scholarly journals Reduced Iris Yellow Spot Symptoms through Selection within Onion Breeding Lines

Horticulturae ◽  
2021 ◽  
Vol 7 (2) ◽  
pp. 12
Author(s):  
Neel Kamal ◽  
Seyed Shahabeddin Nourbakhsh ◽  
Christopher S. Cramer
Keyword(s):  
Disease Severity ◽  
Seed Production ◽  
Thrips Tabaci ◽  
Yellow Spot ◽  
Symptom Expression ◽  
Onion Thrips ◽  
Spot Virus ◽  
Breeding Lines ◽  
Selection Cycle ◽  
Allium Cepa L

Iris yellow spot (IYS) disease in onion (Allium cepa L.) is caused by onion thrips (Thrips tabaci L.) vectored Iris yellow spot virus (IYSV). The absence of cultivars that are resistant/tolerant to thrips and/or IYS is a challenge for onion bulb and seed production worldwide. To measure selection progress for reduced/delayed IYS symptom expression in onion breeding lines after two selection cycles, selections were performed in 2011 on previously evaluated lines that exhibited a reduced symptom expression after one selection cycle. Selected plants from each line were massed in a cage and the resulted progenies were evaluated in 2013 and 2014 along with their original populations and a susceptible check—’Rumba’. In some comparisons, the selection progress for delayed/reduced IYS symptom expression was observed for some breeding lines. Plants of most selected breeding lines exhibited less disease expression than plants of ‘Rumba’. For some selections, a low disease severity was observed even with a relatively high number of thrips per plant. These results suggest that further improvement might be achievable with additional cycles of selection.

scholarly journals Selection Progress for Resistance to Iris Yellow Spot in Onions

HortScience ◽  
2018 ◽  
Vol 53 (8) ◽  
pp. 1088-1094 ◽  
Author(s):  
Neel Kamal ◽  
Christopher S. Cramer
Keyword(s):  
Disease Severity ◽  
First Generation ◽  
Disease Incidence ◽  
Thrips Tabaci ◽  
Yellow Spot ◽  
Effective Control ◽  
State University ◽  
Onion Thrips ◽  
Breeding Lines ◽  
New Mexico State University

Onion thrips (Thrips tabaci Lindeman)–vectored Iris yellow spot virus (IYSV) causes the disease Iris yellow spot (IYS), which is a major threat to the sustainability of onion production worldwide. An increase in thrips resistance to various insecticides, high costs, and the limited efficacy of insecticides under hot and drier conditions found in various onion-growing regions restrict grower’s options for effective control of thrips and spread of IYSV. Because cultivars resistant to thrips and IYS are lacking, this study was undertaken to measure selection progress for IYS resistance after one selection cycle. In 2009, selections were performed on previously evaluated New Mexico State University (NMSU) breeding lines that showed some reduced IYS disease symptoms, and the selected plants self-pollinated the following year. In 2011 and 2012, plants from the original and selected populations along with a susceptible check, ‘Rumba’, were evaluated under field conditions when onion thrips and IYSV were present. Plants were rated for IYS disease severity and the number of thrips per plant was recorded three times during the study in each year. First-generation material, NMSU 10-776, NMSU 10-782, NMSU 10-785, NMSU 10-807, and NMSU 10-813, had fewer thrips number per plant, lower disease severity, and disease incidence than their original breeding lines on at least one or two rating times in both years. Some first-generation breeding lines performed better with a lower thrips number and disease severity than their original population in 1 year or the other. Most entries exhibited fewer thrips, lower IYS disease severity, and less incidence than the susceptible check ‘Rumba’ at most rating times. Overall, some progress was observed in this first-generation material for reduced IYS disease symptom expression when compared with their original populations.

scholarly journals Distribution and Transmission of Iris yellow spot virus

Plant Disease ◽  
2001 ◽  
Vol 85 (8) ◽  
pp. 838-842 ◽  
Author(s):  
A. Kritzman ◽  
M. Lampel ◽  
B. Raccah ◽  
A. Gera
Keyword(s):  
Frankliniella Occidentalis ◽  
Thrips Tabaci ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
Onion Thrips ◽  
Spot Virus ◽  
Nucleocapsid Gene ◽  
Thrips Species ◽  
Mother Plants ◽  
Thrips Population

Iris yellow spot virus (IYSV), a new tospovirus associated with a disease in onion (Allium cepa) that is known to growers in Israel as “straw bleaching,” was identified and further characterized by host range, serology, electron microscopy, and molecular analysis of the nucleocapsid gene. The transmissibility of IYSV by Thrips tabaci and Frankliniella occidentalis was studied. IYSV was efficiently transmitted by T. tabaci from infected to healthy onion seedlings and leaf pieces. Two biotypes of F. occidentalis, collected from two different locations in Israel, failed to transmit the virus. Surveys to relate the incidence of thrips populations to that of IYSV were conducted in onion fields. They revealed that the onion thrips T. tabaci was the predominant thrips species, and that its incidence was strongly related to that of IYSV. Forty-five percent of the thrips population collected from IYSV-infected onion and garlic fields in Israel transmitted the virus. IYSV was not transmitted to onion seedlings from infected mother plants through the seed, and was not located in bulbs of infected plants.

scholarly journals Evaluation of Lisianthus as an Indicator Host for Iris yellow spot virus

Plant Disease ◽  
2011 ◽  
Vol 95 (12) ◽  
pp. 1520-1527 ◽  
Author(s):  
Rajagopalbabu Srinivasan ◽  
Stan Diffie ◽  
Sivamani Sundaraj ◽  
Stephen W. Mullis ◽  
David Riley ◽  
...  
Keyword(s):  
Transmission Rate ◽  
Thrips Tabaci ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
Effect Of Temperature ◽  
Enzyme Linked Immunosorbent Assay ◽  
Mechanical Transmission ◽  
Symptom Expression ◽  
Spot Virus ◽  
Temperature Regimes

Iris yellow spot virus (IYSV) can severely affect onion production. IYSV is transmitted by the onion thrips, Thrips tabaci. However, information on IYSV–thrips–onion interactions is limited due to the difficulty associated with infecting onion plants experimentally. Lisianthus (Eustoma russellianum) was used as an indicator host to study mechanical transmission of IYSV, IYSV transmission by T. tabaci, IYSV distribution in the host plant, and the effect of temperature on IYSV symptom expression. Mechanical inoculation tests from IYSV-infected onion plants to noninfected lisianthus plants resulted in a mean transmission rate of 82.5 ± 6.9% (mean ± standard error), and from IYSV-infected lisianthus plants to noninfected lisianthus plants resulted in a mean transmission rate of 89.2 ± 7.1%. T. tabaci adults transmitted IYSV at a rate of 80.0 ± 8.3% from infected onion plants to noninfected lisianthus plants. To assess IYSV distribution in infected lisianthus plants, leaf sections, stems, and roots were tested by enzyme-linked immunosorbent assay (ELISA). All the plant parts tested positive for IYSV, but not on every plant assayed. Alternating night and day temperatures of 18 and 23°C, 25 and 30°C, and 30 and 37°C were evaluated for the effects on IYSV symptom expression. More severe symptoms developed on inoculated plants incubated at the 18 and 23°C or 25 and 30°C temperature regimes than at the 30 and 37°C regime, and symptoms were observed earliest on plants incubated at the 25 and 30°C temperature regime compared to the other temperature regimes.

scholarly journals Evaluating Iris Yellow Spot Disease Incidence and Severity in Onion Germplasm of Varying Leaf Characteristics

HortScience ◽  
2017 ◽  
Vol 52 (4) ◽  
pp. 527-532 ◽  
Author(s):  
Christopher S. Cramer ◽  
Neel Kamal ◽  
Narinder Singh
Keyword(s):  
Disease Incidence ◽  
Thrips Tabaci ◽  
Yellow Spot ◽  
State University ◽  
Leaf Color ◽  
Onion Thrips ◽  
Spot Virus ◽  
Disease Symptoms ◽  
New Mexico State University ◽  
Onion Cultivar

Iris yellow spot (IYS) disease, caused by Iris yellow spot virus (IYSV), results in irregular and diamond-shaped, chlorotic, and necrotic lesions on the leaves and seedstalks of onions (Allium cepa L.). These lesions reduce leaf photosynthetic area and ultimately reduce onion bulb size and yield from larger bulb classes. IYSV is vectored by onion thrips (Thrips tabaci L.) that are difficult to control under certain environmental conditions. Currently, no onion cultivar is resistant to the disease symptoms, virus, and/or thrips. Twenty-one cultivars and 17 germplasm lines were evaluated in the field for IYS disease severity and thrips densities at multiple times during the season as well as leaf color, waxiness, and axil openness of these entries. Plants were grown under conditions that favored thrips populations (high temperatures, low moisture, and no insecticidal spray applications), IYSV presence and distribution, and IYS development. Plants of New Mexico State University (NMSU) 07-10-1 had fewer thrips than several entries later in the season in both 2009 and 2010. Several entries exhibited a lower number of thrips per plant early or later in the season; however, these results were not consistent across years and were not associated with a particular foliage characteristic. Lighter leaf color and/or a lesser amount of epicuticular wax did not always result in the fewest number of thrips per plant as has been reported in the literature. Plants of NMSU 09-58 tended to exhibit fewer and less severe IYS symptoms early in the season as compared with plants of other entries.

scholarly journals First Report of Iris yellow spot virus Infecting Onion in Pakistan

Plant Disease ◽  
2013 ◽  
Vol 97 (11) ◽  
pp. 1517-1517 ◽  
Author(s):  
R. Iftikhar ◽  
S. Bag ◽  
M. Ashfaq ◽  
H. R. Pappu
Keyword(s):  
Thrips Tabaci ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
Spot Virus ◽  
Viral Pathogen ◽  
Widespread Occurrence ◽  
First Report ◽  
Allium Cepa L ◽  
Seed Crops ◽  
Agricultural Organization

Onion (Allium cepa L.) is an important vegetable crop in Pakistan. According to the Food and Agricultural Organization (FAO), Pakistan is the world's fifth largest onion producer. The area and production is 127.8 thousand hectares and 1.7 million tons, respectively, with a yield of 13.8 tons per hectare during 2012. The agro-ecological diversity in the country enables onion production almost year round. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus), transmitted principally by Thrips tabaci, is an economically important viral pathogen of bulb and seed onion crops in many onion-growing areas of the world (1,3). In Asia, IYSV has been reported in India and Sri Lanka (2,4). During March to May 2012, as part of a survey for tospoviruses in vegetables, symptoms suspected to be caused by IYSV were observed on bulb and seed onions grown in farmers' fields in Faisalabad, Nankana, Sheikhupura, and Sialkot districts of Punjab. Symptoms consisted of spindle-shaped, straw colored, irregular chlorotic lesions with occasional green islands on the leaves. Approximately 60% of the fields surveyed had about 30% of the plants with these symptoms. The presence of the virus was confirmed with an IYSV-specific ELISA kit (Bioreba). IYSV infection was verified by RT-PCR with primers IYSV-F (TAAAACAAACATTCAAACAA) and IYSV-R (CTCTTAAACACATTTAACAAGCA) as forward and reverse primers, respectively. Amplicons of approximately 1,100 bp were obtained from the symptomatic samples, but not from healthy and water controls. The amplicons were cloned and sequenced. The IYSV-Pakistan isolates (GenBank Accession Nos. KF171103, KF171104, and KF171105) had the highest nucleotide sequence identity of 99% with the corresponding region of an IYSV isolate from Chile (DQ150107). To our knowledge, this is the first report of IYSV infecting onion in Pakistan. The relatively widespread occurrence of IYSV underscores the need for systematic surveys to assess its incidence and impact on onion bulb and seed crops so that appropriate management tactics can be developed. References: (1) D. H. Gent et al. Plant Dis. 88:446, 2004. (2) B. Mandal et al. Plant Dis. 94:468, 2012. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) K. S. Ravi et al. Plant Pathol. 55:288, 2006.

scholarly journals Screening Winter-sown Onion Entries for Iris Yellow Spot Virus Tolerance

HortScience ◽  
2009 ◽  
Vol 44 (3) ◽  
pp. 627-632 ◽  
Author(s):  
Parminder S. Multani ◽  
Christopher S. Cramer ◽  
Robert L. Steiner ◽  
Rebecca Creamer
Keyword(s):  
Disease Progression ◽  
Integrated Management ◽  
Management Strategies ◽  
Thrips Tabaci ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
Enzyme Linked Immunosorbent Assay ◽  
Symptom Expression ◽  
Spot Virus ◽  
Over Time

Identification of resistant or tolerant onion (Allium cepa L.) cultivars is crucial for the development of integrated management strategies for Iris yellow spot virus (IYSV). Exclusively vectored by onion thrips (Thrips tabaci), IYSV is a potentially devastating tospovirus of onion that has been confirmed to be present in 15 countries all over the world. In this study, 18 winter-sown onion entries were screened for IYSV symptom expression over two seasons. Over the growing season, straw-colored, necrotic lesions typical of IYSV infection were observed and rated for disease severity. Entries, NMSU 03-52-1, NMSU 04-41, NMSU 04-44-1, and ‘NuMex Jose Fernandez’, exhibited fewer symptoms than many other entries tested. ‘Caballero’, NMSU 04-57-1, NMSU 04-78-1, and ‘Cimarron’ exhibited more symptoms. Disease progression over time was rapid for entries exhibiting more symptoms and slow for entries exhibiting fewer symptoms. Enzyme-linked immunosorbent assay (ELISA) optical densities correlated poorly with the severity of disease symptoms. Trends in the disease progression over time emphasize the importance of rating IYSV symptoms late in the crop's development and to search for delayed disease progression rather than early symptom expression to determine IYSV susceptibility.

scholarly journals Importance of Transplanted Onions Contributing to Late-Season Iris yellow spot virus Epidemics in New York

Plant Disease ◽  
2018 ◽  
Vol 102 (7) ◽  
pp. 1264-1272 ◽  
Author(s):  
Ashley Leach ◽  
Marc Fuchs ◽  
Riley Harding ◽  
Rebecca Schmidt-Jeffris ◽  
Brian A. Nault
Keyword(s):  
New York ◽  
Thrips Tabaci ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
Onion Thrips ◽  
Chain Reaction ◽  
Spot Virus ◽  
Direct Seeded ◽  
Polymerase Chain

Iris yellow spot virus (IYSV) is an economically significant tospovirus of onion transmitted by onion thrips (Thrips tabaci Lindeman). IYSV epidemics in onion fields are common in New York; however, the role of various habitats contributing to viruliferous onion thrips populations and IYSV epidemics is not known. In a 2-year field study in New York, the abundance of dispersing onion thrips, including those determined to be viruliferous via reverse-transcriptase polymerase chain reaction, was recorded in habitats known to harbor both IYSV and its vector. Results showed that viruliferous thrips were encountered in all habitats; however, transplanted onion sites accounted for 49 to 51% of the total estimated numbers of viruliferous thrips. During early to midseason, transplanted onion sites had 9 to 11 times more viruliferous thrips than the other habitats. These results indicate that transplanted onion fields are the most important habitat for generating IYSV epidemics in all onion fields (transplanted and direct-seeded) in New York. Our findings suggest that onion growers should control onion thrips in transplanted fields early in the season to minimize risk of IYSV epidemics later in the season.

Sign in / Sign up

Export Citation Format

Share Document