scholarly journals Determination of Exosome Mitochondrial DNA as a Biomarker of Renal Cancer Aggressiveness

2021 ◽  
Author(s):  
Elena Arance ◽  
Viviana Ramírez ◽  
Alejandro Rubio-Roldan ◽  
Francisco M. Ocaña-Peinado ◽  
Catalina Romero-Cachinero ◽  
...  
Keyword(s):  
Mitochondrial Dna ◽  
Hypervariable Region ◽  
Digital Pcr ◽  
Complex Iii ◽  
Mtdna Copy Number ◽  
Non Invasive ◽  
Apocytochrome B ◽  
Cancer Aggressiveness ◽  
Next Generation Sequencing Ngs ◽  
First Time

Abstract Background: Components of liquid biopsy are promising non-invasive biomarkers for monitoring the renal cell carcinoma (RCC) status. Present study tries to evaluate the role of exosomes and mitochondrial DNA (mtDNA) as promise, novel and stable biomarkers that could improve current ones in RCC. Methods: A total of 140 fractions obtained by ultracentrifugations of whole blood samples stored in EDTA anticoagulant from 28 (13 patients and 15 controls) were included in present study. An exosome collection protocol and exhaustive analysis of all phases obtained by ultracentrifugations (named from B to F) was performed. Subsequently, an analysis of dPCR (digital PCR) using the QuantStudio™ 3D Digital PCR platform and the quantification of mtDNA copy number using by QuantStudioTM 12K Flex Real-Time PCR System (qPCR) was developed. Moreover, Next Generation Sequencing (NGS) analyses were included using MiSeq system (Illumina, CA, USA). Results: F fraction, which contains all exosomes´ data and all mitochondrial markers (hypervariable region 1 (HV1) and apocytochrome b of complex III (MT-CYB)) were statistically identified in dPCR and qPCR (p values < 0.05) when a comparison between cases and controls was performed. Moreover, the studied mitochondrial genes shown a relevant significance in RCC aggressiveness analyses (metastasis and stages 4).Conclusions: To sum up, this is the first time a relation between mtDNA genetic markers in exosome and clinical management of RCC is suggested.

scholarly journals Determination of Exosome Mitochondrial DNA as a Biomarker of Renal Cancer Aggressiveness

Cancers ◽  
2021 ◽  
Vol 14 (1) ◽  
pp. 199
Author(s):  
Elena Arance ◽  
Viviana Ramírez ◽  
Alejandro Rubio-Roldan ◽  
Francisco M. Ocaña-Peinado ◽  
Catalina Romero-Cachinero ◽  
...  
Keyword(s):  
Mitochondrial Dna ◽  
Liquid Biopsy ◽  
Digital Pcr ◽  
Mtdna Copy Number ◽  
Non Invasive ◽  
Cancer Aggressiveness ◽  
Next Generation Sequencing Ngs ◽  
First Time

Here, the role of non-invasive biomarkers in liquid biopsy was evaluated, mainly in exosomes and mitochondrial DNA (mtDNA) as promising, novel, and stable biomarkers for renal cell carcinoma (RCC). A total of 140 fractions (named from B to F) obtained by ultracentrifugations of whole blood samples from 28 individuals (13 patients and 15 controls) were included. Nanoparticle Tracking Analysis (NTA) was conducted to characterized exosomal fraction. Subsequently, an analysis of digital PCR (dPCR) using the QuantStudio™ 3D Digital PCR platform was performed and the quantification of mtDNA copy number by QuantStudioTM 12K Flex Real-Time PCR System (qPCR) was developed. Moreover, Next Generation Sequencing (NGS) analyses were included using MiSeq system (Illumina, San Diego, CA, USA). An F fraction, which contains all exosome data and all mitochondrial markers, was identified in dPCR and qPCR with statistically significant power (adjusted p values ≤ 0.03) when comparing cases and controls. Moreover, present analysis in mtDNA showed a relevant significance in RCC aggressiveness. To sum up, this is the first time a relation between exosomal mtDNA markers and clinical management of RCC is analyzed. We suggest a promising strategy for future liquid biopsy RCC analysis, although more analysis should be performed prior to application in routine clinical practice.

scholarly journals Quantitative mitochondrial DNA copy number determination using droplet digital PCR with single cell resolution: a focus on aging and cancer

2019 ◽  
Author(s):  
Ryan O’Hara ◽  
Enzo Tedone ◽  
Andrew Ludlow ◽  
Ejun Huang ◽  
Beatrice Arosio ◽  
...  
Keyword(s):  
Mitochondrial Dna ◽  
T Cell Activation ◽  
Copy Number ◽  
Metabolic Regulation ◽  
Single Cells ◽  
Digital Pcr ◽  
Droplet Digital Pcr ◽  
Mtdna Copy Number ◽  
Mitochondrial Dna Copy Number ◽  
Human T Cell

ABSTRACTMitochondria are involved in a number of diverse cellular functions, including energy production, metabolic regulation, apoptosis, calcium homeostasis, cell proliferation and motility as well as free radical generation. Mitochondrial DNA (mtDNA) is present at hundreds to thousands of copies per cell in a tissue-specific manner. Importantly, mtDNA copy number also varies during aging and disease progression and therefore might be considered as a biomarker that mirrors alterations within the human body. Here we present a new quantitative, highly sensitive droplet digital PCR (ddPCR) method (ddMDM; droplet digital mitochondrial DNA measurement) to measure mtDNA copy number not only from cell populations but also from single cells. Our developed assay can generate data in as little as 3 hours, is optimized for 96-well plates and also allows the direct use of cell lysates without the need for DNA purification or nuclear reference genes. Importantly, we show that ddMDM is able to detect differences between samples whose mtDNA copy number was close enough as to be indistinguishable by other commonly used mtDNA quantitation methods. By utilizing ddMDM, we show quantitative changes in mtDNA content per cell across a wide variety of physiological contexts including cancer progression, cell cycle progression, human T cell activation, and human aging.

31 Effect of vitrification of porcine oocytes on production of ATP and mitochondrial DNA copy number

2021 ◽  
Vol 33 (2) ◽  
pp. 123
Author(s):  
E. J. Gutierrez ◽  
F. B. Diaz ◽  
K. R. Bondioli
Keyword(s):  
Mitochondrial Dna ◽  
Copy Number ◽  
Pure Water ◽  
Digital Pcr ◽  
Control Group ◽  
Atp Content ◽  
Mtdna Copy Number ◽  
Atp Production ◽  
Mitochondrial Dna Copy Number ◽  
Mitochondrial Number

This experiment evaluated the effects of vitrification at different time points of invitro maturation (IVM) on ATP production and mitochondrial DNA (mtDNA) copy number of porcine oocytes. Treatments included vitrification at 24h of IVM (V24), vitrification at 44h of IVM (V44), and a control group consisting of fresh oocytes after 48h of IVM. Porcine cumulus–oocyte complexes (COCs) were obtained from a commercial vendor and underwent the first 24h of IVM during shipment in a portable incubator. Upon arrival, COCs were randomly allocated into treatments. The oocytes in the V44 and control groups were incubated at 38.8°C and 5.5% CO2 to continue IVM. Before vitrification, COCs were denuded in hyaluronidase by vortexing, followed by 3 washes in holding medium (Hanks’ balanced salt solution–HEPES + 4% BSA). Denuded oocytes were vitrified using a 3-step, dimethyl sulfoxide (DMSO)- and ethylene glycol-based protocol (VitriCool kit, IVF Bioscience), Cryolocks as carriers, and liquid nitrogen as cryogenic agent. All steps were carried out at room temperature. Warming was achieved using the VitriWarm kit (IVF Bioscience) consisting of 4 dilution steps. After warming, the oocytes were washed in holding medium and incubated in IVM medium to complete 48h of maturation (24h for V24 and 4h for V44). All warming steps were performed at 38.5°C. Oocytes destined for ATP production assessment (Control n=26, V44 n=27, V24 n=28) were frozen in 50µL of ultra-pure water, whereas oocytes destined for mtDNA copy number quantification (Control n=32, V44 n=30, V24 n=32) were snap-frozen in ∼1µL of holding medium. Samples were kept at −80°C until further processing. The ATP content of single oocytes was determined using an ATP bioluminescent somatic cell kit (FLASC, Sigma-Aldrich). The assessment of mtDNA copy number in single oocytes was performed by amplifying the porcine Mt-ND4 gene (F atccaagcactatccatcacca, R ccgatgattacgtgcaaccc; NC_000845.1) and quantification was carried out using a Droplet Digital PCR system (Bio-Rad Laboratories). Results for ATP production and mtDNA copy number were analysed through ANOVA with Tukey’s adjustment (SAS 9.4; Sas Institute Inc.). No differences were found in mtDNA copy number among groups (Control 178 004.69±19 207.23, V44 170 483.67±18 127.18, V24 176 767.50±27 211.09; P=0.36). In contrast, all groups differed in ATP content (pg/µL) among each other (Control 26.36±4.99, V44 20.26±6.61, V24 16.54±8.07; P&lt;0.0001). These data indicate that although there was no effect on mitochondrial number, ATP production/storage ability is significantly reduced as a result of vitrification-warming. Vitrification at 44h of IVM followed by a 4-h post-warming incubation showed the highest ATP content among the vitrification treatments.

scholarly journals Raman spectroscopic detection of interleukin-10 and angiotensin converting enzyme

2021 ◽  
Vol 17 (1) ◽  
Author(s):  
Shuo Zhang ◽  
Frederieke A. M. van der Mee ◽  
Roel J. Erckens ◽  
Carroll A. B. Webers ◽  
Tos T. J. M. Berendschot
Keyword(s):  
Angiotensin Converting Enzyme ◽  
Biomedical Applications ◽  
Interleukin 10 ◽  
Spectral Features ◽  
Converting Enzyme ◽  
Raman Spectroscopic ◽  
Non Invasive ◽  
Confocal Raman ◽  
First Time ◽  
Enzyme Characteristic

AbstractIn this report we present a confocal Raman system to identify the unique spectral features of two proteins, Interleukin-10 and Angiotensin Converting Enzyme. Characteristic Raman spectra were successfully acquired and identified for the first time to our knowledge, showing the potential of Raman spectroscopy as a non-invasive investigation tool for biomedical applications.

scholarly journals Biofluid quantification of TWEAK/Fn14 axis in combination with a selected biomarker panel improves assessment of prostate cancer aggressiveness

2019 ◽  
Vol 17 (1) ◽  
Author(s):  
Xavier Ruiz-Plazas ◽  
Esther Rodríguez-Gallego ◽  
Marta Alves ◽  
Antonio Altuna-Coy ◽  
Javier Lozano-Bartolomé ◽  
...  
Keyword(s):  
Prostate Cancer ◽  
Clinical Biochemistry ◽  
Specific Antigen ◽  
Total Serum ◽  
Mrna Levels ◽  
Biomarker Panel ◽  
Non Invasive ◽  
Clinical Biomarkers ◽  
Cancer Aggressiveness ◽  
Aggressive Tumors

Abstract Background Conventional clinical biomarkers cannot accurately differentiate indolent from aggressive prostate cancer (PCa). We investigated the usefulness of a biomarker panel measured exclusively in biofluids for assessment of PCa aggressiveness. Methods We collected biofluid samples (plasma/serum/semen/post-prostatic massage urine) from 98 patients that had undergone radical prostatectomy. Clinical biochemistry was performed and several cytokines/chemokines including soluble(s) TWEAK, sFn14, sCD163, sCXCL5 and sCCL7 were quantified by ELISA in selected biofluids. Also, the expression of KLK2, KLK3, Fn14, CD163, CXCR2 and CCR3 was quantified by real-time PCR in semen cell sediment. Univariate, logistic regression, and receiver operating characteristic (ROC) analyses were used to assess the predictive ability of the selected biomarker panel in conjunction with clinical and metabolic variables for the evaluation of PCa aggressiveness. Results Total serum levels of prostate-specific antigen (PSA), semen levels of sTWEAK, fasting glycemia and mRNA levels of Fn14, KLK2, CXCR2 and CCR3 in semen cell sediment constituted a panel of markers that was significantly different between patients with less aggressive tumors [International Society of Urological Pathology (ISUP) grade I and II] and those with more aggressive tumors (ISUP grade III, IV and V). ROC curve analysis showed that this panel could be used to correctly classify tumor aggressiveness in 90.9% of patients. Area under the curve (AUC) analysis revealed that this combination was more accurate [AUC = 0.913 95% confidence interval (CI) 0.782–1] than a classical non-invasive selected clinical panel comprising age, tumor clinical stage (T-classification) and total serum PSA (AUC = 0.721 95% CI 0.613–0.830). Conclusions TWEAK/Fn14 axis in combination with a selected non-invasive biomarker panel, including conventional clinical biochemistry, can improve the predictive power of serum PSA levels and could be used to classify PCa aggressiveness.

Mitochondrial and nuclear DNA variation, genotype fingerprinting and genetic relationships in lentil (Lens culinaris Medik.)

1997 ◽  
Vol 77 (4) ◽  
pp. 515-521 ◽  
Author(s):  
Om P. Rajora ◽  
John D. Mahon
Keyword(s):  
Mitochondrial Dna ◽  
Restriction Fragment ◽  
Lens Culinaris ◽  
Nuclear Dna ◽  
Genetic Relationships ◽  
Restriction Enzymes ◽  
Dna Variation ◽  
Apocytochrome B ◽  
Nuclear Dna Variation ◽  
Mean Similarity

Mitochondrial DNA (mtDNA) and nuclear DNA (nuDNA) variations were examined in six cultivars of Lens culinaris ssp. culinaris and two (mtDNA) or one (nuDNA) accession(s) of L. culinaris ssp. orientalis. Total leaf DNA was digested with up to 15 restriction endonucleases, separated by agarose gel electrophoresis and trasferred to nylon membranes. To examine mtDNA variation, blots were probed with mtDNA coding for cytochrome c oxidase I (coxI) and ATPase 6 (atp6) of both wheat and maize as well as apocytochrome b (cob) and Orf25 (orf25) of wheat. Sixteen combinations of mtDNA probes and restriction enzymes revealed 34 fragments that discriminated between at least two lentil accessions. For nuDNA analysis, probes from cDNA and genomic DNA clones of lentil were used to probe the same blots, and identified 46 diagnostic fragments from 19 probe/enzyme combinations. Each lentil accession could be unequivocably distinguished from all others on the basis of both mitochondrial and nuclear DNA fragment patterns. The mitochondrial restriction fragment similarities ranged from 0.944 to 0.989, with a mean of 0.970 but nuclear restriction fragment similarities varied from 0.582 to 0.987, with a mean of 0.743. The apparent genetic relationships among accessions differed according to the source of DNA examined, although the commercial varieties Laird, Brewer and Redchief showed similarly high levels of mean similarity with both nuclear (0.982) and mitochondrial DNA (0.983). Key words: Lens culinaris Medik., genetic variation, mitochondrial, nuclear, DNA, lentil

Limitations of Allotopic Expression of Mitochondrial Genes in Mammalian Cells

Genetics ◽  
2003 ◽  
Vol 165 (2) ◽  
pp. 707-720
Author(s):  
Jose Oca-Cossio ◽  
Lesley Kenyon ◽  
Huiling Hao ◽  
Carlos T Moraes
Keyword(s):  
Mitochondrial Dna ◽  
Mammalian Cells ◽  
Mitochondrial Genes ◽  
Terminal Segment ◽  
Universal Genetic Code ◽  
Apocytochrome B ◽  
Dna Mutations ◽  
C Terminus ◽  
Cytoplasmic Compartment ◽  
Allotopic Expression

Abstract The possibility of expressing mitochondrial DNA-coded genes in the nuclear-cytoplasmic compartment provides an attractive system for genetic treatment of mitochondrial disorders associated with mitochondrial DNA mutations. In theory, by recoding mitochondrial genes to adapt them to the universal genetic code and by adding a DNA sequence coding for a mitochondrial-targeting sequence, one could achieve correct localization of the gene product. Such transfer has occurred in nature, and certain species of algae and plants express a number of polypeptides that are commonly coded by mtDNA in the nuclear-cytoplasmic compartment. In the present study, allotopic expression of three different mtDNA-coded polypeptides (ATPase8, apocytochrome b, and ND4) into COS-7 and HeLa cells was analyzed. Among these, only ATPase8 was correctly expressed and localized to mitochondria. The full-length, as well as truncated forms, of apocytochrome b and ND4 decorated the periphery of mitochondria, but also aggregated in fiber-like structures containing tubulin and in some cases also vimentin. The addition of a hydrophilic tail (EGFP) to the C terminus of these polypeptides did not change their localization. Overexpression of molecular chaperones also did not have a significant effect in preventing aggregations. Allotopic expression of apocytochrome b and ND4 induced a loss of mitochondrial membrane potential in transfected cells, which can lead to cell death. Our observations suggest that only a subset of mitochondrial genes can be replaced allotopically. Analyses of the hydrophobic patterns of different polypeptides suggest that hydrophobicity of the N-terminal segment is the main determinant for the importability of peptides into mammalian mitochondria.

Sign in / Sign up

Export Citation Format

Share Document