Case Report: A 54 base pair inactivating mutation of LHCGR in a 28-year old woman with poor ovarian response
The luteinizing hormone/choriogonadotropin (LH/CG) receptor plays an important role in male and female infertility. Many studies have demonstrated that mutations at specific sites in LHCGR gene may result in mild or complete loss of receptor function. Insertions in exon-1 of LHCGR gene were first studied in male Leydig cell hypoplasia and later extended to female reproductive disorders. Previous studies have shown that these insertions play an important role in intrauterine insemination (IUI) and in vitro fertilization (IVF) outcome. Here we report a 54bp insertion in a 28-year old woman with infertility, recurrent cyst formation and failed stimulated IUI cycles. As the patient showed a blunted response to the ovarian stimulation and human chorionic gonadotropin (hCG) stimulation test, follicle stimulating hormone receptor (FSHR) and luteinizing hormone/choriogonadotropin (LHCGR) gene sequencing was performed. Gene sequence analysis revealed a 54bp homozygous insertion (GCTGCTGAAGCTGCTGCTGCTGCTGCAGCTGCTGAAGCTGCTGCTGCTGCTGCA) in the exon-1 of LHCGR gene. This mutation might have caused a decrease in receptor function in the present infertile patient, thus resulting in poor ovarian response.