Diversity of the trifunctional histidine biosynthesis gene (his) in cerealPhaeosphaeriaspecies

Genome ◽  
2007 ◽  
Vol 50 (6) ◽  
pp. 595-609 ◽  
Author(s):  
Chih-Li Wang ◽  
Arkadiusz Malkus ◽  
Sabina M. Zuzga ◽  
Pi-Fang Linda Chang ◽  
Barry M. Cunfer ◽  
...  
Keyword(s):  
Genetic Diversity ◽  
Amino Acid ◽  
Meiotic Recombination ◽  
Pcr Amplification ◽  
Amino Acid Sequences ◽  
Histidine Biosynthesis ◽  
Leaf Blotch ◽  
Rates Of Evolution ◽  
Biosynthesis Gene ◽  
Histidinol Dehydrogenase

Phaeosphaeria species are important causal agents of Stagonospora leaf blotch diseases in cereals. In this study, the nucleotide sequence and deduced polypeptide of the trifunctional histidine biosynthesis gene (his) are used to investigate the phylogenetic relationships and provide molecular identification among cereal Phaeosphaeria species. The full-length sequences of the his gene were obtained by PCR amplification and compared among cereal Phaeosphaeria species. The coding sequence of the his gene in wheat-biotype P. nodorum (PN-w) was 2697 bp. The his genes in barley-biotype P. nodorum (PN-b), two P. avenaria f. sp. triticea isolates (homothallic Pat1 and Pat3), and Phaeosphaeria species from Polish rye and dallis grass were 2694 bp. The his gene in heterothallic isolate Pat2, however, was 2693 bp because the intron had one fewer base. In P. avenaria f. sp. avenaria (Paa), the his gene was only 2670 bp long. The differences in the size of the his gene contributed to the variation in amino acid sequences in the gap region located between the phosphoribosyl-ATP pyrophosphohydrolase and histidinol dehydrogenase sub-domains. Based on nucleotide and deduced amino acid sequences of the his gene, Pat1 was not closely related to either PN-w or the Paa clade. It appears that rates of evolution of the his gene were fast in cereal Phaeosphaeria species. The possible involvement of meiotic recombination in genetic diversity of the his gene in P. nodorum is discussed.

scholarly journals Genetic Diversity Among Geminiviruses Associated with the Weed Species Sida spp., Macroptilium lathyroides, and Wissadula amplissima from Jamaica

Plant Disease ◽  
1997 ◽  
Vol 81 (11) ◽  
pp. 1251-1258 ◽  
Author(s):  
Marcia E. Roye ◽  
Wayne A. McLaughlin ◽  
Medhat K. Nakhla ◽  
Douglas P. Maxwell
Keyword(s):  
Genetic Diversity ◽  
Amino Acid ◽  
Mosaic Virus ◽  
Amino Acid Sequences ◽  
Yellow Mosaic Virus ◽  
Weed Species ◽  
Degenerate Primers ◽  
Sequence Comparisons ◽  
The Common ◽  
Macroptilium Lathyroides

Genetic diversity among geminiviruses associated with three common weeds in Jamaica was studied using digoxigenin-labeled geminiviral DNA probes, polymerase chain reaction with degenerate primers for DNA-A and DNA-B, nucleic acid sequencing, and derived amino acid sequences. Geminiviruses with bipartite genomes were found in Sida spp., Macroptilium lathyroides, and Wissadula amplissima. The geminiviruses detected in Sida spp. and M. lathyroides were nearly identical and were both designated Sida golden mosaic geminivirus (SidGMV-JA), whereas the geminivirus in W. amplissima was sufficiently different to be designated Wissadula golden mosaic geminivirus (WGMV). Nucleotide sequence comparisons of the common regions and the N-terminal regions of the AC1 (rep) and AV1 ORFs, together with the derived amino acid sequence comparisons of the N-terminal parts of BC1 and BV1 ORFs were used to determine their similarities to other geminiviruses. SidGMV-JA was most similar to potato yellow mosaic geminivirus (PYMV). We propose that these two geminiviruses (SidGMV-JA and PYMV) define a new geminivirus cluster, the potato yellow mosaic virus (PYMV) cluster. WGMV was most similar to members of the Abutilon mosaic virus cluster but is not likely to be included in the Abutilon phylogenetic group because of the divergent sequence of the common region. These results indicate that geminiviruses infecting some weeds in Jamaica are distinct from crop-infecting geminiviruses in Jamaica and define a new geminivirus cluster.

scholarly journals Cloning and Comparison of fliC Genes and Identification of Glycosylation in the Flagellin ofPseudomonas aeruginosa a-Type Strains

1998 ◽  
Vol 180 (12) ◽  
pp. 3209-3217 ◽  
Author(s):  
Cynthia D. Brimer ◽  
T. C. Montie
Keyword(s):  
Molecular Weight ◽  
Monoclonal Antibody ◽  
Pseudomonas Aeruginosa ◽  
Amino Acid ◽  
Type Strain ◽  
Polyacrylamide Gel Electrophoresis ◽  
Sodium Dodecyl ◽  
Pcr Amplification ◽  
Amino Acid Sequences ◽  
Type Strains

ABSTRACT Pseudomonas aeruginosa a-type strains produce flagellin proteins which vary in molecular weight between strains. To compare the properties of a-type flagellins, the flagellin genes of severalPseudomonas aeruginosa a-type strains, as determined by interaction with specific anti-a monoclonal antibody, were cloned and sequenced. PCR amplification of the a-type flagellin gene fragments from five strains each yielded a 1.02-kb product, indicating that the gene size is not likely to be responsible for the observed molecular weight differences among the a-type strains. The flagellin amino acid sequences of several a-type strains (170018, 5933, 5939, and PAK) were compared, and that of 170018 was compared with that of PAO1, a b-type strain. The former comparisons revealed that a-type strains are similar in amino acid sequence, while the latter comparison revealed differences between 170018 and PAO1. Posttranslational modification was explored for its contribution to the observed differences in molecular weight among the a-type strains. A biotin-hydrazide glycosylation assay was performed on the flagellins of three a-type strains (170018, 5933, and 5939) and one b-type strain (M2), revealing a positive glycosylation reaction for strains 5933 and 5939 and a negative reaction for 170018 and M2. Deglycosylation of the flagellin proteins with trifluoromethanesulfonic acid (TFMS) confirmed the glycosylation results. A molecular weight shift was observed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis for the TFMS-treated flagellins of 5933 and 5939. These results indicate that the molecular weight discrepancies observed for the a-type flagellins can be attributed, at least in part, to glycosylation of the protein. Anti-a flagellin monoclonal antibody reacted with the TFMS-treated flagellins, suggesting that the glycosyl groups are not a necessary component of the epitope for the human anti-a monoclonal antibody. Comparisons between a-type sequences and a b-type sequence (PAO1) will aid in delineation of the epitope for this monoclonal antibody.

The Study of Plant Phylogeny Using Amino Acid Sequences of Ribulose-1,5-Bisphosphate Carboxylase. IV. Proteaceae and Fagaceae and the Rate of Evolution of the Small Subunit

1984 ◽  
Vol 32 (3) ◽  
pp. 291 ◽  
Author(s):  
PG Martin ◽  
JM Dowd
Keyword(s):  
Amino Acid ◽  
Plate Tectonics ◽  
Phylogenetic Trees ◽  
Small Subunit ◽  
Amino Acid Sequences ◽  
Ribulose Bisphosphate Carboxylase ◽  
Bisphosphate Carboxylase ◽  
Plant Phylogeny ◽  
Rates Of Evolution ◽  
Molecular Evolutionary Clock

N-terminal, 40 amino acid sequences of ribulose bisphosphate carboxylase small subunit (SSU) are given for four species of Proteaceae, six of Fagaceae including four from Nothofagus, and seven from Solanaceae including six new sequences from Nicotiana. Phylogenetic trees, regarded as tentative since only one protein is involved, are given for each of the three groups and approximate positions of the families in the angiosperm tree are indicated. An example of the destabilizing of a hitherto invariant site is given. Working from the 'molecular evolutionary clock' hypothesis, and deriving time from plate tectonics, the data from both Proteaceae and Nothofagus lead to rates of evolution of SSU of one non-silent nucleotide substitution per 9 My. This agrees with an early Cretaceous origin of the angiosperms. A test is proposed to distinguish distributions that are the result of 'vicariance biogeography' from those due to 'dispersal biogeography'. It is concluded that distribution of Nicotiana is most likely due to dispersal.

An Anionic, Stem-Specific Flax Peroxidase cDNA With C-Terminal Motifs Also Found in a Blue Copper-Type Pea Protein Correlated With Lignin Deposition

1996 ◽  
Vol 23 (6) ◽  
pp. 773 ◽  
Author(s):  
F Omann ◽  
H Tyson
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Catalytic Domain ◽  
Pcr Amplification ◽  
Amino Acid Sequences ◽  
Specific Expression ◽  
Blue Copper ◽  
Linum Usitatissimum L ◽  
Plant Peroxidases ◽  
Lignin Deposition

A flax (Linum usitatissimum L.) peroxidase cDNA (FLXPER1) was isolated from a �gt10 library made from RNA derived from shoot tissue of the cultivar Stormont Cirrus, by screening with probes encoding amino termini of flax peroxidases. The probes were obtained by PCR amplification of the library with the �gt10 reverse primer 5'CTTATGAGTATTTCTTCCAGGGTA3' flanking the Eco RI cloning site, and a mixed oligonucleotide derived from the catalytic domain (HFHDCFV) found in all plant peroxidases. FLXPER1 is the second flax peroxidase to be so isolated and described, following the previously documented FLXPER2 (Omann et al. 1994, Genome 37, 137-147). These two cDNAs are the completely sequenced members of a family currently encompassing FLXPER1 to FLXPER4, all isolated from the same �gt10 library. FLXPER3 and 4 will be separately described and related to FLXPER1, 2. The FLXPER1 deduced amino acid sequence reveals a signal peptide of 27 amino acids, and an anionic mature protein with seven potential N-linked glycosylation sites in its 332 amino acids (38.25 kDa; pI 4.38). The FLXPER1 C terminus is similar to plant peroxidases with a putative C-terminal vacuolar targeting signal, but also contains amino acid motifs with striking homologies to the membrane anchoring motifs of a pea blue copper type protein correlated with lignin deposition. Northern blot analysis demonstrated its stem specific expression. Southern blots suggested one to five copies of FLXPER1 in the flax genome, compared with one to two for FLXPER2. FLXPER1 resembles cucumber, poplar and tobacco amino acid sequences; its asymmetry in codon usage coincides with that of other dicotyledon peroxidases, i.e. much lower than in monocotyledon peroxidases.

scholarly journals Identification of cytokine-induced neutrophil chemoattractants (CINC), rat GRO/CINC-2α and CINC-2 β, produced by granulation tissue in culture: purification, complete amino acid sequences and characterization

1994 ◽  
Vol 301 (2) ◽  
pp. 545-550 ◽  
Author(s):  
H Nakagawa ◽  
N Komorita ◽  
F Shibata ◽  
A Ikesue ◽  
K Konishi ◽  
...  
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Granulation Tissue ◽  
Pcr Amplification ◽  
Neutrophil Infiltration ◽  
Amino Acid Sequences ◽  
Terminal Amino Acid ◽  
Reverse Transcription Pcr ◽  
Terminal Amino ◽  
The Difference

Four basic neutrophil chemotactic factors (chemokines) have been purified from conditioned medium of granulation tissue obtained from carrageenin-induced inflammation in the rat. On the basis of their N-terminal amino acid sequences, one of the chemokines was identical with rat GRO/cytokine-induced neutrophil chemoattractant (CINC) which we reported previously, and another was identical with rat macrophage inflammatory protein-2 (MIP-2). Two other chemokines were novel chemoattractants related to MIP-2. The novel chemokines are referred to as rat GRO/CINC-2 alpha and CINC-2 beta, and consequently CINC and rat MIP-2 are renamed rat GRO/CINC-1 and CINC-3 respectively. The complete amino acid sequences of purified CINC-2 alpha and CINC-3 were determined by analysis of the fragments isolated from proteinase V8-treated CINCs. The cDNA for CINC-2 beta was cloned by reverse transcription/PCR amplification using specific primers starting with total RNA extracted from lipopolysaccharide-stimulated rat macrophages. A comparison of the amino acid sequence encoded by the cDNA with the N-terminal amino acid sequence of purified CINC-2 beta revealed that mature CINC-2 beta is a 68-residue chemoattractant produced by cleavage of a 32-residue signal peptide. The difference in amino acid sequences between CINC-2 alpha and CINC-2 beta consisted of only three C-terminal residues. Rat GRO/CINC-2 alpha is a major chemokine, and the four purified chemokines have similar chemotactic activity, suggesting that they contribute to neutrophil infiltration into inflammatory sites in rats.

Genetic Diversity of HPV-16E6,E7, andL1Genes in Women With Cervical Lesions in Liaoning Province, China

2011 ◽  
Vol 21 (3) ◽  
pp. 551-558 ◽  
Author(s):  
Zhengrong Sun ◽  
Gaowei Ren ◽  
Xin Cui ◽  
Weiqiang Zhou ◽  
Chao Liu ◽  
...  
Keyword(s):  
Genetic Diversity ◽  
Amino Acid ◽  
Biological Effects ◽  
Northern China ◽  
Amino Acid Sequences ◽  
Human Papillomaviruses ◽  
Liaoning Province ◽  
Cervical Lesions ◽  
Hpv 16 ◽  
Oncogenic Potential

IntroductionHigh-risk human papillomaviruses (HPVs) play a cardinal role in the etiology of cervical cancer. The most prevalent type, HPV-16, shows intratypic sequence variants that are known to differ in oncogenic potential and geographic distribution. Intratype variations in oncogenic E6/E7 and capsid L1 proteins of HPV-16 are associated with risk of viral persistence and progression.MethodsThis study was designed to analyze sequence variations inE6,E7, andL1genes of HPV-16 in patients with cervical lesion to identify the most prevalent and novel HPV-16 variants in northern China.ResultsOur results showed that HPV-16 variants with respect to E6 and E7 were high prevalence of the Asian lineage: 48.3% and 51.4%, respectively. Sequences of theE6gene revealed 4 amino acid changes of variants D25E and L83V, with 48.3% (69/143) and 11.2% (16/143), respectively, and variants H78Y and E113D in this study. The results also showed the prevalence of 4 hot spots of E7 nucleotide variations leading to N29H, N29S, and 2 silent variations, nucleotide G666A and nucleotide T846C, with 4.2% (6/142), 43% (61/142), 32.4% (46/142), and 43% (61/142), respectively. The following L1 variations were found in this study: L103F, P104K, P104Y, P104S, D105G, P106S, N108P, F109V, C172S, H228D, and T292A. It was also found that 448S was inserted and 465D was deleted in the L1 amino acid sequences of all the samples. No significant relationship between HPV-16 variants and high-grade lesions was found.ConclusionsThe study provides some new data on the genetic diversity of HPV-16, which may help to understand the oncogenic potential of the virus and design the diagnosis reagents and vaccine of HPV in China. Furthermore, in-depth studies are needed to determine the clinical and biological effects of these variants.

scholarly journals The random character of protein evolution and its effects on the reliability of phylogenetic information deduced from amino acid sequences and compositions

1980 ◽  
Vol 191 (2) ◽  
pp. 349-354 ◽  
Author(s):  
A Cornish-Bowden
Keyword(s):  
Amino Acid ◽  
Amino Acid Composition ◽  
Acid Composition ◽  
Random Effect ◽  
Cross Reactivity ◽  
Amino Acid Sequences ◽  
Random Errors ◽  
Phylogenetic Information ◽  
Rates Of Evolution ◽  
Related Pair

Because evolution occurs by random events, the actual number of substitutions that occur in any period is not exactly equal to the number expected from the mean rate of substitution, but is statistically distributed about it. In consequence, even if rates of evolution are constant in different lineages, ‘trees’ deduced from descendant protein sequences contain random errors. When there are fewer than about eight differences between the sequences of the most distantly related pair from a set of proteins, this random effect is very large. It can then render trivial the statistical disadvantage inherent in using a crude measure of protein difference, such as amino acid composition or immunological cross-reactivity, in preference to a measure based the sequences of the most distantly related pair from a set of proteins, this random effect is very large. It can then render trivial the statistical disadvantage inherent in using a crude measure of protein difference, such as amino acid composition or immunological cross-reactivity, in preference to a measure based the sequences of the most distantly related pair from a set of proteins, this random effect is very large. It can then render trivial the statistical disadvantage inherent in using a crude measure of protein difference, such as amino acid composition or immunological cross-reactivity, in preference to a measure based on amino acid sequence. In some cases, such as classification of mammals on the basis of cytochrome c structure, it appears to make little difference to the reliability of the results whether the sequences of the protein concerned are known or not. It may also be possible to obtain more reliable phylogenetic information from composition measurements on several kinds of protein than one could obtain from sequence measurements on a single kind of protein.

scholarly journals Identification and Molecular Analysis of Putative Self-Incompatibility Ribonuclease Alleles in an Extreme Polyploid Species, Prunus laurocerasus L.

2021 ◽  
Vol 12 ◽  
Author(s):  
Júlia Halász ◽  
Anna Borbála Molnár ◽  
Gulce Ilhan ◽  
Sezai Ercisli ◽  
Attila Hegedűs
Keyword(s):  
Amino Acid ◽  
Pcr Amplification ◽  
Amino Acid Sequences ◽  
Phylogenetic Position ◽  
Pcr Analysis ◽  
Self Incompatibility ◽  
Polyploid Species ◽  
Specific Allele ◽  
Cherry Laurel ◽  
Prunus Laurocerasus

Cherry laurel (Prunus laurocerasus L.) is an extreme polyploid (2n = 22x) species of the Rosaceae family where gametophytic self-incompatibility (GSI) prevents inbreeding. This study was carried out to identify the S-ribonuclease alleles (S-RNases) of P. laurocerasus using PCR amplification of the first and second intron region of the S-RNase gene, cloning and sequencing. A total of 23 putative S-RNase alleles (S1–S20, S5m, S13m, and S18m) were sequenced from the second (C2) to the fifth conserved region (C5), and they shared significant homology to other Prunus S-RNases. The length of the sequenced amplicons ranged from 505 to 1,544 bp, and similar sizes prevented the proper discrimination of some alleles based on PCR analysis. We have found three putatively non-functional alleles (S5m, S18m, and S9) coding for truncated proteins. Although firm conclusions cannot be drawn, our data seem to support that heteroallelic pollen cannot induce self-compatibility in this polyploid Prunus species. The identities in the deduced amino acid sequences between the P. laurocerasus and other Prunus S-RNases ranged between 44 and 100%, without a discontinuity gap separating the identity percentages of trans-specific and more distantly related alleles. The phylogenetic position, the identities in nucleotide sequences of the second intron and in deduced amino acid sequences found one or more trans-specific alleles for all but S10, S14, S18, and S20 cherry laurel RNases. The analysis of mutational frequencies in trans-specific allele pairs indicated the region RC4–C5 accepts the most amino acid replacements and hence it may contribute to allele-specificity. Our results form the basis of future studies to confirm the existence and function of the GSI system in this extreme polyploid species and the alleles identified will be also useful for phylogenetic studies of Prunus S-RNases as the number of S-RNase sequences was limited in the Racemose group of Prunus (where P. laurocerasus belongs to).

scholarly journals Phylogeny of North American Powassan virus

2001 ◽  
Vol 82 (7) ◽  
pp. 1657-1665 ◽  
Author(s):  
Gregory D. Ebel ◽  
Andrew Spielman ◽  
Sam R. Telford
Keyword(s):  
Genetic Diversity ◽  
New York ◽  
Amino Acid ◽  
North America ◽  
Adaptive Evolution ◽  
Envelope Protein ◽  
Amino Acid Sequences ◽  
Ixodid Ticks ◽  
Genetic Lineages ◽  
Powassan Virus

To determine whether Powassan virus (POW) and deer tick virus (DTV) constitute distinct flaviviral populations transmitted by ixodid ticks in North America, we analysed diverse nucleotide sequences from 16 strains of these viruses. Two distinct genetic lineages are evident, which may be defined by geographical and host associations. The nucleotide and amino acid sequences of lineage one (comprising New York and Canadian POW isolates) are highly conserved across time and space, but those of lineage two (comprising isolates from deer ticks and a fox) are more variable. The divergence between lineages is much greater than the variation within either lineage, and lineage two appears to be more diverse genetically than is lineage one. Application of McDonald–Kreitman tests to the sequences of these strains indicates that adaptive evolution of the envelope protein separates lineage one from lineage two. The two POW lineages circulating in North America possess a pattern of genetic diversity suggesting that they comprise distinct subtypes that may perpetuate in separate enzootic cycles.

Sign in / Sign up

Export Citation Format

Share Document