome, similar to patients with unfavorable cytogenetics. Table 1. Clinical descriptors, hematologic parameters and outcome of each set of patients Del 20qin Karyotype All othersnon-Del 20q P N = 35 N = 1706 Age (y), median (range) 65 (35-83) 61 (12-89) 0.04 Baseline hematologic data median (range) WBC × 109/L 2.7 (0.7-32.6) 5.8 (0.3-433) 0.001 Hemoglobin, g/dL 8.1 (5.6-14.2) 8.7 (2-93.3) 0.29 Platelet count, × 109/L 40 (7-254) 49 (2-676) 0.21 Neutrophil 29 (4-88) 16 (0-94) <0.001 PB blasts 9 (0-50) 16 (0-99) 0.02 BM blasts 30 (7-98) 47 (0-99) <0.001 Treatment Response and Survival Prior Chemo/XRT 7 301 0.72 CR 13 (37%) 990 (58%) 0.01 CRp 3 (9%) 88 (5%) 0.03 Cri 0 18 (1%) - RFS median, mo (95% CI) 17.22 (16.81-17.62) 25.59 (25.56-25-62) 0.55 OS median, mo (95% CI) 7.49 (7.26-7.73) 13.47 (13.45-13.49) 0.01 Disclosures Chahoud: American Society of Hematology (ASH): Other: 2015 HONORS Award recipient. Off Label Use: Inotuzumab.. Cortes:Novartis: Consultancy, Research Funding; Pfizer: Consultancy, Research Funding; BMS: Consultancy, Research Funding; BerGenBio AS: Research Funding; Teva: Research Funding; Ariad: Consultancy, Research Funding; Astellas: Consultancy, Research Funding; Ambit: Consultancy, Research Funding; Arog: Research Funding; Celator: Research Funding; Jenssen: Consultancy.

Download Full-text

Survival among colorectal cancer patients with a history of previous cancer.

Journal of Clinical Oncology ◽

10.1200/jco.2020.38.15_suppl.e16146 ◽

2020 ◽

Vol 38 (15_suppl) ◽

pp. e16146-e16146

Author(s):

Sandi Pruitt ◽

David E. Gerber ◽

Hong Zhu ◽

Daniel Heitjan ◽

Bhumika Maddineni ◽

...

Keyword(s):

Colorectal Cancer ◽

Overall Survival ◽

Cox Regression ◽

Population Based ◽

Competing Risk ◽

Cancer Specific Survival ◽

Risk Of Death ◽

Number Of Patients ◽

Significant Difference ◽

The Impact

e16146 Background: A growing number of patients with colorectal cancer (CRC) have survived a previous cancer. Although little is known about their prognosis, this population is frequently excluded from clinical trials. We examined the impact of previous cancer on overall and cancer-specific survival in a population-based cohort of patients diagnosed with incident CRC. Methods: We identified patients aged ≥66 years and diagnosed with CRC between 2005-2015 in linked SEER-Medicare data. For patients with and without previous cancer, we estimated overall survival using Cox regression and cause-specific survival using competing risk regression, separately by CRC stage, while adjusting for numerous covariates and competing risk of death from previous cancer, other causes, or the incident CRC. Results: Of 112,769 CRC patients diagnosed with incident CRC, 15,935 (14.1%) had a previous cancer – most commonly prostate (32.9%) or breast (19.4%) cancer, with many 7505 (47.1%) diagnosed ≤5 years of CRC. For all CRC stages except IV in which there was no significant difference in survival, patients with previous cancer had modestly worse overall survival (hazard ratios from fully adjusted models range from 1.11-1.28 across stages; see Table). This survival disadvantage was driven by deaths due to previous cancer and other causes. Notably, most patients with previous cancer had improved CRC-specific survival. Conclusions: CRC patients who have survived a previous cancer have generally worse overall survival but superior CRC-specific survival. This evidence should be considered concurrently with concerns about trial generalizability, low accrual, and heterogeneity of participants when determining exclusion criteria. [Table: see text]

Download Full-text

The impact of time-to-castration resistance on survival in patients with metastatic hormone-naïve prostate cancer: A multicenter retrospective study.

Journal of Clinical Oncology ◽

10.1200/jco.2020.38.6_suppl.213 ◽

2020 ◽

Vol 38 (6_suppl) ◽

pp. 213-213

Author(s):

Teppei Okamoto ◽

Shingo Hatakeyama ◽

Masahiro Takahashi ◽

Shintaro Narita ◽

Masanori Ishida ◽

...

Keyword(s):

Prostate Cancer ◽

Cox Regression ◽

Prognostic Impact ◽

Castration Resistant Prostate Cancer ◽

Castration Resistance ◽

First Line ◽

Cox Regression Analysis ◽

Line Life ◽

Number Of Patients ◽

The Impact

213 Background: To evaluate the prognostic impact of time to castration resistance (TCR) in patients with metastatic hormone-naïve prostate cancer (mHNPC). Methods: We retrospectively evaluated 283 mHNPC patients with metastatic castration-resistant prostate cancer (mCRPC) who were initially treated with androgen deprivation therapy as metastatic hormone-naïve prostate cancer in 14 hospitals between September 2008 and October 2018. Overall survival (OS) and OS after castration resistance (OS-CR) were compared between the <12 months (TCR <12M) and ≥12 months (TCR ≥12M). The association between the first-line life-prolonging therapy (docetaxel or new androgen receptor-targeted agents: ART) and TCR on OS-CR was investigated using multivariate Cox regression analysis via inverse probability of treatment weighting (IPTW) model. Results: Median age and time to CRPC were 72 years and 12 months, respectively. The number of patients in the TCR<12M and ≥12M groups were 137 and 146, respectively. Of 283, baseline parameters such as age, extent of disease (EOD), hemoglobin (Hgb), lactate dehydrogenase (LDH), and serum albumin levels were significantly differences in between the groups. We observed significantly poor OS and OS-CR in the TCR <12M group than those in the TCR ≥12M group. First-line docetaxel therapy did not significantly improved OS-CR regardless of TCR. Background (age, ECOG PS, GS, Hgb, tumor volume, serum data, and TCR)-adjusted multivariate Cox regression analyses showed that first-line docetaxel therapy was significantly associated with shorter OS-CR than first-line ART therapy in the TCR <12M group. Conclusions: The prognostic impact of TCR on OS was significant. However, the association between the first-line life-prolonging therapy and TCR on OS need further study.

Download Full-text

The Impact of MN1 Over-Expression on the Outcome of Younger Patients with AML Treated with Intensive Chemotherapy with or without ATRA Therapy

Blood ◽

10.1182/blood.v112.11.2978.2978 ◽

2008 ◽

Vol 112 (11) ◽

pp. 2978-2978

Author(s):

Carol Guy ◽

Amanda Gilkes ◽

Rosemary Gale ◽

David C. Linch ◽

Robert Hills ◽

...

Keyword(s):

Overall Survival ◽

De Novo ◽

Performance Status ◽

Normal Karyotype ◽

White Blood Count ◽

Prognostic Impact ◽

Atra Treatment ◽

Over Expression ◽

The Impact ◽

To Receive

Abstract Over-expression of the MN1 gene has been reported in AML, and appears to be associated with the inv(16) subgroup. In a study of 142 patients with normal karyotype (NK) it was found to be an adverse prognostic factor for CR and overall survival in older patients (Heuser et al Blood2006, 108:3898). In addition over-expression correlates with unmutated NPM1 and resistance to ATRA in combination with chemotherapy in non-APL with NK (Heuser et al Blood2007, 110:1639). The UK MRC 12 trial treated patients with standard induction of ADE/MAE/DAT followed by 2 or 3 consolidation courses (MACE/MidAc/ICE). Of the 3459 patients recruited to the trial 1097 were also randomised to receive ATRA 45mg/m2/d (d 1–60); all these patients received DAT chemotherapy. Diagnostic samples were available from 196 patients in the ATRA randomisation for a retrospective analysis of the prognostic impact of MN1 over-expression. Methods: cDNA was generated using random priming and MuLV reverse transcriptase (Applied Biosystems). MN1 exon 1 forward, ATTGACCTGGACTCGCTGATG (Carella et al. Leukemia, 2007, 21:1679) and MN1 exon2 reverse, TGCTGAGGCCTTGTTTGCA primers were used to measure RNA abundance, giving a product of 174bp. The expression of ABL was used as an endogenous control: primers NA4_abl_exon4 CGGCTCTCGGAGGAGACGTAGA and A2N_abl-exon2 CCCAACCTTTTCGTTGCACTGT (Emig et al, Leukemia1999, 13:1825) resulting in a product of 386 bp. Both primer sets are intron spanning and do not function on genomic DNA. PCR reactions were carried out to ensure linear amplification using dilutions of an inv(16) patient sample across the expected range which enabled the relative concentrations of MN1 and ABL, and the expression relative to the standard sample, to be calculated. Results: The median age of patients was 46 years (range 17–68); median follow up was 7.1 years. 107/196 patients were randomised to receive ATRA. MN1 status, whether viewed as high/low, or as a continuous variable was not significantly associated with age, white blood count (WBC) or sex; patients with normal karyotype were found to have lower MN1 levels (p<0.0001), patients with inv(16) or adverse cytogenetics tended to have higher MN1 levels (p=0.001, p=0.0007). Patients with NPM1 mutations, or FLT3-ITD mutations tended to have lower MN1 levels (p<0.0001, p=0.02 respectively). There was no significant impact of MN1 levels on remission rates, overall survival (OS) or relapse in either univariate analyses or those adjusted for age, WBC, sex, cytogenetics, performance status, de Novo/Secondary disease, FLT3-ITD and NPM1 status (effect sizes per log increase in MN1: CR adjusted OR 0.80 (0.42–1.52) p=0.5; OS adjusted HR 0.92 (0.69–1.23) p=0.6; Relapse adjusted HR 1.20 (0.83–1.72) p=0.3). Results were similar if analyses were restricted to normal karyotype patients. Overall there was no significant effect of ATRA, as reported previously (Burnett et al ASH 2002 abstract 529). There was no significant interaction between MN1 level and ATRA treatment for CR (unadjusted p=0.7; adjusted p=0.8) or overall survival (unadjusted p=0.9; adjusted p=0.8). However, in adjusted analyses there was a suggestion that the effect of ATRA on relapse was greater in patients with low MN1 levels (adjusted p=0.08). Similarly, looking at the normal karyotype group only there was no evidence of interaction on CR (adjusted p=0.4) or OS (adjusted p=0.9), with a similar greater effect of ATRA on relapse in low MN1 level patients (adjusted p=0.02). Conclusions: The data show a possible interaction between MN1 and ATRA treatment on relapse when adjusted for other baseline variables, but no evidence of prognostic value, nor that any effect of ATRA is moderated by MN1 when considering remission or survival.

Download Full-text

Improvement In Renal Function In Newly Diagnosed Myeloma Improves Survival, but Still Remains Inferior to Those with Normal Renal Function

Blood ◽

10.1182/blood.v116.21.2970.2970 ◽

2010 ◽

Vol 116 (21) ◽

pp. 2970-2970 ◽

Cited By ~ 1

Author(s):

Shaji Kumar ◽

Angela Dispenzieri ◽

Martha Lacy ◽

Suzanne R. Hayman ◽

Francis Buadi ◽

...

Keyword(s):

Overall Survival ◽

Renal Function ◽

Renal Insufficiency ◽

Serum Creatinine ◽

Renal Dysfunction ◽

Research Funding ◽

Negative Impact ◽

Newly Diagnosed ◽

Number Of Patients ◽

The Impact

Abstract Abstract 2970 Background: Over a quarter of patients (pts) with symptomatic multiple myeloma (MM) have some degree of renal insufficiency at the time of diagnosis. Multiple studies show that presence of renal failure is strong predictor of inferior overall survival in MM. With effective therapy, renal function improves in a considerable number of patients. It is not clear if the return of renal function to normal levels will improve their outcome to that expected for patients without renal dysfunction. Methods: We evaluated 1478 patients with newly diagnosed myeloma seen at Mayo Clinic within 90 days of diagnosis, between January 1999 and January 2009. We examined these patients for improvement in renal function and identified the lowest serum creatinine obtained during the disease course. The outcomes were analyzed with respect to the renal function improvements. Results: The median age at diagnosis was 64 years (range; 22–93) and 50% were male. The median estimated follow up for the entire cohort was 53 months, with 781 patients alive at the time of analysis with a median follow of 3 years. The serum creatinine was over 1.5 mg/dL at diagnosis in 333 (22.5%) pts and over 2.5 mg/dL in 148 (10%) pts. The median overall survival for the 333 patients was 37 mos (95% CI; 28, 40) compared to 56 mos (95% CI; 51, 63) for those < 1.5 mg/dL; P < 0.001. Among the 333 pts with baseline Cr > 1.5 mg/dl, any improvement in Cr was seen in 263 (79%) including an improvement of at least 0.5 mg/dL in 208 (62%) pts. Among the 263 pts with any improvement, the median time to lowest Cr was 4 months (range; 1–13). The median survival of the group of patients with Cr <= 1.5 mg/dl, over 1.5 mg/dL at diagnosis but improved to <= 1.5 mg/dL, or remained >1.5 mg/dL were 56., 40 and 27 mos respectively; P < 0.001, Figure). We then examined the impact of renal function improvement in the group of patients where the baseline Cr was >2.5 mg/dL. The median OS for the 42 (out of 148 pts with Cr > 2.5 at diagnosis) who had improved to <=1.5 mg/dL was 40 mos compared to 56 mos for those with a Cr <= 1.5 mg/dL at diagnosis and 27.4 mos for the 106 pts whose Cr did not decrease to <= 1.5 mg/dL; P < 0.001. Conclusion: The results of this study point toward improved outcome among patients with renal dysfunction in whom renal function improves. However, it shows that this improvement in renal function does not necessarily improve survival to that observed for the patients with a comparable level of serum creatinine at diagnosis. While early treatment of asymptomatic myeloma has been shown to have little impact on overall survival, a strategy of waiting for serious features of target organ damage to appear before initiation of treatment may have a negative impact on survival in some patients, especially patients with high light chain production who have a higher predilection for renal insufficiency. Disclosures: Kumar: Celgene: Consultancy, Research Funding; Millennium: Research Funding; Merck: Consultancy, Research Funding; Novartis: Research Funding; Genzyme: Consultancy, Research Funding; Cephalon: Research Funding. Off Label Use: Lenalidomide for treatment of newly diagnosed myeloma. Dispenzieri:Celgene: Honoraria, Research Funding; Binding Site: Honoraria. Lacy:Celgene: Research Funding.

Download Full-text

Multivariate Analysis of the Impact of Pre-Treatment Serum Ferritin Level On Response and Overall Survival in Patients with Myelodysplastic Syndromes Treated with Azacitidine

Blood ◽

10.1182/blood.v120.21.1710.1710 ◽

2012 ◽

Vol 120 (21) ◽

pp. 1710-1710 ◽

Cited By ~ 1

Author(s):

Regina Garcia Delgado ◽

Dunia de Miguel ◽

Alicia Bailen ◽

José Ramón Gonzalez ◽

Joan Bargay ◽

...

Keyword(s):

Overall Survival ◽

Multivariate Analysis ◽

Research Funding ◽

Complete Response ◽

The Other ◽

Prognostic Impact ◽

Transfusion Dependency ◽

Baseline Characteristics ◽

Pre Treatment ◽

The Impact

Abstract Abstract 1710 Introduction: Red blood cell (RBC) transfusion dependency independently predicted inferior overall survival (OS) (Itzykson R, et al. Blood. 2011;117:403-11). Transfusion dependency appears to have a major negative prognostic impact in patients with myelodysplastic syndromes (MDS) (Malcovati L, et al. J Clin Oncol. 2005;23:7594-603). The independent prognostic value of development of iron overload on OS and acute myeloid leukemia (AML) risk in MDS has been demonstrated (Sanz G, et al. Blood. 2008;112:abstract 640). Serum ferritin (SF) concentration predicts morbidity and mortality after hematopoietic cell transplantation (Sorror ML, et al. Blood. 2009;114:abstract 651). The prognostic impact of SF on overall response (OR) and OS in patients with MDS treated with azacitidine (AZA) remains unknown. Aim: To analyze the impact of pre-treatment SF levels on response and OS in patients with World Health Organization-defined MDS or AML with 20–30% bone marrow (BM) blasts who received AZA through a compassionate-use program in Spain. Methods: We report a retrospective multivariate analysis of the impact of SF level on OR and OS in patients treated with AZA. Hematologic response was assessed according to International Working Group 2003 (AML) and 2006 (MDS) criteria. SF levels were selected based on median SF value, dividing in two the first half for a better discrimination of the effect (< 500 ng/mL, 500–1000 ng/mL, and > 1000 ng/mL). Comparison of baseline characteristics between SF level groups was performed using Chi-Squared, Fisher's exact, or Likelihood Ratio Chi-Square test for qualitative variables; and analysis of variance, Mann-Whitney and Wilcoxon, or Kruskal-Wallis test for quantitative variables. A logistic regression model was used to evaluate the effect of pre-treatment variables (ie, SF levels, sex, age, French-American-British classification, BM blast count, time since diagnosis, hemoglobin [Hb] level, International Prognostic Scoring System [IPSS] risk, and thrombocytopenia) on best OR (marrow complete response [mCR] + complete response [CR] + partial response [PR] + hematologic improvement [HI]). A Cox proportional hazards model was used to evaluate the effect of the mentioned variables on OS. All analyses were done using SAS System® version 9.2. Results: Of 240 patients enrolled, pre-AZA SF levels were available for 190 patients. The median pre-treatment SF level was 1001 ng/mL (range 21–5548). Baseline characteristics according to SF levels (< 500 ng/mL [n = 49], 500–1000 ng/mL [n = 46], and > 1000 ng/mL [n = 95]) are summarized in Table 1. OR rates were higher and OS was increased in patients with pre-AZA SF levels of ≤ 1000 ng/mL (Table 2 and Fig). In multivariate analysis, pre-treatment SF levels were predictive of best OR (P = 0.0001). Patients with SF levels > 1000 ng/mL had a reduced likelihood of OR (P < 0.0001 vs SF levels < 500 ng/mL). Baseline SF levels were also predictive of OS (P = 0.0002); patients with SF levels > 1000 ng/mL had the lowest likelihood of OS (P = 0.0012 vs SF < 500 ng/mL; and P = 0.0023 vs SF 500–1000 ng/mL). None of the other variables analyzed had a significant impact on OR or OS. Conclusion: Patients with pre-AZA SF levels > 1000 ng/mL had lower OR rates and inferior OS compared with patients with SF levels ≤ 1000 ng/mL. None of the other patient baseline characteristics analyzed had an impact on these outcomes. Our results suggest that higher OR rates and increased OS are obtained with AZA treatment in MDS patients with SF levels ≤ 1000 ng/mL, compared with patients with SF levels > 1000 ng/mL. This may advocate for early initiation of therapy before increasing SF level; however, prospective controlled clinical trials are needed to confirm this hypothesis. Acknowledgments: Regina Garcia Delgado, Dunia de Miguel, Alicia Bailen, José Ramón González, Joan Bargay, Jose F. Falantes, Rafael Andreu, Fernando Ramos, Mar Tormo, Rafael F. Duarte, Ma José Jiménez Lorenzo, Salut Brunet, Benet Nomdedeu, Antonio Figueredo, Javier Casaño, Llorenç Badiella, and Antonio Fernández Jurado submitted this abstract on behalf of the Asociación Andaluza de Hematología y Hemoterapia, Spain. Disclosures: Garcia Delgado: Celgene Corporation: Research Funding. de Miguel:Celgene Corporation: Speakers Bureau. Bargay:Celgene Corporation: Research Funding. Ramos:Celgene Corporation: Speakers Bureau. Sanz:Celgene Corporation: Speakers Bureau.

Download Full-text

The FLT3ITD mRNA level has a high prognostic impact in NPM1 mutated, but not in NPM1 unmutated, AML with a normal karyotype

Blood ◽

10.1182/blood-2010-12-327072 ◽

2012 ◽

Vol 119 (19) ◽

pp. 4383-4386 ◽

Cited By ~ 27

Author(s):

Friederike Schneider ◽

Eva Hoster ◽

Michael Unterhalt ◽

Stephanie Schneider ◽

Annika Dufour ◽

...

Keyword(s):

Cox Regression ◽

Mrna Level ◽

Normal Karyotype ◽

Hazard Ratio ◽

Independent Effect ◽

Prognostic Impact ◽

Internal Tandem Duplication ◽

Npm1 Mutation ◽

Free Survival ◽

The Impact

Abstract The impact of a FLT3-internal tandem duplication (FLT3ITD) on prognosis of patients with acute myeloid leukemia (AML) is dependent on the ratio of mutated to wild-type allele. In 648 normal karyotype (NK) AML patients, we found a significant independent effect of the quantitative FLT3ITD mRNA level—measured as (FLT3ITD/wtFLT3)/(FLT3ITD/wtFLT3 + 1)—on outcome. Moreover, this effect was clearly seen in 329 patients with a mutated NPM1 gene (NPM1+), but not in 319 patients without a NPM1 mutation (wtNPM1). In a multivariate Cox regression model, the quantitative FLT3ITD mRNA level showed an independent prognostic impact on overall survival (OS) and relapse-free survival (RFS) only in the NPM1+ subgroup (OS: hazard ratio, 5.9; [95% confidence interval [CI]: 3.1-11.2]; RFS: hazard ratio, 7.5 [95% CI: 3.4-16.5]). The FLT3ITD mRNA level contributes to relapse risk stratification and might help to guide postremission therapy in NPM1-mutated AML.

Download Full-text

Calreticulin Mutation Status Predicts Improved Disease Outcome in Prefibrotic Primary Myelofibrosis but Not in WHO-Defined Essential Thrombocythemia

Blood ◽

10.1182/blood.v124.21.3167.3167 ◽

2014 ◽

Vol 124 (21) ◽

pp. 3167-3167

Author(s):

Heinz Gisslinger ◽

Juergen Thiele ◽

Bettina Gisslinger ◽

Tiina Berg ◽

Martin Schalling ◽

...

Keyword(s):

Overall Survival ◽

Essential Thrombocythemia ◽

Research Funding ◽

Primary Myelofibrosis ◽

Striking Difference ◽

Free Survival ◽

Significant Difference ◽

Calr Mutations ◽

The Impact ◽

Calr Mutation

Abstract The genomic landscape of myeloproliferative neoplasms (MPNs) has altered dramatically due to the recent discovery of somatic mutations of calreticulin (CALR). This discovery enables for the first time molecular information, in addition to JAK2V617F, to be used in the majority of MPN patients as an affirmative variable to discriminate MPNs from reactive myeloid proliferations. The clinical course of essential thrombocythemia (ET) or primary myelofibrosis (PMF) in patients carrying the CALR mutation was reported to be more indolent than in JAK2 positive patients and was associated with increased survival. Our aim was to investigate whether the impact of CALR expression on prognosis and clinical outcome is different in prefibrotic/early PMF (prePMF) compared to WHO-ET. In a cohort of 348 adult patients with the clinical diagnosis of either ET or PMF mutational analysis for CALR was available. Eligibility criteria for the study included: availability of mutation analysis for JAK2, MPL and CALR; availability of representative, treatment-naive bone marrow biopsy (BM); availability of a histological and clinical consensus on the diagnosis; complete long-term documentation of clinical data and outcome. Consenting clinico-pathological findings in our cohort were consistent with 115 cases showing WHO-ET and 85 patients with prePMF. In comparison to WHO-ET, prePMF revealed minor/borderline age- and gender-matched anemia, slight increase in serum LDH level and leukocyte count, minor to slight splenomegaly, and an occasional left shift in granulo- and erythropoiesis with occurrence of a few myelo-and/or erythroblasts (table 1). An accurate differentiation between both MPN entities was shown to exert a significant difference in terms of overall and relative survival and hematologic transformation into overt PMF and AL. The present study revealed a different CALR mutation frequency in ET in contrast to most of the investigations published recently. We observed CALR mutations in 18% of WHO-ET; JAK2, MPL and CALR wildtype (wt) was observed in 13% of WHO-ET. The discrepancy in the frequencies of CALR positivity in our ET cohort to most of the recently published studies may be due to our strict adherence to the WHO criteria for diagnosis of ET. Regarding prePMF, we observed CALR mutations in 39% of the patients. 92% of the JAK2 and MPL wt subgroup carried the CALR mutation, with JAK2, MPL and CALR wt being observed in only 3% of prePMF. The most remarkable differences between WHO-ET and prePMF were seen in the comparison of the overall survival (figure 1). While the CALR mutation did not have any beneficial influence on survival in WHO-ET, it was associated with a superior overall survival in prePMF. Such a striking difference was not seen at the time of transformation into overt myelofibrosis, and there was only a slightly shorter time to progression to fibrosis in CALR wt prePMFs. There was a trend showing that CALR mutated prePMF patients have shorter thrombosis-free survival compared to CALR wt prePMF patients. There was no impact of the CALR mutations on thrombosis-free survival in WHO-ET. The present data confirm that WHO-ET and prePMF are biologically different sub-entities of MPNs. In prePMF, almost 100% of patients are now associated with a known disease-causing mutation. Our data support the classical clinical approach in the diagnosis of thrombocytosis, using BM histology to differentiate WHO-ET from prePMF and to estimate the outcome of the disease more accurately. Table 1:Total cohort (N=200)WHO-ET (N=115)prePMF (N=85)PAge at diagnosis, years0,04median58,8556,460,7range19-8819-8427-88Sex0,587male784335female1227250Hb, g/dL<0,001median14,114,313,5range8,1-17,68,8-17,68,1-16,6WBC, x109/l0,054median9,258,999,6range4,01-24,544,92-22,34,01-24,54Platelets, x109/l0,739median770770794range78-2530414-249078-2530Palpable splenomegaly<0,001No.51 (12 unk, 1 splenectomy)16 (7 unk, 1 splenectomy)35 (5 unk)%25,513,941,2Fibrotic transformations<0,001No.24 (10 unk)6 (1 unk)18 (9 unk)%125,221,2Thrombotic events0,439No.39 (1 unk)22 (1 unk)17%19,51920prev thrombosis0,042No.503416%2530,418,8JAK2 V617F pos0,08No.1207545%6065,252,9CALR pos0,001No.542133%2718,338,8MPL pos0,189No.844%43,54,7JAK2/MPL/CALR wt0,0029No.18153%9133,5 Figure 1 Figure 1. Disclosures Thiele: AOP Orphan Pharmaceuticals: Consultancy, Honoraria; Incyte Corporation: Consultancy, Honoraria; Novartis: Consultancy, Honoraria, Research Funding; Shire: Consultancy, Honoraria, Research Funding; Sanofi: Consultancy, Honoraria.

Download Full-text

Impact of Variant t(9;22) and Additional Cytogenetic Aberrations at Diagnosis on Prognosis of CML

Blood ◽

10.1182/blood.v116.21.355.355 ◽

2010 ◽

Vol 116 (21) ◽

pp. 355-355

Author(s):

Armin Leitner ◽

Susanne Saussele ◽

Claudia Haferlach ◽

Brigitte Schlegelberger ◽

Gudrun Göhring ◽

...

Keyword(s):

Overall Survival ◽

Y Chromosome ◽

Median Time ◽

Research Funding ◽

Chronic Phase ◽

Molecular Response ◽

Prognostic Impact ◽

Major Molecular Response ◽

Cytogenetic Aberrations ◽

The Impact

Abstract Abstract 355 Introduction: The prognostic relevance of variant t(9;22) and additional cytogenetic aberrations (ACA) at diagnosis of chronic myeloid leukemia (CML) is conflicting. Patients and Method: We used baseline and outcome data of 1028 patients (607 male, 421 female, median age 53, range 16–88) with chronic phase CML randomized to the German CML-Study IV (imatinib [IM] 800 mg [n=264] vs IM 400 mg [n=253] vs IM 400 mg + IFN [n=281] vs IM 400 mg after IFN failure [n=108] vs IM 400 mg + AraC [n=122]) to investigate the impact of variant t(9;22) and of clonal ACA at diagnosis on time to complete cytogenetic remission (CCyR) and major molecular response (MMR), accepted markers of prognosis. Cytogenetic analysis was performed after 24- and/or 48 h culture on G-banded metaphases. If appropriate, fluorescent-in-situ-hybridization on metaphases was used in addition. Since lack of the Y chromosome is regarded as a negligible age-related, not leukemia-associated event, those patients were excluded from evaluation. Result: In total, 123/1028 patients (12%) showed additional cytogenetic findings at diagnosis: 52/1028 patients (5.1%) had variants of the t(9;22), 33/1028 patients (3.2%) lacked the Y chromosome, 38/1028 patients (3.7%) had other additional numerical or structural aberrations. 105/1028 patients (10.2%) had only one type of additional cytogenetic finding, while 18/1028 patients (1.8%) showed ≥ 2 types of additional cytogenetic findings. 905/1028 patients (88%) had no variant t(9;22) or ACA. Median age, sex and treatment were similarly distributed (Table 1). In 45/52 patients (86.5%) with variant t(9;22), one further chromosome was involved (three way translocation), whereas in 7/52 patients (13.5%) ≥ 2 chromosomes were involved (complex variant). No involvement of the chromosomes 10, 18, 20, 21, X, or Y has been found. For patients without variant t(9;22) and ACA, with variant t(9;22), with variant t(9;22) and ACA other than –Y, and with ACA other than -Y and variant t(9;22), median time (years) to CCyR was 0.98, 0.84, 1.08 and 1.34, median time (years) to MMR was 1.4, 1.55, 1.8 and 2.17, and probability (%, confidence interval) for 2 years overall survival was 0.97 (0.96-0.98), 0.96 (0.89-0.99), 0.95 (0.90-0.99) and 0.94 (0.85-0.99), respectively. There was no difference regarding time to CCyR, time to major molecular response (MMR) and 2 years overall survival between patients with variant t(9;22) or ACA compared to those without variant t(9;22) or ACA. Conclusion: We conclude that additional chromosomal abnormalities at diagnosis have no negative prognostic impact. This finding is hypothesis generating. For confirmation of this hypothesis longer observation of the course of patients with variant t(9;22) and ACA is needed. Disclosure: Haferlach: MLL Munich Leukemia Laboratory: Employment, Equity Ownership, Research Funding. German CML-Study Group:Deutsche Krebshilfe: Research Funding; Novartis: Research Funding; Roche: Research Funding; BMBF: Research Funding; Essex: Research Funding.

Download Full-text