scholarly journals Plant Density and Irrigation Regime Have an Interactive Effect on Common Bean Seed Quality

2018 ◽  
Vol 2 (4) ◽  
Author(s):  
Albert Thembinkosi Modi
Keyword(s):  
Common Bean ◽  
Seed Quality ◽  
Plant Density ◽  
Interactive Effect ◽  
Irrigation Regime ◽  
Bean Seed

scholarly journals Molecular detection of Colletotrichum lindemuthianum in bean seed samples

2018 ◽  
Vol 40 (4) ◽  
pp. 370-377 ◽  
Author(s):  
Stélio Jorge Castro Gadaga ◽  
Carolina da Silva Siqueira ◽  
José da Cruz Machado
Keyword(s):  
Common Bean ◽  
Molecular Detection ◽  
Seed Quality ◽  
Colletotrichum Lindemuthianum ◽  
The Other ◽  
Inoculum Potential ◽  
Bean Seed ◽  
Detection Techniques ◽  
Pcr Techniques ◽  
Detection And Quantification

Abstract: Colletotrichum lindemuthianum is the causal agent of anthracnose in common bean, and infected seeds are the most typical propagation form of the disease. Thus, using common bean seeds free of C. lindemuthianum is crucial to managing this pest, as well as employing fast and accurate detection techniques to ensure high seed quality. In this study, both conventional and quantitative PCR techniques (cPCR and qPCR) were used for the detection and quantification of C. lindemuthianum in samples of common bean seeds. For that, seeds were inoculated by exposing them to fungal colonies for different periods of time, 0 h, 36 h, 72 h, 108 h and 144 h, each period corresponding to an inoculum potential. Then, they were mixed with healthy seeds, so incidences of 0.25%, 0.50%, 1%, 10%, and 100% of seeds with different inoculum potentials were obtained, in samples of 400 seeds. Both cPRC and qPCR techniques were effective in detecting the fungus. With the cPCR method, the highest sensitivity was recorded in those samples with 10% inoculated seeds with inoculum potential P36. On the other hand, with the qPCR technique, the highest sensitivity in detecting the fungus was observed in samples with 0.25% inoculated seeds with inoculum potential P36.

scholarly journals Common bean seed quality as affected by cover crop mixtures and nitrogen fertilization

2019 ◽  
Vol 13 (02) ◽  
pp. 300-308 ◽  
Author(s):  
Alexandre Pedrinho ◽  
◽  
Eduardo Mariano ◽  
Luis Fernando Merloti ◽  
Marco Eustáquio de Sá ◽  
...  
Keyword(s):  
Common Bean ◽  
Nitrogen Fertilization ◽  
Cover Crop ◽  
Seed Quality ◽  
Bean Seed

Relationship between Laboratory Seed Quality Tests and Field Emergence of Common Bean Seed

Crop Science ◽  
2000 ◽  
Vol 40 (2) ◽  
pp. 470-475 ◽  
Author(s):  
Krystyna Kolasinska ◽  
Jerzy Szyrmer ◽  
Stefania Dul
Keyword(s):  
Common Bean ◽  
Seed Quality ◽  
Bean Seed ◽  
Field Emergence

scholarly journals PLANT DENSITY AND NITROGEN FERTILIZATION ON COMMON BEAN NUTRITION AND YIELD

2017 ◽  
Vol 30 (3) ◽  
pp. 670-678 ◽  
Author(s):  
ROGÉRIO PERES SORATTO ◽  
TIAGO ARANDA CATUCHI ◽  
EMERSON DE FREITAS CORDOVA DE SOUZA ◽  
JADER LUIS NANTES GARCIA
Keyword(s):  
Grain Yield ◽  
Common Bean ◽  
Nitrogen Fertilization ◽  
Dry Matter ◽  
Plant Density ◽  
N Fertilization ◽  
N Concentration ◽  
Plant Densities ◽  
N Rates ◽  
Lower Plant

ABSTRACT The objective of this work was to evaluate the effect of plant densities and sidedressed nitrogen (N) rates on nutrition and productive performance of the common bean cultivars IPR 139 and Pérola. For each cultivar, a randomized complete block experimental design was used in a split-plot arrangement, with three replicates. Plots consisted of three plant densities (5, 7, and 9 plants ha-1) and subplots of five N rates (0, 30, 60, 120, and 180 kg ha-1). Aboveground dry matter, leaf macro- and micronutrient concentrations, yield components, grain yield, and protein concentration in grains were evaluated. Lower plant densities (5 and 7 plants m-1) increased aboveground dry matter production and the number of pods per plant and did not reduce grain yield. In the absence of N fertilization, reduction of plant density decreased N concentration in common bean leaves. Nitrogen fertilization linearly increased dry matter and leaf N concentration, mainly at lower plant densities. Regardless of plant density, the N supply linearly increased grain yield of cultivars IPR 139 and Pérola by 17.3 and 52.2%, respectively.

scholarly journals PENGARUH JARAK TANAM DAN DOSIS PUPUK TERHADAP PRODUKSI DAN VIABILITAS BENIH SETEK NILAM (Pogostemon cablin Benth)

2020 ◽  
Vol 18 (2) ◽  
pp. 81
Author(s):  
SUKARMAN SUKARMAN
Keyword(s):  
Plant Growth ◽  
Key Words ◽  
Seed Quality ◽  
Plant Density ◽  
Plant Spacing ◽  
Experimental Station ◽  
Pogostemon Cablin ◽  
C Value ◽  
Plot Design

<p>ABSTRAK<br />Sampai saat ini informasi pengaruh jarak tanam dan dosis pupuk<br />terhadap produktivitas, dan viabilitas benih nilam (Pogostemon cablin<br />Benth) masih terbatas. Untuk itu penelitian ini dilakukan dengan tujuan<br />mendapatkan jarak tanam dan dosis pupuk yang optimum untuk produksi<br />benih/setek nilam. Penelitian dilakukan di Kebun Percobaan (KP)<br />Sukamulya, Balai Penelitian Tanaman Rempah dan Industri Lain (Balittri),<br />Pakuwon, Parungkuda, Sukabumi, dari Januari sampai November 2010.<br />Percobaan faktorial, dengan tiga faktor dan tiga ulangan, disusun dalam<br />rancangan petak terbagi dua kali (RPPT). Petak utama adalah dua varietas<br />nilam yaitu Sidikalang dan Lhokseumawe. Anak petak adalah tiga jarak<br />tanam yaitu (1) 1 x 0,5 m; (2) 1 x 0,7 m; dan (3) 1 x 1 m. Anak-anak petak<br />adalah dua dosis pemupukan yaitu : 1) 30 ton pupuk kandang, 300 kg urea,<br />150 kg SP-36, dan 300 kg KCl/th, dan 2) 45 ton pupuk kandang, 450 kg<br />urea, 225 kg SP-36, dan 450 kg KCl/th. Ukuran plot 8,4 x 5 m. Parameter<br />yang diamati adalah pertumbuhan tanaman (tinggi tanaman, jumlah<br />cabang primer, sekunder, dan tersier), produksi benih pertanaman,<br />diameter bagian pangkal, tengah, dan pucuk dari cabang primer dan<br />sekunder, kadar karbohidrat dan serat, dan viabilitas benih setek.<br />Pengamatan dilakukan pada umur enam bulan setelah tanam (6 BST).<br />Hasil penelitian menunjukkan bahwa : (1) varietas Sidikalang dengan<br />dosis pemupukan 45 ton pupuk kandang, 450 kg urea, 225 kg SP-36, dan<br />450 kg KCl/th, menghasilkan jumlah cabang primer paling tinggi yaitu<br />14,29; (2) jarak tanam 1 x 0,5 m menghasilkan benih setek tertinggi<br />(73.555 stek/1.000 m 2 ). Rata-rata diameter benih berasal dari pangkal ≥ 5<br />mm, sedangkan rata-rata diameter benih berasal dari pucuk ≥ 4 mm; (3)<br />Viabilitas benih pada 0 dan 4 hari setelah penyimpanan ≥ 80%. Jarak<br />tanam 1 x 0,5 m dengan dosis pupuk kandang sebanyak 30 ton, 300 kg<br />urea, 150 kg SP-36, dan 300 kg KCl pertahun merupakan dosis yang<br />optimal untuk produksi benih/setek nilam. Kombinasi perlakuan<br />pemupukan 30 ton pupuk kandang, 300 kg urea, 150 kg SP-36, 300 kg<br />KCl/th dengan jarak tanam 1 x 0,5 m menghasilkan keuntungan tertinggi<br />yaitu: Rp 6.668.500 dengan nilai B/C 2,05.<br />Kata kunci : Pogostemon cablin Benth, jarak tanam, pemupukan,<br />produksi, kualitas benih/setek</p><p>ABSTRACT<br />Effect of Spacing and Fertilizer Dosages on Production<br />and Viability of Patchouli Cutting Seeds<br />Information on the effect of plant density and fertilizer dosage on<br />the production and viability of patchouli seeds is still limited. This<br />experiment was aimed at finding out optimum plant spacing and fertilizer<br />dosage for improving production and quality of patchouli cutting seeds.<br />The experiment was conducted at Sukamulya experimental station of<br />Indonesian Spice and Industrial Crops Research Institute (ISICRI),<br />Pakuwon, Sukabumi from January through November 2010. This<br />experiment was consisted of three factors and three replicates and was<br />arranged in a split-split-plot design. The main plots were two varieties of<br />patchouli, i.e. V1 = Sidikalang and V2 = Lhokseumawe. The sub plots<br />were three plant spacing dimentions, i.e. S1 (1 x 0.5 m), S2 (1 x 0.7 m),<br />and S3 (1 x 1 m). The sub-sub plots were two levels of fertilizer dosage,<br />i.e. F1 (manure; urea, SP-36, and KCl of 30 t; 450, 225, and 450 kg/ha,<br />respectively) and F2 (manure; urea, SP-36, and KCl of 45 t; 300, 150, and<br />450 kg/year, respectively). Variables observed were plant growth (plant<br />height; number of primary, secondary, and tertiary branches), seed<br />productivity and viability, diameter of bottom, medium, and upper of<br />cutting seeds. The results of experiment indicated that Sidikalang variety,<br />treated with 45 tons of manure, 450 kg urea, 225 kg SP-36, and 450 kg<br />KCl per hectare produced the highest number of primary branches<br />compared to other treatments. Plant spacing of 1 x 0.5 m produced the<br />highest number of cutting seeds (73,555 stumps/1,000m 2 ). The averaged<br />diameters of cutting seeds from basal were ≥ 5 mm while those from top<br />were ≥ 4 mm. Viability of the cutting seeds at 0 and 4 days after storage<br />was ≥ 80%. Plant spacing 1 x 0.5 m with dosage of fertilizer 30 ton dung<br />manure, 300 kg urea, 150 kg SP-36, and 300 kg KCl per year is the dosage<br />optimum for producing seed/cutting of patchouli. Combination of fertilizer<br />dosages of 30 tons manure, 300 kg urea, 150 kg SP-36, and 300 kg KCl<br />per year and plant spacing of 1 x 0.5 m produced the highest profit as<br />much as Rp 6,668,500 with B/C value of 2.05.<br />Key words: Pogostemon cablin Benth, plant spacing, fertilizer,<br />production, cutting seed quality</p>

scholarly journals First Report of Tobacco ringspot virus Infecting Kudzu (Pueraria montana) in Louisiana

Plant Disease ◽  
2013 ◽  
Vol 97 (4) ◽  
pp. 561-561 ◽  
Author(s):  
S. Khankhum ◽  
P. Bollich ◽  
R. A. Valverde
Keyword(s):  
Common Bean ◽  
Mosaic Virus ◽  
Seed Quality ◽  
Soybean Mosaic Virus ◽  
Ringspot Virus ◽  
Wild Plants ◽  
Rt Pcr ◽  
Sequence Comparisons ◽  
First Report ◽  
Tobacco Ringspot Virus

Kudzu is an introduced legume commonly found growing as a perennial throughout the southeastern United States. This fast-growing vine was originally planted as an ornamental for forage and to prevent erosion (2), but is now considered an invasive species. During April 2011, a kudzu plant growing near a soybean field in Amite (Tangipahoa Parish, southeastern LA) was observed with foliar ringspot and mottle symptoms. Leaf samples were collected, and sap extracts (diluted 1:5 w/v in 0.02 M phosphate buffer pH 7.2) were mechanically inoculated onto carborundum-dusted leaves of at least five plants of the following species: kudzu, common bean (Phaseolus vulgaris) cv. Black Turtle Soup, globe amaranth (Gomphrena globosa), Nicotiana benthamiana, and soybean (Glycine max) cv. Asgrow AG 4801. Two plants of each species were also mock-inoculated. Eight to fourteen days after inoculation, all virus-inoculated plants showed virus symptoms that included foliar ringspots, mosaic, and mottle. Common bean and soybean also displayed necroses and were stunted. ELISA using antisera for Bean pod mottle virus, Cucumber mosaic virus, Soybean mosaic virus, and Tobacco ringspot virus (TRSV) (Agdia Inc., Elkhart, IN) were performed on field-collected kudzu and all inoculated plants species. ELISA tests resulted positive for TRSV but were negative for the other three viruses. All virus-inoculated plant species tested positive by ELISA. To confirm that TRSV was present in the samples, total RNA was extracted from infected and healthy plants and used in RT-PCR tests. The set of primers TRS-F (5′TATCCCTATGTGCTTGAGAG3′) and TRS-R (5′CATAGACCACCAGAGTCACA3′), which amplifies a 766-bp fragment of the RdRp of TRSV, were used (3). Expected amplicons were obtained with all of the TRSV-infected plants and were cloned and sequenced. Sequence analysis confirmed that TRSV was present in kudzu. Nucleotide sequence comparisons using BLAST resulted in a 95% similarity with the bud blight strain of TRSV which infects soybeans (GenBank Accession No. U50869) (1). TRSV has been reported to infect many wild plants and crops, including soybean. In soybean, this virus can reduce yield and seed quality (4). During summer 2012, three additional kudzu plants located near soybean fields showing ringspot symptoms were also found in Morehouse, Saint Landry, and West Feliciana Parishes. These three parishes correspond to the north, central, and southeast regions, respectively. These plants also tested positive for TRSV by ELISA and RT-PCR. The results of this investigation documents that TRSV was found naturally infecting kudzu near soybean fields in different geographical locations within Louisiana. Furthermore, a TRSV strain closely related to the bud blight strain that infects soybean was identified in one location (Amite). This finding is significant because infected kudzu potentially could serve as the source of TRSV for soybean and other economically important crops. To the best of our knowledge, this is the first report of TRSV infecting kudzu. References: (1) G. L. Hartman et al. 1999. Compendium of Soybean Diseases. American Phytopathological Society, St. Paul, MN. (2) J. H. Miller and B. Edwards. S. J. Appl. Forestry 7:165, 1983. (3) S. Sabanadzovic et al. Plant Dis. 94:126, 2010. (4) P. A. Zalloua et al. Virology 219:1, 1996.

scholarly journals Effect of plant density and seed position on mother plant on physiological characteristic of cocklebur (Xanthium strumarium) seeds

2014 ◽  
Vol 32 (1) ◽  
pp. 61-68
Author(s):  
A. Foroughi ◽  
J. Gherekhloo ◽  
F. Ghaderi-Far
Keyword(s):  
Seed Quality ◽  
Plant Density ◽  
Physiological Characteristic ◽  
Mother Plant ◽  
Xanthium Strumarium ◽  
Randomized Design ◽  
Seed Position ◽  
Plant Densities ◽  
Shade Environment ◽  
Cardinal Temperatures

Experiments were conducted in 2010 to determine the influence of plant density and seed position on the mother plant on seed physiological characteristics of cocklebur (Xanthium strumarium). Cocklebur burs were collected in fall of 2010 from Research Farm of University of Agricultural Sciences and Natural Resources of Gorgan, Iran. The experiment was established as factorial arrangement using a completely randomized design with three replications. The factors included different densities of cocklebur (0, 2, 4, 6 and 8 plant m-2) and the top and bottom parts of the canopy. Non dormant seeds were used for determining cardinal temperatures and tolerance to salinity and drought stresses. Base, optimum and ceiling germination temperatures were estimated between 7.09 to 12.33, 32 to 35 and 44 to 45 respectively in different treatments. Salinity stress up to 300 Mm and osmotic potential 8 bar inhibited the germination completely. Comparison of base temperatures and sigmoid equation coefficients showed that seeds produced in the top had higher germination than those that produced at the bottom of the mother plant. It seems plant densities through seed position on the mother plant affect seed quality. Likewise changes of light quality and quantity in shade environment increased seed dormancy in matured seeds. Shade environment affect seed germination on mother plant that increased dormancy of seeds maturing under shade be an adaptive response that reduces the probability of germination of offspring under unfavorable (shade, competitive) conditions.

Sign in / Sign up

Export Citation Format

Share Document