genetic character
Recently Published Documents


TOTAL DOCUMENTS

40
(FIVE YEARS 2)

H-INDEX

9
(FIVE YEARS 0)

Cassowary ◽  
2021 ◽  
Vol 4 (1) ◽  
pp. 10-18
Author(s):  
Zarima Wibawati ◽  
Amelia Sarungallo ◽  
Barahima Abbas

Propagation through tissue culture by using orchid seed as explants will produce a lot of orchid plants. This study aims to measure the genetic character of orchid plantlets that were regenerated from seeds which have been resulted from in vitro culture. The genetic character of the original orchid plants produced from in vitro culture was determined using Random Amplified Polymorphic DNA (RAPD) molecular markers. The results showed that the primers used in the RAPD analysis showed a polymorphic band pattern of 14 DNA bands, with sizes between 500 bp - 8000 bp. The genetic distance of Grammatophyllum scriptum orchids that was regenerated from seeds is between 0.229 and 0.649.  The progenis produced from in vitro culture were clustered into seven groups at a dissimilarity coefficient of 45%.



Author(s):  
L. V. Kalinkova ◽  
A. E. Shemarykin
Keyword(s):  


2020 ◽  
Vol 11 (4) ◽  
pp. 991-1003
Author(s):  
Vicente Vega Sánchez ◽  
Martín Talavera Rojas ◽  
Jeannette Barba León ◽  
Andrea Paloma Zepeda Velázquez ◽  
Nydia Edith Reyes Rodríguez

Escherichia coli is an important microorganism as an intestinal microbiota of animals and humans, so its presence in food serves as an indicator of possible fecal contamination; some strains can cause disease, mainly due to the consumption of water and animal food contaminated. The objective of this study was to detemine the resistance to antimicrobials and the genetic character of E. coli present in the carcasses and feces of bovines killed in slaugtherhouses, and to know the epidemiological panorama in Mexico. The study was carried out in 32 strains in three municipal slaugtherhouses (A, B and C) obtained from bovines in Central Mexico; their resistance profile and their genetic relationship between the different isolates were analyzed by genotyping with the enzyme XbaI-PFGE; The dendrogram was constructed using the coefficient of similarity of Dice with a tolerance of 1.5 %. It is observed that 75 % (24/32) of the isolates show resistance to some antibiotic, 84.3 % (27/32) have an intermediate profile and 12.5 % (4/32) are sensitive to all antibiotics, the 28.1 % (9/32), were MDR; 27 PFGE and pulsetypes will be identified; 7 clusters were formed with 2 or more isolates (A-F and I) and two integrated with a strain (G and H). This study shows a diversity antimicrobial resistance present in cattle carcasses and feces in Mexico, which is a risk factor and a public health problem.



2020 ◽  
Vol 13 (2) ◽  
pp. 175-179
Author(s):  
S.D. Jagtap ◽  
B.C. Game ◽  
P.E. More

Powdery mildew disease of sesame occurs on epidemic scale in areas of high rainfall and humidity coupled with low night temperature causing considerable yield losses. Use of host plant resistance is the practical approach to manage this disease, but proper resistance sources with combining ability for the trait are unknown. Hence, an experiment was conducted to determine resistance in sesame genotypes against powdery mildew disease. Among the twenty four genotypes screened, none was found resistant while, nine genotypes exhibited moderately resistant to tolerant reaction and 15 genotypes exhibited susceptible reaction. Apparent rate of infection value varied and at times they did not remain consistent for given genotype and also did not show a particular trend which is attributed to genetic character of the genotype. The AUDPC values differed considerably for different genotypes. The values of AUDPC and apparent rate of infection of susceptible varieties were high as compared to moderately susceptible varieties. Genotype ‘JLS-302-11’ and ‘JLT-7’ having minimum AUDPC and apparent rate of infection value showed lowest intensity of powdery mildew while, genotype ‘JLT-408’ having maximum AUDPC and apparent rate of infection value showed highest intensity of powdery mildew.



2019 ◽  
Vol 6 (2) ◽  
pp. 117
Author(s):  
Lestari Wilujeng, Gunanti Mahasri, Mufasirin

Abstract This study aims to analyze the genetic character of Anguilla bicolor based on cytochrome b gene as the basis of information in the study of phylogeny and genetic engineering. The research was conducted from May to September 2013 in the Laboratory of Biotechnology Faculty of Science, University of Brawijaya. This study uses a survey with qualitative descriptive analysis in the laboratory. Samples obtained from direct arrests in Tulungagung Popo Beach , Manado , Medan and Cilacap. Study was initiated by DNA isolation using CTAB method and followed by PCR . Primers used were cytb - 1 (5' - TGCTAACGATGCCCTAGTGG - 3 ') and b CYT - 2 (5' - CTAGTCAACCTACT - AATGGG - 3 ') . PCR results were cut using restriction enzymes and Msp1 Hha1. Data analysis was performed with the aid of NTSYS software program. Genetic character of a sequence of nucleotide bases making up DNA from the cytochrome b gene were obtained on each sample has a degree of similarity around 32 - 100 %.



2018 ◽  
Author(s):  
Gatot Ciptadi ◽  
Ardyah Ramadina Irsanti Putri ◽  
Sri Rahayu ◽  
Sri Wahjuningsih ◽  
Moch. Nasich ◽  
...  




2016 ◽  
Vol 17 (2) ◽  
pp. 73
Author(s):  
Abdullah Bin Arif ◽  
Sriani Sujiprihati ◽  
Muhamad Syukur

<p>Inheritance of Several Qualitative Characters in Three Group Pepper. Selection method is one of most important factors in determining the success of pepper breeding programs. Selection method will be effective if it is supported by a complete knowledge of genetic character inheritance. This research was aimed to investigate the information of inheritance pattern of pepper adaptability to qualitative characters. There are two steps in this research i.e makes material genetic and inheritance study of qualitative characters in the field. The result showed that all characters qualitative controlled one gen. There are several characters qualitative that depended action gen full dominant (colour young length and fruit textur) and others characters depended action gen partial dominant (colour young fruit and flower position).</p><p> </p><p><strong>Abstrak</strong></p><p>Metode seleksi adalah salah satu faktor penting yang menentukan keberhasilan pemuliaan cabai. Metode seleksi akan lebih efektif jika didukung oleh pengetahuan yang lengkap tentang pola pewarisan karakter genetik. Penelitian ini bertujuan untuk mengetahui pola pewarisan yang sesuai untuk karakter-karakter kualitatif. Penelitian ini berlangsung dua tahap, yaitu pembentukan materi genetik dan studi pewarisan karakter kualitatif di lapang. Hasil penelitian menunjukkan semua karakter kualitatif dikendalikan oleh satu gen. Ada beberapa karakter kualitatif yang dipengaruhi oleh gen dominan penuh (warna batang muda dan tekstur permukaan buah) dan karakter lainnya dipengaruhi oleh gen dominan sebagian (warna buah muda dan posisi bunga).</p>



Author(s):  
Yonggyun Kim ◽  
◽  
Md. Sadekuzzaman ◽  
Minhyun Kim ◽  
Kyusoon Kim ◽  
...  


2015 ◽  
Vol 145 (1) ◽  
pp. 69-82 ◽  
Author(s):  
Mark W. Fritts ◽  
Cheryl Grunwald ◽  
Isaac Wirgin ◽  
Tim L. King ◽  
Douglas L. Peterson


Sign in / Sign up

Export Citation Format

Share Document