scholarly journals Developing a Low-Cost, Simple-to-Use Electrochemical Sensor for the Detection of Circulating Tumour DNA in Human Fluids

Biosensors ◽  
2020 ◽  
Vol 10 (11) ◽  
pp. 156
Author(s):  
Bukola Attoye ◽  
Chantevy Pou ◽  
Ewen Blair ◽  
Christopher Rinaldi ◽  
Fiona Thomson ◽  
...  
Keyword(s):  
Point Of Care ◽  
Low Cost ◽  
Dna Amplification ◽  
Response To Therapy ◽  
Clinical Samples ◽  
Wild Type ◽  
Point Of Care Test ◽  
Improved Outcomes ◽  
Circulating Tumour Dna ◽  
Amplification Reaction

It is well-known that two major issues, preventing improved outcomes from cancer are late diagnosis and the evolution of drug resistance during chemotherapy, therefore technologies that address these issues can have a transformative effect on healthcare workflows. In this work we present a simple, low-cost DNA biosensor that was developed specifically to detect mutations in a key oncogene (KRAS). The sensor employed was a screen-printed array of carbon electrodes, used to perform parallel measurements of DNA hybridisation. A DNA amplification reaction was developed with primers for mutant and wild type KRAS sequences which amplified target sequences from representative clinical samples to detectable levels in as few as twenty cycles. High levels of sensitivity were demonstrated alongside a clear exemplar of assay specificity by showing the mutant KRAS sequence was detectable against a significant background of wild type DNA following amplification and hybridisation on the sensor surface. The time to result was found to be 3.5 h with considerable potential for optimisation through assay integration. This quick and versatile biosensor has the potential to be deployed in a low-cost, point-of-care test where patients can be screened either for early diagnosis purposes or monitoring of response to therapy.

scholarly journals Highly performing point-of-care molecular testing for SARS-CoV-2 with RNA extraction and isothermal amplification.

2020 ◽  
Author(s):  
Pierre Garneret ◽  
Etienne Coz ◽  
Elian Martin ◽  
Jean-Claude Manuguerra ◽  
Elodie Brient-Litzler ◽  
...  
Keyword(s):  
Point Of Care ◽  
Low Cost ◽  
Rna Extraction ◽  
Dna Amplification ◽  
Developed Countries ◽  
Temperature Cycling ◽  
Isothermal Amplification ◽  
Nucleic Acid Amplification ◽  
Clinical Samples ◽  
Molecular Testing

In order to respond to the urgent request of massive testing, developed countries perform nucleic acid amplification tests (NAAT) of SARS-CoV-2 in centralized laboratories. Real-time RT - PCR (Reverse transcription - Polymerase Chain Reaction) is used to amplify the viral RNA and enable its detection. Although PCR is 37 years old, it is still considered, without dispute, as the gold standard. PCR is an efficient process, but the complex engineering required for automated RNA extraction and temperature cycling makes it incompatible for use in point of care settings. In the present work, by harnessing progress made in the past two decades in DNA amplification, microfluidics and membrane technologies, we succeeded to create a portable test, in which SARS-CoV-2 RNA is extracted, amplified isothermally by RT - LAMP (Loop-mediated Isothermal Amplification), and detected using intercalating dyes or highly fluorescent probes. Depending on the viral load, the detection takes between twenty minutes and one hour. Using pools of naso-pharyngal clinical samples, we estimated a sensitivity comparable to RT-qPCR (up to a Cycle threshold of 39, equivalent to <0.1 TCID50 per mL) and a 100% specificity, for other human coronaviruses and eight respiratory viruses currently circulating in Europe. We designed and fabricated an easy-to-use portable device called COVIDISC to carry out the test at the point of care. The low cost of the materials along with the absence of complex equipment paves the way towards a large dissemination of this device. The perspective of a reliable SARS-CoV-2 point of care detection, highly performing, that would deliver on-site results in less than one hour opens up a new efficient approach to manage the pandemics.

scholarly journals Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Tahmineh Jalali ◽  
Mostafa Salehi-Vaziri ◽  
Mohammad Hassan Pouriayevali ◽  
Seyed Latif Mousavi Gargari
Keyword(s):  
Point Of Care ◽  
Hemorrhagic Fever ◽  
Diagnostic Methods ◽  
Clinical Samples ◽  
Crimean Congo Hemorrhagic Fever ◽  
Point Of Care Test ◽  
Specificity And Sensitivity ◽  
Rural And Remote Areas ◽  
Cchf Virus ◽  
Exponential Enrichment

AbstractCrimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

scholarly journals A haemagglutination test for rapid detection of antibodies to SARS-CoV-2

2020 ◽  
Author(s):  
Alain Townsend ◽  
Pramila Rijal ◽  
Julie Xiao ◽  
Tiong Kit Tan ◽  
Kuan-Ying A Huang ◽  
...  
Keyword(s):  
High Performance ◽  
Point Of Care ◽  
Low Cost ◽  
Glycophorin A ◽  
Red Cell ◽  
Special Equipment ◽  
Cell Agglutination ◽  
Haemagglutination Test ◽  
Point Of Care Test ◽  
Laboratory Facilities

ABSTRACTSerological detection of antibodies to SARS-CoV-2 is essential for establishing rates of seroconversion in populations, detection of seroconversion after vaccination, and for seeking evidence for a level of antibody that may be protective against COVID-19 disease. Several high-performance commercial tests have been described, but these require centralised laboratory facilities that are comparatively expensive, and therefore not available universally. Red cell agglutination tests have a long history in blood typing, and general serology through linkage of reporter molecules to the red cell surface. They do not require special equipment, are read by eye, have short development times, low cost and can be applied as a Point of Care Test (POCT). We describe a red cell agglutination test for the detection of antibodies to the SARS-CoV-2 receptor binding domain (RBD). We show that the Haemagglutination Test (“HAT”) has a sensitivity of 90% and specificity of 99% for detection of antibodies after a PCR diagnosed infection. The HAT can be titrated, detects rising titres in the first five days of hospital admission, correlates well with a commercial test that detects antibodies to the RBD, and can be applied as a point of care test. The developing reagent is composed of a previously described nanobody to a conserved glycophorin A epitope on red cells, linked to the RBD from SARS-CoV-2. It can be lyophilised for ease of shipping. We have scaled up production of this reagent to one gram, which is sufficient for ten million tests, at a cost of ∼0.27 UK pence per test well. Aliquots of this reagent are ready to be supplied to qualified groups anywhere in the world that need to detect antibodies to SARS-CoV-2, but do not have the facilities for high throughput commercial tests.

scholarly journals AnemoCheck-LRS: an optimized, color-based point-of-care test to identify severe anemia in limited-resource settings

BMC Medicine ◽  
2020 ◽  
Vol 18 (1) ◽  
Author(s):  
Marina S. Perez-Plazola ◽  
Erika A. Tyburski ◽  
Luke R. Smart ◽  
Thad A. Howard ◽  
Amanda Pfeiffer ◽  
...  
Keyword(s):  
Screening Tool ◽  
Point Of Care ◽  
Low Cost ◽  
Limited Resource ◽  
Absolute Difference ◽  
Severe Anemia ◽  
Detection Range ◽  
Point Of Care Test ◽  
Colour Scale ◽  
Life Saving

Abstract Background Severe anemia is common and frequently fatal for hospitalized patients in limited-resource settings. Lack of access to low-cost, accurate, and rapid diagnosis of anemia impedes the delivery of life-saving care and appropriate use of the limited blood supply. The WHO Haemoglobin Colour Scale (HCS) is a simple low-cost test but frequently inaccurate. AnemoCheck-LRS (limited-resource settings) is a rapid, inexpensive, color-based point-of-care (POC) test optimized to diagnose severe anemia. Methods Deidentified whole blood samples were diluted with plasma to create variable hemoglobin (Hb) concentrations, with most in the severe (≤ 7 g/dL) or profound (≤ 5 g/dL) anemia range. Each sample was tested with AnemoCheck-LRS and WHO HCS independently by three readers and compared to Hb measured by an electronic POC test (HemoCue 201+) and commercial hematology analyzer. Results For 570 evaluations within the limits of detection of AnemoCheck-LRS (Hb ≤ 8 g/dL), the average difference between AnemoCheck-LRS and measured Hb was 0.5 ± 0.4 g/dL. In contrast, the WHO HCS overestimated Hb with an absolute difference of 4.9 ± 1.3 g/dL for samples within its detection range (Hb 4–14 g/dL, n = 405). AnemoCheck-LRS was much more sensitive (92%) for the diagnosis of profound anemia than WHO HCS (22%). Conclusions AnemoCheck-LRS is a rapid, inexpensive, and accurate POC test for anemia. AnemoCheck-LRS is more accurate than WHO HCS for detection of low Hb levels, severe anemia that may require blood transfusion. AnemoCheck-LRS should be tested prospectively in limited-resource settings where severe anemia is common, to determine its utility as a screening tool to identify patients who may require transfusion.

scholarly journals Electrochemical DNA Detection Methods to Measure Circulating Tumour DNA for Enhanced Diagnosis and Monitoring of Cancer

Proceedings ◽  
2020 ◽  
Vol 60 (1) ◽  
pp. 15
Author(s):  
Bukola Attoye ◽  
Matthew Baker ◽  
Chantevy Pou ◽  
Fiona Thomson ◽  
Damion K. Corrigan
Keyword(s):  
Point Of Care ◽  
Low Cost ◽  
Detection Methods ◽  
Clinical Samples ◽  
Label Free ◽  
Ambient Conditions ◽  
Liquid Biopsies ◽  
Current Time ◽  
Electrochemical Approach ◽  
Label Free Detection

Liquid biopsies are becoming increasingly important as a potential replacement for existing biopsy procedures which can be invasive, painful and compromised by tumour heterogeneity. This paper reports a simple electrochemical approach tailored towards point-of-care cancer detection and treatment monitoring from biofluids using a label-free detection strategy. The mutations under test were the KRAS G12D and G13D mutations, which are both important in the development and progression of many human cancers and which have a presence that correlates with poor outcomes. These common circulating tumour markers were investigated in clinical samples and amplified by standard and specialist PCR methodologies for subsequent electrochemical detection. Following pre-treatment of the sensor to present a clean surface, DNA probes developed specifically for detection of the KRAS G12D and G13D mutations were immobilized onto low-cost carbon electrodes using diazonium chemistry and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride/N-hydroxysuccinimide coupling. Following the functionalisation of the sensor, it was possible to sensitively and specifically detect a mutant KRAS G13D PCR product against a background of wild-type KRAS DNA from the representative cancer sample. Our findings give rise to the basis of a simple and very low-cost system for measuring ctDNA biomarkers in patient samples. The current time to result of the system was 3.5 h with considerable scope for optimisation, and it already compares favourably to the UK National Health Service biopsy service where patients can wait weeks for their result. This paper reports the technical developments we made in the production of consistent carbon surfaces for functionalisation, assay performance data for KRAS G13D and detection of PCR amplicons under ambient conditions.

scholarly journals System Architecture for IIoT-Based POC Molecular Diagnostic Device

2021 ◽  
Vol 6 (1) ◽  
pp. 60
Author(s):  
Byeong-Heon Kil ◽  
Ji-Seong Park ◽  
Chan-Young Park ◽  
Yu-Seop Kim ◽  
Jong-Dae Kim
Keyword(s):  
Point Of Care ◽  
Low Cost ◽  
Diagnostic System ◽  
Pcr Amplification ◽  
Dna Amplification ◽  
System Structure ◽  
World Health ◽  
Molecular Diagnostic ◽  
Target System ◽  
Open Platform

In this paper, we investigate an efficient structure for a point-of-care (POC) molecular diagnostic system based on the industrial Internet of things (IIoT). The target system can perform automated molecular diagnosis including DNA extraction, PCR amplification, and fluorescence detection. Samples and reagents are placed in a multi-room cartridge and loaded into the system. A rotating motor and a syringe motor control the cartridge to extract DNA from the sample. The extracted DNA is transferred to a polymerase chain reaction (PCR) chamber for DNA amplification and detection. The proposed system provides multiplexing of up to four colors. For POC molecular diagnostics, the World Health Organization demands features such as low volume, low cost, fast results, and a user-friendly interface. In this paper, we propose a system structure that can satisfy these requirements by using a PCR chip and open platform. A distributed structure is adopted for the convenience of maintenance, and a web-based GUI is adopted for the user’s convenience. We also investigated communication problems that may occur between system components. Using the proposed structure, the user can conveniently control from standard computing devices including a smartphone.

scholarly journals Toward point-of-care diagnostics of Candida auris

2020 ◽  
Author(s):  
Geoffrey Mulberry ◽  
Sudha Chaturvedi ◽  
Vishnu Chaturvedi ◽  
Brian N. Kim
Keyword(s):  
New York ◽  
Real Time ◽  
Real Time Pcr ◽  
Positive Impact ◽  
Point Of Care ◽  
Low Cost ◽  
High Sensitivity ◽  
Clinical Samples ◽  
Pcr Assay ◽  
Candida Auris

AbstractCandida auris is a multidrug-resistant yeast that presents global health threat for the hospitalized patients. Early diagnostic of C. auris is crucial in control, prevention, and treatment. Candida auris is difficult to identify with standard laboratory methods and often can be misidentified leading to inappropriate management. A newly-devised real-time PCR assay played an important role in the ongoing investigation of the C. auris outbreak in New York metropolitan area. The assay can rapidly detect C. auris DNA in surveillance and clinical samples with high sensitivity and specificity, and also useful for confirmation of C. auris cultures. Despite its positive impact, the real-time PCR assay is difficult to deploy at frontline laboratories due to high-complexity set-up and operation. Using a low-cost handheld real-time PCR device, we show that the C. auris can potentially be identified in a low-complexity assay without the need for high-cost equipment. An implementation of low-cost real-time PCR device in hospitals and healthcare facilities is likely to accelerate the diagnosis of C. auris and for control of the global epidemic.

scholarly journals Application of the amplification-free SERS-based CRISPR/Cas12a platform in the identification of SARS-CoV-2 from clinical samples

2021 ◽  
Vol 19 (1) ◽  
Author(s):  
Jiajie Liang ◽  
Peijun Teng ◽  
Wei Xiao ◽  
Guanbo He ◽  
Qifang Song ◽  
...  
Keyword(s):  
Nucleic Acids ◽  
Point Of Care ◽  
Clinical Samples ◽  
Nasopharyngeal Swab ◽  
Enhancement Effect ◽  
Diagnostic Assays ◽  
Point Of Care Test ◽  
Raman Enhancement ◽  
Potential Strategy ◽  
Refractory Diseases

AbstractThe control of contagious or refractory diseases requires early, rapid diagnostic assays that are simple, fast, and easy-to-use. Here, easy-to-implement CRISPR/Cas12a-based diagnostic platform through Raman transducer generated by Raman enhancement effect, term as SERS-CRISPR (S-CRISPR), are described. The S-CRISPR uses high-activity noble metallic nanoscopic materials to increase the sensitivity in the detection of nucleic acids, without amplification. This amplification-free platform, which can be performed within 30–40 min of incubation time, is then used for detection of SARS-CoV-2 derived nucleic acids in RNA extracts obtained from nasopharyngeal swab specimens (n  =  112). Compared with the quantitative reverse transcription polymerase chain reaction (RT-qPCR), the sensitivity and specificity of S-CRISPR reaches 87.50% and 100%, respectively. In general, the S-CRISPR can rapidly identify the RNA of SARS-CoV-2 RNA without amplification and is a potential strategy for nucleic acid point of care test (POCT).

scholarly journals COVD-29. CONTINUATION OF TEMOZOLOMIDE CHEMOTHERAPY IN A GLIOBLASTOMA PATIENT AFTER RESOLUTION OF COVID-19 PNEUMONIA

2020 ◽  
Vol 22 (Supplement_2) ◽  
pp. ii26-ii27
Author(s):  
Jigisha Thakkar ◽  
Michael Teitcher ◽  
Douglas Anderson ◽  
Kevin Barton ◽  
Edward Melain
Keyword(s):  
Pulmonary Infection ◽  
Point Of Care ◽  
Absolute Lymphocyte Count ◽  
Wild Type ◽  
Active Infection ◽  
Point Of Care Test ◽  
Adjuvant Temozolomide ◽  
Size Contrast ◽  
The Brain ◽  
Radiographic Improvement

Abstract We present a case of a 33 year-old patient with glioblastoma (IDH wild type, MGMT unmethylated) who was diagnosed with COVID-19 pneumonia while undergoing chemotherapy. The patient did not have any medical comorbidities. He was clinically asymptomatic following surgery, completed concurrent phase of combined chemotherapy and radiation and was undergoing treatment with adjuvant temozolomide. He had radiographic improvement of the brain tumor (decreased size, contrast enhancement and T2 flair) after three cycles of adjuvant temozolomide. However, after cycle three the patient developed fever and abdominal pain. Evaluation in the emergency room revealed low absolute lymphocyte count (0.7 K/MM3), positive COVID-19 point of care test and CT chest revealed patchy peripheral bibasilar ground glass and consolidative opacities compatible with pulmonary infection, with viral etiology such as COVID. Symptoms resolved after 2 weeks. Due to active infection and leucopenia temozolomide was on hold for 1 month. He was considered cleared of infection after resolution of symptoms. Temozolomide was initiated after resolution of leucopenia. Patient continued to do well after administration of subsequent temozolomide cycles and repeat CT chest after 2 months revealed resolution of consolidation and no new areas of consolidation. Temozolomide was safely administered in this patient without reactivation of COVID-19 infection. He did not have any thrombotic events.

Sign in / Sign up

Export Citation Format

Share Document