scholarly journals Case Report: A 54 base pair inactivating mutation of LHCGR in a 28-year old woman with poor ovarian response

F1000Research ◽  
2015 ◽  
Vol 4 ◽  
pp. 72
Author(s):  
Ravi Krishna Cheemakurthi ◽  
Gottumukkala Achyuta Rama Raju ◽  
Thota Sivanaryana ◽  
Kalagara Madan ◽  
Kota Murali Krishna ◽  
...  
Keyword(s):  
Luteinizing Hormone ◽  
Intrauterine Insemination ◽  
Ovarian Response ◽  
Cyst Formation ◽  
Receptor Function ◽  
Poor Ovarian Response ◽  
Gene Sequence Analysis ◽  
Exon 1 ◽  
Recurrent Cyst

The luteinizing hormone/choriogonadotropin (LH/CG) receptor plays an important role in male and female infertility. Many studies have demonstrated that mutations at specific sites in LHCGR gene may result in mild or complete loss of receptor function. Insertions in exon-1 of LHCGR gene were first studied in male Leydig cell hypoplasia and later extended to female reproductive disorders. Previous studies have shown that these insertions play an important role  in  intrauterine insemination (IUI) and in vitro fertilization (IVF) outcome. Here we report a 54bp insertion in a 28-year old woman with infertility, recurrent cyst formation and failed stimulated IUI cycles. As the patient showed a blunted response to the ovarian stimulation and human chorionic gonadotropin (hCG) stimulation test,  follicle stimulating hormone receptor (FSHR) and luteinizing hormone/choriogonadotropin (LHCGR) gene sequencing was performed. Gene sequence analysis revealed a 54bp homozygous insertion (GCTGCTGAAGCTGCTGCTGCTGCTGCAGCTGCTGAAGCTGCTGCTGCTGCTGCA) in the exon-1 of LHCGR gene. This mutation might have caused a decrease in receptor function in the present infertile patient, thus resulting in poor ovarian response.

scholarly journals Stage 2 Acupuncture for Poor Ovarian Response: A Randomized Controlled Trial

2021 ◽  
Vol 10 (10) ◽  
pp. 2182
Author(s):  
Jihyun Kim ◽  
Hoyoung Lee ◽  
Tae-Young Choi ◽  
Joong Il Kim ◽  
Byoung-Kab Kang ◽  
...  
Keyword(s):  
Randomized Controlled Trial ◽  
Controlled Trial ◽  
Ovarian Response ◽  
Controlled Ovarian Hyperstimulation ◽  
University Hospital ◽  
Ovarian Hyperstimulation ◽  
Poor Ovarian Response ◽  
Vitro Fertilization ◽  
Randomized Controlled

Acupuncture is believed to improve ovarian reserve and reproductive outcomes in women undergoing in vitro fertilization (IVF). This study was conducted to evaluate the effect of network-optimized acupuncture followed by IVF on the oocyte yield in women showing a poor ovarian response. This study was an exploratory randomized controlled trial conducted from June 2017 to January 2020 at the Pusan National University Hospital. Women diagnosed with poor ovarian response were enrolled and randomly divided into two groups: IVF alone and Ac + IVF groups (16 acupuncture sessions before IVF treatment). Eight acupoints with high degree centrality and betweenness centrality were selected using network analysis. Among the participants, compared with the IVF treatment alone, the acupuncture + IVF treatment significantly increased the number of retrieved mature oocytes in women aged more than 37 years and in those undergoing more than one controlled ovarian hyperstimulation cycle. The negative correlation between the number of retrieved mature oocytes and consecutive controlled ovarian hyperstimulation cycles was not observed in the Ac + IVF group irrespective of the maternal age. These findings suggest that physicians can consider acupuncture for the treatment of women with poor ovarian response and aged > 37 years or undergoing multiple IVF cycles.

scholarly journals Cumulative live birth rate after up to three consecutive embryo transfer cycles in women with poor ovarian response

2020 ◽  
Vol 47 (2) ◽  
pp. 135-139
Author(s):  
Se Jeong Kim ◽  
Dayong Lee ◽  
Seul Ki Kim ◽  
Byung Chul Jee ◽  
Seok Hyun Kim
Keyword(s):  
Embryo Transfer ◽  
Live Birth ◽  
Birth Rate ◽  
Live Birth Rate ◽  
Ovarian Response ◽  
Rank Test ◽  
Poor Ovarian Response ◽  
Cumulative Live Birth Rate ◽  
Cumulative Live Birth

Objective: In the present study, we aimed to retrospectively evaluate the cumulative live birth rate (LBR) after up to three consecutive embryo transfer (ET) cycles, either fresh or frozen, in women with expected poor ovarian response (ePOR). Methods: We selected 115 women who entered the first <i>in vitro</i> fertilization (IVF) cycle between August 2013 and July 2016. The women were divided into an ePOR group (37 women) and a non-ePOR group (78 women). All women in the ePOR group were ≥40 years old or had serum anti-Müllerian hormone levels of less than 1.1 ng/mL at the time of the first IVF cycle. Live birth outcomes were monitored until December 2017. The cumulative LBR (with both conservative and optimistic estimates) was calculated according to the serial number of ET cycles. Results: After up to three ET cycles, the overall cumulative LBR was significantly lower in the ePOR group than in the non-ePOR group (conservative estimate, 10.8% vs. 44.9%, respectively; optimistic estimate, 14.7% vs. 56.1%, respectively; log-rank test, <i>p</i>=0.003). Conclusion: Women with ePOR exhibited a lower cumulative LBR than women in the non-ePOR group, and this information should be provided to ePOR women during counseling before starting IVF.

scholarly journals Dehydroepiandrosterone supplementation in women undergoing assisted reproductive technology with poor ovarian response. A prospective case-control study

2017 ◽  
Vol 46 (1) ◽  
pp. 143-149 ◽  
Author(s):  
Haifa A. Al-Turki
Keyword(s):  
Pregnancy Rate ◽  
Live Birth ◽  
Case Control Study ◽  
Ovarian Response ◽  
Case Control ◽  
Poor Ovarian Response ◽  
Control Study ◽  
Prospective Case Control Study

Objective The effects of dehydroepiandrosterone (DHEA) supplementation in Saudi Arabian women with poor ovarian response (POR) is presently unknown. The present study aimed to assess the benefits of DHEA supplementation in women undergoing in vitro fertilization (IVF) or intracytoplasmic sperm injection (ICSI). Methods This was a prospective case-control study involving 62 women who were diagnosed with POR and underwent IVF/ICSI between January 2012 and June 2016. The positive influence of DHEA in 34 women, compared with 28 women without supplementation, was defined as improvements in the number of oocytes retrieved, the fertilization rate, the number of grade I embryos generated and the pregnancy rate. Results Both groups were evenly matched for age, body mass index and laboratory test parameters. There were statistically significant differences between the groups with and without DHEA supplementation for oocyte yield (6.35 ± 2.41 versus 3.98 ± 3.2), Grade I embryos generated (55% versus 30%), positive pregnancy rate (21/34 versus 10/28), and live birth rate (18/34 versus 4/28). Conclusion DHEA supplementation in women with POR had a positive effect on hormonal profiles, the quality of the endometrium, the number of oocytes retrieved, the quality of embryos, and the pregnancy and live birth rates.

scholarly journals Poor ovarian response in women undergoing in vitro fertilization is associated with altered microRNA expression in cumulus cells

2015 ◽  
Vol 103 (6) ◽  
pp. 1469-1476.e3 ◽  
Author(s):  
Cengiz Karakaya ◽  
Ozlem Guzeloglu-Kayisli ◽  
Asli Uyar ◽  
Amanda N. Kallen ◽  
Elnur Babayev ◽  
...  
Keyword(s):  
In Vitro Fertilization ◽  
Ovarian Response ◽  
Cumulus Cells ◽  
Microrna Expression ◽  
Poor Ovarian Response ◽  
Vitro Fertilization
Sign in / Sign up

Export Citation Format

Share Document