PCR amplification of cDNAs of fish hemoglobin β chains using a consensus primer: cDNA-derived amino acid sequences of β chains from the catfishParasilurus asotus and the scadDecapterus maruadsi

1996 ◽  
Vol 15 (4) ◽  
pp. 389-394 ◽  
Author(s):  
Tomohiko Suzuki ◽  
Teppei Nishikawa

1998 ◽  
Vol 180 (12) ◽  
pp. 3209-3217 ◽  
Author(s):  
Cynthia D. Brimer ◽  
T. C. Montie

ABSTRACT Pseudomonas aeruginosa a-type strains produce flagellin proteins which vary in molecular weight between strains. To compare the properties of a-type flagellins, the flagellin genes of severalPseudomonas aeruginosa a-type strains, as determined by interaction with specific anti-a monoclonal antibody, were cloned and sequenced. PCR amplification of the a-type flagellin gene fragments from five strains each yielded a 1.02-kb product, indicating that the gene size is not likely to be responsible for the observed molecular weight differences among the a-type strains. The flagellin amino acid sequences of several a-type strains (170018, 5933, 5939, and PAK) were compared, and that of 170018 was compared with that of PAO1, a b-type strain. The former comparisons revealed that a-type strains are similar in amino acid sequence, while the latter comparison revealed differences between 170018 and PAO1. Posttranslational modification was explored for its contribution to the observed differences in molecular weight among the a-type strains. A biotin-hydrazide glycosylation assay was performed on the flagellins of three a-type strains (170018, 5933, and 5939) and one b-type strain (M2), revealing a positive glycosylation reaction for strains 5933 and 5939 and a negative reaction for 170018 and M2. Deglycosylation of the flagellin proteins with trifluoromethanesulfonic acid (TFMS) confirmed the glycosylation results. A molecular weight shift was observed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis for the TFMS-treated flagellins of 5933 and 5939. These results indicate that the molecular weight discrepancies observed for the a-type flagellins can be attributed, at least in part, to glycosylation of the protein. Anti-a flagellin monoclonal antibody reacted with the TFMS-treated flagellins, suggesting that the glycosyl groups are not a necessary component of the epitope for the human anti-a monoclonal antibody. Comparisons between a-type sequences and a b-type sequence (PAO1) will aid in delineation of the epitope for this monoclonal antibody.



1996 ◽  
Vol 315 (1) ◽  
pp. 315-321 ◽  
Author(s):  
Kent L. REDMAN ◽  
Glenn W. BURRIS

Rat cDNAs for a 52-amino-acid ribosomal protein (CEP52) that is typically formed as a ubiquitin fusion protein, were cloned following reverse transcription and PCR amplification. CEP52 sequence conservation is demonstrated by the similarity of the human and rat cDNA sequences and the identity of the predicted proteins. Amplification of rat cDNA with a primer specific for the 3´ non-coding region of the CEP52 gene, in combination with a consensus primer for the 5´ end of the ubiquitin coding sequence, provided evidence that the rat CEP52 gene is fused to a ubiquitin reading frame. Direct sequence analysis of this PCR product confirmed the in-frame fusion of a ubiquitin coding sequence to the rat CEP52 gene. Antibodies against a synthetic CEP52 peptide were used to show that expressed CEP52 is associated with the 60 S ribosomal subunit, and that it is not linked to ubiquitin. The quantity of CEP52 found in different tissues is quite variable, but appears to correspond to the amount of ribosomes present. Although the human, Arabidopsis thaliana and Nicotiana tabacum CEP52 genes contain introns within the CEP52 coding region, the rat CEP52 coding sequence appears to lack insertions.



1996 ◽  
Vol 23 (6) ◽  
pp. 773 ◽  
Author(s):  
F Omann ◽  
H Tyson

A flax (Linum usitatissimum L.) peroxidase cDNA (FLXPER1) was isolated from a �gt10 library made from RNA derived from shoot tissue of the cultivar Stormont Cirrus, by screening with probes encoding amino termini of flax peroxidases. The probes were obtained by PCR amplification of the library with the �gt10 reverse primer 5'CTTATGAGTATTTCTTCCAGGGTA3' flanking the Eco RI cloning site, and a mixed oligonucleotide derived from the catalytic domain (HFHDCFV) found in all plant peroxidases. FLXPER1 is the second flax peroxidase to be so isolated and described, following the previously documented FLXPER2 (Omann et al. 1994, Genome 37, 137-147). These two cDNAs are the completely sequenced members of a family currently encompassing FLXPER1 to FLXPER4, all isolated from the same �gt10 library. FLXPER3 and 4 will be separately described and related to FLXPER1, 2. The FLXPER1 deduced amino acid sequence reveals a signal peptide of 27 amino acids, and an anionic mature protein with seven potential N-linked glycosylation sites in its 332 amino acids (38.25 kDa; pI 4.38). The FLXPER1 C terminus is similar to plant peroxidases with a putative C-terminal vacuolar targeting signal, but also contains amino acid motifs with striking homologies to the membrane anchoring motifs of a pea blue copper type protein correlated with lignin deposition. Northern blot analysis demonstrated its stem specific expression. Southern blots suggested one to five copies of FLXPER1 in the flax genome, compared with one to two for FLXPER2. FLXPER1 resembles cucumber, poplar and tobacco amino acid sequences; its asymmetry in codon usage coincides with that of other dicotyledon peroxidases, i.e. much lower than in monocotyledon peroxidases.



1994 ◽  
Vol 301 (2) ◽  
pp. 545-550 ◽  
Author(s):  
H Nakagawa ◽  
N Komorita ◽  
F Shibata ◽  
A Ikesue ◽  
K Konishi ◽  
...  

Four basic neutrophil chemotactic factors (chemokines) have been purified from conditioned medium of granulation tissue obtained from carrageenin-induced inflammation in the rat. On the basis of their N-terminal amino acid sequences, one of the chemokines was identical with rat GRO/cytokine-induced neutrophil chemoattractant (CINC) which we reported previously, and another was identical with rat macrophage inflammatory protein-2 (MIP-2). Two other chemokines were novel chemoattractants related to MIP-2. The novel chemokines are referred to as rat GRO/CINC-2 alpha and CINC-2 beta, and consequently CINC and rat MIP-2 are renamed rat GRO/CINC-1 and CINC-3 respectively. The complete amino acid sequences of purified CINC-2 alpha and CINC-3 were determined by analysis of the fragments isolated from proteinase V8-treated CINCs. The cDNA for CINC-2 beta was cloned by reverse transcription/PCR amplification using specific primers starting with total RNA extracted from lipopolysaccharide-stimulated rat macrophages. A comparison of the amino acid sequence encoded by the cDNA with the N-terminal amino acid sequence of purified CINC-2 beta revealed that mature CINC-2 beta is a 68-residue chemoattractant produced by cleavage of a 32-residue signal peptide. The difference in amino acid sequences between CINC-2 alpha and CINC-2 beta consisted of only three C-terminal residues. Rat GRO/CINC-2 alpha is a major chemokine, and the four purified chemokines have similar chemotactic activity, suggesting that they contribute to neutrophil infiltration into inflammatory sites in rats.



Genome ◽  
2007 ◽  
Vol 50 (6) ◽  
pp. 595-609 ◽  
Author(s):  
Chih-Li Wang ◽  
Arkadiusz Malkus ◽  
Sabina M. Zuzga ◽  
Pi-Fang Linda Chang ◽  
Barry M. Cunfer ◽  
...  

Phaeosphaeria species are important causal agents of Stagonospora leaf blotch diseases in cereals. In this study, the nucleotide sequence and deduced polypeptide of the trifunctional histidine biosynthesis gene (his) are used to investigate the phylogenetic relationships and provide molecular identification among cereal Phaeosphaeria species. The full-length sequences of the his gene were obtained by PCR amplification and compared among cereal Phaeosphaeria species. The coding sequence of the his gene in wheat-biotype P. nodorum (PN-w) was 2697 bp. The his genes in barley-biotype P. nodorum (PN-b), two P. avenaria f. sp. triticea isolates (homothallic Pat1 and Pat3), and Phaeosphaeria species from Polish rye and dallis grass were 2694 bp. The his gene in heterothallic isolate Pat2, however, was 2693 bp because the intron had one fewer base. In P. avenaria f. sp. avenaria (Paa), the his gene was only 2670 bp long. The differences in the size of the his gene contributed to the variation in amino acid sequences in the gap region located between the phosphoribosyl-ATP pyrophosphohydrolase and histidinol dehydrogenase sub-domains. Based on nucleotide and deduced amino acid sequences of the his gene, Pat1 was not closely related to either PN-w or the Paa clade. It appears that rates of evolution of the his gene were fast in cereal Phaeosphaeria species. The possible involvement of meiotic recombination in genetic diversity of the his gene in P. nodorum is discussed.



2021 ◽  
Vol 12 ◽  
Author(s):  
Júlia Halász ◽  
Anna Borbála Molnár ◽  
Gulce Ilhan ◽  
Sezai Ercisli ◽  
Attila Hegedűs

Cherry laurel (Prunus laurocerasus L.) is an extreme polyploid (2n = 22x) species of the Rosaceae family where gametophytic self-incompatibility (GSI) prevents inbreeding. This study was carried out to identify the S-ribonuclease alleles (S-RNases) of P. laurocerasus using PCR amplification of the first and second intron region of the S-RNase gene, cloning and sequencing. A total of 23 putative S-RNase alleles (S1–S20, S5m, S13m, and S18m) were sequenced from the second (C2) to the fifth conserved region (C5), and they shared significant homology to other Prunus S-RNases. The length of the sequenced amplicons ranged from 505 to 1,544 bp, and similar sizes prevented the proper discrimination of some alleles based on PCR analysis. We have found three putatively non-functional alleles (S5m, S18m, and S9) coding for truncated proteins. Although firm conclusions cannot be drawn, our data seem to support that heteroallelic pollen cannot induce self-compatibility in this polyploid Prunus species. The identities in the deduced amino acid sequences between the P. laurocerasus and other Prunus S-RNases ranged between 44 and 100%, without a discontinuity gap separating the identity percentages of trans-specific and more distantly related alleles. The phylogenetic position, the identities in nucleotide sequences of the second intron and in deduced amino acid sequences found one or more trans-specific alleles for all but S10, S14, S18, and S20 cherry laurel RNases. The analysis of mutational frequencies in trans-specific allele pairs indicated the region RC4–C5 accepts the most amino acid replacements and hence it may contribute to allele-specificity. Our results form the basis of future studies to confirm the existence and function of the GSI system in this extreme polyploid species and the alleles identified will be also useful for phylogenetic studies of Prunus S-RNases as the number of S-RNase sequences was limited in the Racemose group of Prunus (where P. laurocerasus belongs to).



2014 ◽  
Vol 8 (05) ◽  
pp. 570-580 ◽  
Author(s):  
Houssam A. Shaib ◽  
Nelly Cochet ◽  
Thierry Ribeiro ◽  
Afif M Abdel Nour ◽  
Georges Nemer ◽  
...  

Introduction: Avian influenza viruses of the H9N2 subtype have been reported to cause human infections. This study demonstrates the impact of nasal viral passaging of avian H9N2 in hamsters on its cross species-pathogenic adaptability and variability of amino acid sequences of the hemagglutinin (HA) and neuraminidase (NA) stalk. Methodology: Three intranasal passagings of avian H9N2 in hamsters P1, P2, and P3 were accomplished. Morbidity signs and lesions were observed three days post viral inoculation. The HA test was used for presumptive detection of H9N2 virus in the trachea and lungs of the hamsters challenged with the differently passaged viruses. Different primers were used for PCR amplification of the HA1 and NA stalk regions of the differently passaged H9N2 viruses, followed by sequence alignment. Results: The morbidity signs indicated low pathogenicity of the differently passaged H9N2 viruses in hamsters. The frequency of gross and microscopic lesions in the tracheas and lungs were insignificantly different among hamsters challenged with the differently passaged H9N2 viruses (p > 0.05). There was 100% similarity in the amino acid sequence of the HA gene of most passaged viruses. The amino acid sequence of the neuraminidase in the third passaged H9N2 virus recovered from lungs showed a R46P mutation that might have a role in the pathogenic adaptability of P3 viruses in hamsters’ lungs. Conclusions: The apparent adaptation of avian H9N2 virus to mammalian cells is in agreement with the World Health Organization’s alertness for a possible public health threat by this adaptable virus.





1995 ◽  
Vol 74 (04) ◽  
pp. 1079-1087 ◽  
Author(s):  
Klaus-P Radtke ◽  
José A Fernández ◽  
Bruno O Villoutreix ◽  
Judith S Greengard ◽  
John H Griffin

SummarycDNAs for protein C inhibitor (PCI) were cloned from human and rhesus monkey 1 liver RNAs by reverse transcription and polymerase chain reaction (PCR) amplification. Sequencing showed that rhesus monkey and human PCI cDNAs were 93% identical. Predicted amino acid sequences differed at 26 of 387 residues. Pour of these differences (T352M, N359S, R362K, L3631) were in the reactive center loop that is important for inhibitory specificity, and two were in the N-terminal helix (M8T, E13K) that is implicated in glycosaminoglycan binding. PCI in human or rhesus monkey plasma showed comparable inhibitory activity towards human activated protein C in the presence of 10 U/ml heparin. However, maximal acceleration of the inhibition of activated protein C required 5-fold lower heparin concentration for rhesus monkey than for human plasma, consistent with the interpretation that the additional positive charge (E13K) in a putative-heparin binding region increased the affinity for heparin.



1993 ◽  
Vol 69 (04) ◽  
pp. 351-360 ◽  
Author(s):  
Masahiro Murakawa ◽  
Takashi Okamura ◽  
Takumi Kamura ◽  
Tsunefumi Shibuya ◽  
Mine Harada ◽  
...  

SummaryThe partial amino acid sequences of fibrinogen Aα-chains from five mammalian species have been inferred by means of the polymerase chain reaction (PCR). From the genomic DNA of the rhesus monkey, pig, dog, mouse and Syrian hamster, the DNA fragments coding for α-C domains in the Aα-chains were amplified and sequenced. In all species examined, four cysteine residues were always conserved at the homologous positions. The carboxy- and amino-terminal portions of the α-C domains showed a considerable homology among the species. However, the sizes of the middle portions, which corresponded to the internal repeat structures, showed an apparent variability because of several insertions and/or deletions. In the rhesus monkey, pig, mouse and Syrian hamster, 13 amino acid tandem repeats fundamentally similar to those in humans and the rat were identified. In the dog, however, tandem repeats were found to consist of 18 amino acids, suggesting an independent multiplication of the canine repeats. The sites of the α-chain cross-linking acceptor and α2-plasmin inhibitor cross-linking donor were not always evolutionally conserved. The arginyl-glycyl-aspartic acid (RGD) sequence was not found in the amplified region of either the rhesus monkey or the pig. In the canine α-C domain, two RGD sequences were identified at the homologous positions to both rat and human RGD S. In the Syrian hamster, a single RGD sequence was found at the same position to that of the rat. Triplication of the RGD sequences was seen in the murine fibrinogen α-C domain around the homologous site to the rat RGDS sequence. These findings are of some interest from the point of view of structure-function and evolutionary relationships in the mammalian fibrinogen Aα-chains.



Sign in / Sign up

Export Citation Format

Share Document