scholarly journals Identification and Molecular Analysis of Putative Self-Incompatibility Ribonuclease Alleles in an Extreme Polyploid Species, Prunus laurocerasus L.

2021 ◽  
Vol 12 ◽  
Author(s):  
Júlia Halász ◽  
Anna Borbála Molnár ◽  
Gulce Ilhan ◽  
Sezai Ercisli ◽  
Attila Hegedűs
Keyword(s):  
Amino Acid ◽  
Pcr Amplification ◽  
Amino Acid Sequences ◽  
Phylogenetic Position ◽  
Pcr Analysis ◽  
Self Incompatibility ◽  
Polyploid Species ◽  
Specific Allele ◽  
Cherry Laurel ◽  
Prunus Laurocerasus

Cherry laurel (Prunus laurocerasus L.) is an extreme polyploid (2n = 22x) species of the Rosaceae family where gametophytic self-incompatibility (GSI) prevents inbreeding. This study was carried out to identify the S-ribonuclease alleles (S-RNases) of P. laurocerasus using PCR amplification of the first and second intron region of the S-RNase gene, cloning and sequencing. A total of 23 putative S-RNase alleles (S1–S20, S5m, S13m, and S18m) were sequenced from the second (C2) to the fifth conserved region (C5), and they shared significant homology to other Prunus S-RNases. The length of the sequenced amplicons ranged from 505 to 1,544 bp, and similar sizes prevented the proper discrimination of some alleles based on PCR analysis. We have found three putatively non-functional alleles (S5m, S18m, and S9) coding for truncated proteins. Although firm conclusions cannot be drawn, our data seem to support that heteroallelic pollen cannot induce self-compatibility in this polyploid Prunus species. The identities in the deduced amino acid sequences between the P. laurocerasus and other Prunus S-RNases ranged between 44 and 100%, without a discontinuity gap separating the identity percentages of trans-specific and more distantly related alleles. The phylogenetic position, the identities in nucleotide sequences of the second intron and in deduced amino acid sequences found one or more trans-specific alleles for all but S10, S14, S18, and S20 cherry laurel RNases. The analysis of mutational frequencies in trans-specific allele pairs indicated the region RC4–C5 accepts the most amino acid replacements and hence it may contribute to allele-specificity. Our results form the basis of future studies to confirm the existence and function of the GSI system in this extreme polyploid species and the alleles identified will be also useful for phylogenetic studies of Prunus S-RNases as the number of S-RNase sequences was limited in the Racemose group of Prunus (where P. laurocerasus belongs to).

Phylogenetic Position of the Mitochondrion-Lacking Protozoan Trichomonas tenax, Based on Amino Acid Sequences of Elongation Factors 1α and 2

1997 ◽  
Vol 44 (1) ◽  
pp. 98-105 ◽  
Author(s):  
Ayako Yamamoto ◽  
Tetsuo Hashimoto ◽  
Emiko Asaga ◽  
Masami Hasegawa ◽  
Nobuichi Goto
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequences ◽  
Phylogenetic Position ◽  
Elongation Factors

scholarly journals Phylogenetic relationships of the nematode subfamily Phascolostrongylinae from macropodid and vombatid marsupials inferred using mitochondrial protein sequence data

2021 ◽  
Vol 14 (1) ◽  
Author(s):  
Tanapan Sukee ◽  
Ian Beveridge ◽  
Anson V. Koehler ◽  
Ross Hall ◽  
Robin B. Gasser ◽  
...  
Keyword(s):  
Amino Acid ◽  
Phylogenetic Relationships ◽  
Sequence Data ◽  
Mitochondrial Protein ◽  
Amino Acid Sequences ◽  
Internal Transcribed Spacers ◽  
Nuclear Ribosomal Dna ◽  
Phylogenetic Position ◽  
Data Sets ◽  
Sister Relationship

Abstract Background The subfamily Phascolostrongylinae (Superfamily Strongyloidea) comprises nematodes that are parasitic in the gastrointestinal tracts of macropodid (Family Macropodidae) and vombatid (Family Vombatidae) marsupials. Currently, nine genera and 20 species have been attributed to the subfamily Phascolostrongylinae. Previous studies using sequence data sets for the internal transcribed spacers (ITS) of nuclear ribosomal DNA showed conflicting topologies between the Phascolostrongylinae and related subfamilies. Therefore, the aim of this study was to validate the phylogenetic relationships within the Phascolostrongylinae and its relationship with the families Chabertiidae and Strongylidae using mitochondrial amino acid sequences. Methods The sequences of all 12 mitochondrial protein-coding genes were obtained by next-generation sequencing of individual adult nematodes (n = 8) representing members of the Phascolostrongylinae. These sequences were conceptually translated and the phylogenetic relationships within the Phascolostrongylinae and its relationship with the families Chabertiidae and Strongylidae were inferred from aligned, concatenated amino acid sequence data sets. Results Within the Phascolostrongylinae, the wombat-specific genera grouped separately from the genera occurring in macropods. Two of the phascolostrongyline tribes were monophyletic, including Phascolostrongylinea and Hypodontinea, whereas the tribe Macropostrongyloidinea was paraphyletic. The tribe Phascolostrongylinea occurring in wombats was closely related to Oesophagostomum spp., also from the family Chabertiidae, which formed a sister relationship with the Phascolostrongylinae. Conclusion The current phylogenetic relationship within the subfamily Phascolostrongylinae supports findings from a previous study based on ITS sequence data. This study contributes also to the understanding of the phylogenetic position of the subfamily Phascolostrongylinae within the Chabertiidae. Future studies investigating the relationships between the Phascolostrongylinae and Cloacininae from macropodid marsupials may advance our knowledge of the phylogeny of strongyloid nematodes in marsupials. Graphical Abstract

scholarly journals Cloning and Comparison of fliC Genes and Identification of Glycosylation in the Flagellin ofPseudomonas aeruginosa a-Type Strains

1998 ◽  
Vol 180 (12) ◽  
pp. 3209-3217 ◽  
Author(s):  
Cynthia D. Brimer ◽  
T. C. Montie
Keyword(s):  
Molecular Weight ◽  
Monoclonal Antibody ◽  
Pseudomonas Aeruginosa ◽  
Amino Acid ◽  
Type Strain ◽  
Polyacrylamide Gel Electrophoresis ◽  
Sodium Dodecyl ◽  
Pcr Amplification ◽  
Amino Acid Sequences ◽  
Type Strains

ABSTRACT Pseudomonas aeruginosa a-type strains produce flagellin proteins which vary in molecular weight between strains. To compare the properties of a-type flagellins, the flagellin genes of severalPseudomonas aeruginosa a-type strains, as determined by interaction with specific anti-a monoclonal antibody, were cloned and sequenced. PCR amplification of the a-type flagellin gene fragments from five strains each yielded a 1.02-kb product, indicating that the gene size is not likely to be responsible for the observed molecular weight differences among the a-type strains. The flagellin amino acid sequences of several a-type strains (170018, 5933, 5939, and PAK) were compared, and that of 170018 was compared with that of PAO1, a b-type strain. The former comparisons revealed that a-type strains are similar in amino acid sequence, while the latter comparison revealed differences between 170018 and PAO1. Posttranslational modification was explored for its contribution to the observed differences in molecular weight among the a-type strains. A biotin-hydrazide glycosylation assay was performed on the flagellins of three a-type strains (170018, 5933, and 5939) and one b-type strain (M2), revealing a positive glycosylation reaction for strains 5933 and 5939 and a negative reaction for 170018 and M2. Deglycosylation of the flagellin proteins with trifluoromethanesulfonic acid (TFMS) confirmed the glycosylation results. A molecular weight shift was observed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis for the TFMS-treated flagellins of 5933 and 5939. These results indicate that the molecular weight discrepancies observed for the a-type flagellins can be attributed, at least in part, to glycosylation of the protein. Anti-a flagellin monoclonal antibody reacted with the TFMS-treated flagellins, suggesting that the glycosyl groups are not a necessary component of the epitope for the human anti-a monoclonal antibody. Comparisons between a-type sequences and a b-type sequence (PAO1) will aid in delineation of the epitope for this monoclonal antibody.

scholarly journals Characterization of one new non-S-RNase of Armeniaca cathayana

2019 ◽  
Vol 55 (No. 1) ◽  
pp. 39-41
Author(s):  
Mengpei Liu ◽  
Pei Hou ◽  
Xiaoyuan Wang ◽  
Yu Dong ◽  
Wei Zong
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequences ◽  
Self Incompatibility ◽  
Blast Analysis ◽  
New Information ◽  
S Allele ◽  
The One ◽  
A New Species ◽  
Prunus Webbii

Armeniaca cathayana, a new species described in 2010, belongs to gametophytic self-incompatibility (GSI) system which is under S-allele control. One new non-S-ribonuclease (non-S-RNase) was found in A. cathayana through comparing its nucleotide and amino acid sequences with sequences of the S-allele in Genbank. The BLAST analysis showed that the one new non-S-RNase S68-RNase (GenBank Accession No. MH155952) had the highest 96% nucleotide sequence homology with Prunus webbii non-S-RNase PW<sub>1</sub> (EU809938.1). Alignment of deduced amino acid sequences of A. cathayana S68-RNase shared 83% similarity with P. webbii PW<sub>1</sub>. The new non-S-RNase determined in this study will provide new information to GSI of Rosaceae.  

scholarly journals Isolation and Characterization of Genes Responsible for Naphthalene Degradation from Thermophilic Naphthalene Degrader, Geobacillus sp. JF8

2019 ◽  
Vol 8 (1) ◽  
pp. 44 ◽  
Author(s):  
Daisuke Miyazawa ◽  
Le Thi Ha Thanh ◽  
Akio Tani ◽  
Masaki Shintani ◽  
Nguyen Hoang Loc ◽  
...  
Keyword(s):  
Amino Acid ◽  
Thermophilic Bacterium ◽  
Amino Acid Sequences ◽  
Open Reading Frames ◽  
Pcr Analysis ◽  
Naphthalene Degradation ◽  
Isolation And Characterization ◽  
Dihydrodiol Dehydrogenase ◽  
Reading Frames

Geobacillus sp. JF8 is a thermophilic biphenyl and naphthalene degrader. To identify the naphthalene degradation genes, cis-naphthalene dihydrodiol dehydrogenase was purified from naphthalene-grown cells, and its N-terminal amino acid sequence was determined. Using a DNA probe encoding the N-terminal region of the dehydrogenase, a 10-kb DNA fragment was isolated. Upstream of nahB, a gene for dehydrogenase, there were two open reading frames which were designated as nahAc and nahAd, respectively. The products of nahAc and nahAd were predicted to be alpha and beta subunit of ring-hydroxylating dioxygenases, respectively. Phylogenetic analysis of amino acid sequences of NahB indicated that it did not belong to the cis-dihydrodiol dehydrogenase group that includes those of classical naphthalene degradation pathways. Downstream of nahB, four open reading frames were found, and their products were predicted as meta-cleavage product hydrolase, monooxygenase, dehydrogenase, and gentisate 1,2-dioxygenase, respectively. A reverse transcriptase-PCR analysis showed that transcription of nahAcAd was induced by naphthalene. These findings indicate that we successfully identified genes involved in the upper pathway of naphthalene degradation from a thermophilic bacterium.

An Anionic, Stem-Specific Flax Peroxidase cDNA With C-Terminal Motifs Also Found in a Blue Copper-Type Pea Protein Correlated With Lignin Deposition

1996 ◽  
Vol 23 (6) ◽  
pp. 773 ◽  
Author(s):  
F Omann ◽  
H Tyson
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Catalytic Domain ◽  
Pcr Amplification ◽  
Amino Acid Sequences ◽  
Specific Expression ◽  
Blue Copper ◽  
Linum Usitatissimum L ◽  
Plant Peroxidases ◽  
Lignin Deposition

A flax (Linum usitatissimum L.) peroxidase cDNA (FLXPER1) was isolated from a �gt10 library made from RNA derived from shoot tissue of the cultivar Stormont Cirrus, by screening with probes encoding amino termini of flax peroxidases. The probes were obtained by PCR amplification of the library with the �gt10 reverse primer 5'CTTATGAGTATTTCTTCCAGGGTA3' flanking the Eco RI cloning site, and a mixed oligonucleotide derived from the catalytic domain (HFHDCFV) found in all plant peroxidases. FLXPER1 is the second flax peroxidase to be so isolated and described, following the previously documented FLXPER2 (Omann et al. 1994, Genome 37, 137-147). These two cDNAs are the completely sequenced members of a family currently encompassing FLXPER1 to FLXPER4, all isolated from the same �gt10 library. FLXPER3 and 4 will be separately described and related to FLXPER1, 2. The FLXPER1 deduced amino acid sequence reveals a signal peptide of 27 amino acids, and an anionic mature protein with seven potential N-linked glycosylation sites in its 332 amino acids (38.25 kDa; pI 4.38). The FLXPER1 C terminus is similar to plant peroxidases with a putative C-terminal vacuolar targeting signal, but also contains amino acid motifs with striking homologies to the membrane anchoring motifs of a pea blue copper type protein correlated with lignin deposition. Northern blot analysis demonstrated its stem specific expression. Southern blots suggested one to five copies of FLXPER1 in the flax genome, compared with one to two for FLXPER2. FLXPER1 resembles cucumber, poplar and tobacco amino acid sequences; its asymmetry in codon usage coincides with that of other dicotyledon peroxidases, i.e. much lower than in monocotyledon peroxidases.

scholarly journals Identification of cytokine-induced neutrophil chemoattractants (CINC), rat GRO/CINC-2α and CINC-2 β, produced by granulation tissue in culture: purification, complete amino acid sequences and characterization

1994 ◽  
Vol 301 (2) ◽  
pp. 545-550 ◽  
Author(s):  
H Nakagawa ◽  
N Komorita ◽  
F Shibata ◽  
A Ikesue ◽  
K Konishi ◽  
...  
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Granulation Tissue ◽  
Pcr Amplification ◽  
Neutrophil Infiltration ◽  
Amino Acid Sequences ◽  
Terminal Amino Acid ◽  
Reverse Transcription Pcr ◽  
Terminal Amino ◽  
The Difference

Four basic neutrophil chemotactic factors (chemokines) have been purified from conditioned medium of granulation tissue obtained from carrageenin-induced inflammation in the rat. On the basis of their N-terminal amino acid sequences, one of the chemokines was identical with rat GRO/cytokine-induced neutrophil chemoattractant (CINC) which we reported previously, and another was identical with rat macrophage inflammatory protein-2 (MIP-2). Two other chemokines were novel chemoattractants related to MIP-2. The novel chemokines are referred to as rat GRO/CINC-2 alpha and CINC-2 beta, and consequently CINC and rat MIP-2 are renamed rat GRO/CINC-1 and CINC-3 respectively. The complete amino acid sequences of purified CINC-2 alpha and CINC-3 were determined by analysis of the fragments isolated from proteinase V8-treated CINCs. The cDNA for CINC-2 beta was cloned by reverse transcription/PCR amplification using specific primers starting with total RNA extracted from lipopolysaccharide-stimulated rat macrophages. A comparison of the amino acid sequence encoded by the cDNA with the N-terminal amino acid sequence of purified CINC-2 beta revealed that mature CINC-2 beta is a 68-residue chemoattractant produced by cleavage of a 32-residue signal peptide. The difference in amino acid sequences between CINC-2 alpha and CINC-2 beta consisted of only three C-terminal residues. Rat GRO/CINC-2 alpha is a major chemokine, and the four purified chemokines have similar chemotactic activity, suggesting that they contribute to neutrophil infiltration into inflammatory sites in rats.

Diversity of the trifunctional histidine biosynthesis gene (his) in cerealPhaeosphaeriaspecies

Genome ◽  
2007 ◽  
Vol 50 (6) ◽  
pp. 595-609 ◽  
Author(s):  
Chih-Li Wang ◽  
Arkadiusz Malkus ◽  
Sabina M. Zuzga ◽  
Pi-Fang Linda Chang ◽  
Barry M. Cunfer ◽  
...  
Keyword(s):  
Genetic Diversity ◽  
Amino Acid ◽  
Meiotic Recombination ◽  
Pcr Amplification ◽  
Amino Acid Sequences ◽  
Histidine Biosynthesis ◽  
Leaf Blotch ◽  
Rates Of Evolution ◽  
Biosynthesis Gene ◽  
Histidinol Dehydrogenase

Phaeosphaeria species are important causal agents of Stagonospora leaf blotch diseases in cereals. In this study, the nucleotide sequence and deduced polypeptide of the trifunctional histidine biosynthesis gene (his) are used to investigate the phylogenetic relationships and provide molecular identification among cereal Phaeosphaeria species. The full-length sequences of the his gene were obtained by PCR amplification and compared among cereal Phaeosphaeria species. The coding sequence of the his gene in wheat-biotype P. nodorum (PN-w) was 2697 bp. The his genes in barley-biotype P. nodorum (PN-b), two P. avenaria f. sp. triticea isolates (homothallic Pat1 and Pat3), and Phaeosphaeria species from Polish rye and dallis grass were 2694 bp. The his gene in heterothallic isolate Pat2, however, was 2693 bp because the intron had one fewer base. In P. avenaria f. sp. avenaria (Paa), the his gene was only 2670 bp long. The differences in the size of the his gene contributed to the variation in amino acid sequences in the gap region located between the phosphoribosyl-ATP pyrophosphohydrolase and histidinol dehydrogenase sub-domains. Based on nucleotide and deduced amino acid sequences of the his gene, Pat1 was not closely related to either PN-w or the Paa clade. It appears that rates of evolution of the his gene were fast in cereal Phaeosphaeria species. The possible involvement of meiotic recombination in genetic diversity of the his gene in P. nodorum is discussed.

Sign in / Sign up

Export Citation Format

Share Document