scholarly journals Comparative analysis of sour cherry cultivars on their ecological and biological indicators

2021 ◽  
Vol 27 ◽  
Author(s):  
D. Surányi
Keyword(s):  
Northern Hemisphere ◽  
Sour Cherry ◽  
Morphological Diversity ◽  
Biological Indicators ◽  
Frost Tolerance ◽  
Open Pollination ◽  
Prunus Species ◽  
The Balkans ◽  
Partial Similarity ◽  
Cultivar Groups

Sour cherries developed in the northern hemisphere, an alloploid hybrid of dwarf sour cherries (Prunus fruticosa) and bird cherries (P. avium), born in the confluence of the two species. However, the ecological and, above all, cold tolerance of the ancestor of cultivated sour cherries is higher than that of wild cherries (De Candolle, 1894; Rehder, 1954; Terpó, 1974; Iezzoni et al., 1991; Faust & Surányi, 1997). The cultivation limits are in the northern hemisphere 38-44. degree. The Carpathian Basin, the Balkans and Asia Minor are considered to be the main birthplaces for sour cherries. The genetic and morphological diversity of sour cherries is greater than that of the basic species (Iezzoni et al. 1991; Faust & Surányi, 1997). In the study, 472 sour cherry cultivars were compared based on 7 relative ecological indicators and 3 biological values. Compared to other Prunus species, we mostly found less variability in sour cherries - not counting their salt tolerance (SB). The partial similarity between open pollination (OP), frost tolerance (FR) and disease resistance (DR) - partly true in terms of varieties, but also reflected the effects of purposeful breeding and selection. The cultivars together - in comparison, showed balance, but in the highlighting, the differences of the 3 cultivar groups became significant. Indeed, the differences between the species of the former Hungarian cultural flora are clearly different (Surányi, 2004), which is also the case when comparing a large number of apricot (Surányi, 2014), plum (Surányi, 2015) and peach (Surányi, 2020) varieties.

scholarly journals Comparative analysis of apricot cultivars based on their ecological and biological indicators

2016 ◽  
Vol 22 (3-4) ◽  
Author(s):  
D. Surányi
Keyword(s):  
Disease Susceptibility ◽  
Woody Plant ◽  
Biological Indicators ◽  
Frost Tolerance ◽  
Open Pollination ◽  
Fruit Species ◽  
Wild Fruit ◽  
New System ◽  
Sharka Virus

The herbaceous plants organic characterize Ellenberg et al. worked out (1991), well-use system, which is updated with herbaceous and woody plant in the Hungarian flora species, so Soó (1964-1985), Zólyomi et al. (1967), Précsényi (1986) and Simon (1988) also addressed by different aspects of this problem circuits. The author is the first extended-Borhidi –Ellenberg’s system of wild fruit species (Surányi 2000, 2006) and cultivated of fruit (Surányi 2014) as well. Additional considerations there were aspects of the study of fruit varieties, these biological indicators following open pollination, frost tolerance, resistance of Sharka virus and disease   susceptibility for. Firstly, we introduced a system for improving it a plum species and cultivars (Surányi 2015). In this case we used the new system among species and varieties of apricots, because diversity was able to express significantly. Especially the SB, WB, NB, and the relative biological value figures showed the variety. RB (reaction figures) fluctuated only slightly among the 463 varieties, but the dynamic difference between the 11’s was an indicator for the characterization of apricots. If the comparison performed plum and apricot variety’s level anyway justified the use of 11 kinds of organic and biological indicators.

scholarly journals High-Throughput Sequencing Reveals Further Diversity of Little Cherry Virus 1 with Implications for Diagnostics

Viruses ◽  
2018 ◽  
Vol 10 (7) ◽  
pp. 385 ◽  
Author(s):  
Asimina Katsiani ◽  
Varvara Maliogka ◽  
Nikolaos Katis ◽  
Laurence Svanella-Dumas ◽  
Antonio Olmos ◽  
...  
Keyword(s):  
Genetic Diversity ◽  
High Throughput ◽  
High Throughput Sequencing ◽  
Sour Cherry ◽  
Prunus Species ◽  
Cherry Tree ◽  
High Genetic Diversity ◽  
Viral Genomes ◽  
Virus Diversity ◽  
First Time

Little cherry virus 1 (LChV1, Velarivirus, Closteroviridae) is a widespread pathogen of sweet or sour cherry and other Prunus species, which exhibits high genetic diversity and lacks a putative efficient transmission vector. Thus far, four distinct phylogenetic clusters of LChV1 have been described, including isolates from different Prunus species. The recent application of high throughput sequencing (HTS) technologies in fruit tree virology has facilitated the acquisition of new viral genomes and the study of virus diversity. In the present work, several new LChV1 isolates from different countries were fully sequenced using different HTS approaches. Our results reveal the presence of further genetic diversity within the LChV1 species. Interestingly, mixed infections of the same sweet cherry tree with different LChV1 variants were identified for the first time. Taken together, the high intra-host and intra-species diversities of LChV1 might affect its pathogenicity and have clear implications for its accurate diagnostics.

INCIDENCE OF NECROTIC RINGSPOT AND PRUNE DWARF VIRUSES IN WILD PRUNUS SPECIES

1972 ◽  
Vol 52 (6) ◽  
pp. 907-913 ◽  
Author(s):  
T. R. DAVIDSON ◽  
V. RUNDANS
Keyword(s):  
Wild Species ◽  
Prunus Avium ◽  
Sour Cherry ◽  
Ringspot Virus ◽  
Dwarf Virus ◽  
Prunus Species ◽  
Prune Dwarf Virus ◽  
Niagara River ◽  
Niagara Escarpment

In the fruit belt of the Niagara Peninsula, wild Prunus avium and P. serotina are common along the Niagara Escarpment, the larger streams, and the Niagara River. P. virginiana is somewhat more widespread than the former species and P. pensylvanica is very rare. P. nigra and P. americana are limited in distribution. The necrotic ringspot virus (NRSV) was detected in trees of P. avium, P. serotina, and P. virginiana, whereas the prune dwarf virus (PDV) (sour cherry yellows) was found only in trees of P. avium and P. serotina. Because of the limited incidence and distribution of virus-infected trees, however, and because the bloom periods of the wild species rarely coincide with sour cherry, peach, or plum, wild Prunus species are considered relatively unimportant as potential reservoirs of virus for infection of commercial orchards.

scholarly journals Preliminary evaluation of pollen quality, fertility relations and fruit set of selected sour cherry cultivars in polish conditions

2012 ◽  
Vol 61 (1) ◽  
pp. 71-77 ◽  
Author(s):  
Ewa Szpadzik ◽  
Ewa Jadczuk-Tobjasz ◽  
Barbara Łotocka
Keyword(s):  
Fruit Set ◽  
Sour Cherry ◽  
Preliminary Evaluation ◽  
Open Pollination ◽  
Pollen Quality ◽  
Cross Pollination ◽  
Self Pollination

Preliminary experiments were carried out in spring 2006. The percentage of fruit set of 'Schattenmorelle IR-2', 'Koral', 'Debreceni Bötermö', 'újfefértói Fürtos' and 'Karneol' was higher after open pollination compared with self-pollination. The cultivar Vowi had an inconsiderably higher percentage of fruit set after self-pollination compared with open pollination. The percentage of fruit set in 'Debreceni Bötermö' and 'újfehértói Fürtos' was about 25 % higher after pollination by 'Schattenmorelle IR-2' and 'Koral' compared with the percentage of fruit set after cross - pollination of both cultivars with each other. In general, they did not appear to be good pollinators with each other. The highest quality of pollen was observed for the following cultivars: 'Schattenmorelle IR-2', 'Koral' and Vowi and the lowest result was obtained in 'újfehértói Fürtos'. The highest yield was given by the following cultivars: Vowi, Schattenmorelle IR-2 and Koral.

scholarly journals Biochemical characterisation of chlorophyllase from leaves of selected Prunus species--a comparative study.

2013 ◽  
Vol 60 (3) ◽  
Author(s):  
Hubert Sytykiewicz ◽  
Iwona Sprawka ◽  
Paweł Czerniewicz ◽  
Cezary Sempruch ◽  
Bogumił Leszczyński ◽  
...  
Keyword(s):  
Enzymatic Activity ◽  
Sour Cherry ◽  
Inhibitory Effect ◽  
Biochemical Properties ◽  
Prunus Domestica ◽  
Prunus Species ◽  
Chl A ◽  
Chlorophyll Breakdown ◽  
Biochemical Characterisation ◽  
Catabolic Process

Despite senescence-induced chlorophyll depletion in plants has been widely studied, the enzymatic background of this physiologically regulated process still remains highly unclear. The purpose of this study was to determine selected biochemical properties of partially purified fractions of chlorophyllase (Chlase, chlorophyll chlorophyllido-hydrolase, EC 3.1.1.14) from leaves of three Prunus species: bird cherry (Prunus padus L.), European plum (Prunus domestica L.), and sour cherry (Prunus cerasus L.). Secondarily, this report was aimed at comparing seasonal dynamics of Chlase activity and chlorophyll a (Chl a) content within investigated plant systems. Molecular weight of native Chlase F1 has been estimated at 90 kDa (bird cherry) and approximately 100 kDa (European plum and sour cherry), whereas molecular mass of Chlase F2 varied from 35 kDa (European plum) to 60 kDa (sour cherry). Furthermore, enzyme fractions possessed similar optimal pH values ranging from 7.6 to 8.0. It was found that among a broad panel of tested metal ions, Hg(+2), Fe(+2), and Cu(+2) cations showed the most pronounced inhibitory effect on the activity of Chlase. In contrast, the presence of Mg(+2) ions influenced a subtle stimulation of the enzymatic activity. Importantly, although Chlase activity was negatively correlated with the amount of Chl a in leaves of examined Prunus species, detailed comparative analyses revealed an incidental decrement of enzymatic activity in early or moderately senescing leaves. It provides evidence that foliar Chlase is not the only enzyme involved in autumnal chlorophyll breakdown and further in-depth studies elucidating this catabolic process are required.

scholarly journals Prunus Host Range of Plum pox virus (PPV) in the United States by Aphid and Graft Inoculation

Plant Disease ◽  
2007 ◽  
Vol 91 (1) ◽  
pp. 18-23 ◽  
Author(s):  
V. D. Damsteegt ◽  
R. Scorza ◽  
A. L. Stone ◽  
W. L. Schneider ◽  
K. Webb ◽  
...  
Keyword(s):  
Virus Disease ◽  
Systemic Infection ◽  
Sour Cherry ◽  
Aphid Transmission ◽  
The United States ◽  
Enzyme Linked Immunosorbent Assay ◽  
Plum Pox Virus ◽  
Rt Pcr ◽  
Prunus Species ◽  
Wide Range

Plum pox (Sharka) is a serious virus disease of stone fruits caused by the Plum pox virus (PPV). To determine which species could function as potential hosts and virus reservoirs, we used aphid transmission and bud or chip grafting to evaluate the susceptibility of commercial, ornamental, and wild Prunus species to isolates of PPV found in Pennsylvania, USA. Following inoculation, test trees were observed for symptoms, analyzed by enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction (PCR), back-assayed to healthy peach, and followed through at least four cold-induced dormancy (CID) cycles over 4 years. Thirty-one of 33 Prunus species and cultivars were systemically infected following aphid transmission. Systemic infection could not be detected in P. cerasus (sour cherry) and P. × ‘Snofozam’ (Snow Fountains) despite repeated aphid inoculation attempts. Following grafting of PPV-infected budwood, all 40 species and varieties became infected, although species differed in their susceptibility. Within most species, some individual plants remained PPV negative throughout the study despite repeated inoculations. Infection in some species could be detected only through quantitative reverse transcription (RT)-PCR. Most species displayed clear symptoms, were highly positive by ELISA and RT-PCR, and could be back-inoculated into peach seedlings following CID. Our results indicate that a wide range of native and ornamental Prunus species are susceptible to U.S. isolates of PPV-D.

scholarly journals Blooming phenology and fertility of sour cherry cultivars selected in Hungary

2002 ◽  
Vol 8 (2) ◽  
Author(s):  
J. Nyéki ◽  
T. Szabó ◽  
Z. Szabó
Keyword(s):  
Fruit Set ◽  
Sour Cherry ◽  
Flowering Phenology ◽  
The Self ◽  
Open Pollination ◽  
Bee Pollination ◽  
Bloom Period ◽  
Self Pollination ◽  
Pollination Methods ◽  
Blooming Phenology

Experiments were conducted during the period between 1972 and 2002 at three sites in Hungary. At Érd 97, Helvetia 10, and Újfehértó, 3 cultivars were studied in variety collections. Observations were made on the blooming phenology (start, main time, end and length of the bloom period), on the blooming dynamics (the rate of the open flowers counted every day), on the receptivity of sexual organs, on the fruit set following self- and open-pollination and on the effect of association of varieties in the orchards (choice, rate and placement of pollinisers). Based on the results the rate of the overlap of the blooming times were calculated and varieties were assigned into five bloom time groups according to their main bloom. Self-fertility conditioned by natural self pollination was studied and good pollinisers were chosen (sweet, sour and duke cherry varieties) for the self-sterile and partially self-fertile varieties. The necessity of bee pollination was proved by different pollination methods: natural self-pollination, artificial self-pollination, open pollination. Summary: Experiments were conducted during the period between 1972 and 2002 at three sites in Hungary. At Érd 97, Helvetia 10, and Újfehértó, 3 cultivars were studied in variety collections. Observations were made on the flowering phenology (start, main time, end and length of the bloom period), on the flowering dynamics (the rate of the open flowers counted every day), on the receptivity of sexual organs, on the fruit set following self- and open-pollination and on the effect of association of varieties in the orchards (choice, rate and placement of pollinisers).

scholarly journals First Report of Cherry green ring mottle virus in Plum (Prunus domestica) in North America

Plant Disease ◽  
2009 ◽  
Vol 93 (10) ◽  
pp. 1073-1073 ◽  
Author(s):  
L. P. Wang ◽  
N. Hong ◽  
G. P. Wang ◽  
R. Michelutti ◽  
B. L. Zhang
Keyword(s):  
North America ◽  
Sweet Cherry ◽  
Sour Cherry ◽  
Mottle Virus ◽  
Rt Pcr ◽  
Prunus Species ◽  
Indicator Plants ◽  
First Report ◽  
Green Ring ◽  
Field Samples

Cherry green ring mottle virus (CGRMV), a member of the genus Foveavirus, is reported to infect several Prunus species including sour cherry (Prunus cerasus L.), sweet cherry (P. avium L.), flowering cherry (P. serrulata L.), peach (P. persica B.), and apricot (P. armeniaca L.). The virus has been detected in most regions of North America, Europe, New Zealand, Africa, and Japan where Prunus species are grown for production (3). In sour cherry, the virus causes leaf yellowing and dark mottle around secondary veins. Other Prunus species are usually symptomless hosts of CGRMV. There is no report on the infection of CGRMV in plum so far. A survey was conducted to evaluate the sanitary status of stone fruit tree collections in the Canadian Clonal Genebank (CCG) at the Greenhouse and Processing Crops Research Center (GPCRC) in Harrow, Ontario (Canada). In October 2006, samples from 110 cultivar clones including 28 sweet cherry, 36 sour cherry, 12 hybrids, and 34 plum accessions, were bud grafted onto indicator seedlings of P. serrulata ‘Kwanzan’ for virus indexing in a greenhouse with a controlled environment. In April 2007, symptoms of epinasty and/or rusty necrotic fragments of midrib, which is indicative of Kwanzan infection by CGRMV (4), were observed on indicator plants inoculated with samples from eight clones (one sweet cherry, one cherry plum (P. besseyi × P. hortulana) and six plum). Indicator plants inoculated with samples from 19 other clones (three sweet cherry, nine sour cherry, one cherry plum and six plum) showed symptoms including small leaves and leaves that were twisted, deformed, bubbled, and/or had shot holes. Total RNA was extracted from leaves of all these symptomatic indicator plants by the cetyltrimethylammoniumbromide (CTAB) method (2). One-step reverse transcription (RT)-PCR was carried out using the primer set CGRMV1 (CCTCATTCACATAGCTTAGGTTT, 7,297 to 7,313 bp) and CGRMV2 (ACTTTAGCTTCGCCCCGTG, 8,245 to 8,227 bp) (1) for the detection of CGRMV. Amplicons of the expected size of 948 bp were consistently produced from eight samples showing symptoms of CGRMV infection, no amplicons were produced from the other 19 samples. Those results were further confirmed by RT-PCR detection for the original field samples. The fragment from plum cv. Vanier was cloned into pGEM-T Easy and sequenced in both directions of three clones. The resulting nucleotide sequence (GenBank Accession No. FJ402843) had the highest identity (97%) with that of a CGRMV isolate Star from sweet cherry (GenBank Accession No. AY841279) and had lower identity (81%) with that of a CGRMV isolate from apricot (GenBank Accession No. AY172334.1). To our knowledge, this is the first report of CGRMV infecting plum in North America. References: (1) R. Li and R. Mock. J. Virol. Methods 129:162, 2005. (2) R. Li et al. Plant Dis. 88:12, 2004. (3) K. G. Parker et al. USDA Agric. Handb. No. 437:193, 1976. (4) Y. Zhang et al. J. Gen. Virol. 79:2275, 1998.

scholarly journals Review of the biology of plant psyllid (Cacopsylla pruni, Scopoli 1763), and its role in the spreading of European stone fruit yellows, ESFY-phytoplasma with Hungarian data

2018 ◽  
pp. 25-33 ◽  
Author(s):  
Dominika Bodnár ◽  
Kitti Csüllög ◽  
Gábor Tarcali
Keyword(s):  
Life Cycle ◽  
Sour Cherry ◽  
Early Spring ◽  
Stone Fruit ◽  
Prunus Species ◽  
Important Data ◽  
Know How ◽  
Knock Down ◽  
Cacopsylla Pruni ◽  
The Right

The European stone fruit yellows (ESFY) phytoplasma disease caused by pathogen ’Ca. Phytoplasma prunorum’ induces serious damages in cherry, sour cherry, peach, and apricot orchards mostly in Europe. Its known vector is the plum psyllid (Cacopsylla pruni). Many articles report on the biology (morphology, taxonomy, life cycle etc.) and the method of transmission of the pathogen by the vector, and the possibilities of their control. This paper reviews our knowledge about the vector, and summarises the results of an inland research carried out in a northeastern Hungarian apricot orchards. Our goal was to show some important data for the farmers or anyone who is interested in this disease and its vector. And give some known method that we can protect our orchards against them to prevent the appearance of the disease. As the psyllid that became infected with the pathogen can hold its infectionous capacity during their lifetime, it is very important to have enough knowledge about their lifecycle, that we can determine the right time and method to control them. We also have to know how to identify them; therefore, this paper lists several important data which can be helpful. The most important keys of identification are their wing color, which dark borwn in the apex and brown is in the remaining part of the forewing. The length of the antennae is also an important factor, since other genuse’s species have longer antennae than twice the width of the head. C. pruni has as long antennae as twice the width of the head. They return to Prunus species in early spring and we have to protect our orhards in this period against them. We have to use preparations with a knock down effect on them to prevent the inoculation of the pathogen into the trees in our orchards.

Sign in / Sign up

Export Citation Format

Share Document