Inspired Biological Synthesis of Nanomaterials Using Eukaryotic Microbial Nano-Machinery

2020 ◽  
pp. 81-109
Author(s):  
Basma A. Omran
Keyword(s):  
Biological Synthesis ◽  
Synthesis Of Nanomaterials

scholarly journals Síntesis y caracterización de nanopartículas de oro y su funcionalización con sondas específicas de DNA de Achlya sp. y Escherichia coli

2015 ◽  
Author(s):  
◽  
Blanca Estela Chavez-Sandoval
Keyword(s):  
Escherichia Coli ◽  
Good Alternative ◽  
Noble Metal Nanoparticles ◽  
Biological Synthesis ◽  
Target Sequence ◽  
Inorganic Synthesis ◽  
Fish Farms ◽  
E Coli ◽  
Synthesis Of Nanomaterials

The pick in the use of noble metal nanoparticles (NPs) in various fields has resulted in inorganic synthesis of metal NPs, however the methodologies used for their preparation are generally expensive and involve the use of hazardous chemicals, is why has recently increased the development of sustainable and environmentally friendly alternatives. Synthesize biologically AuNPs is easy, inexpensive and is less damaging to the environment. The use of plant extracts for the synthesis of nanomaterials has not yet been fully explored, however represents a good alternative as well as the aforementioned advantages are obtained stable NPs of different size and shape. In this work the synthesis and characterization of AuNPs wasnperformed, and their functionalization with specific DNA probes of two microorganisms of environmental interest Achlya sp. and Escherichia coli (E. coli). Achlya sp. is a fungus that infects fish farms, aquariums and natural reservoirs; E coli is a bacteria pathogenic to humans and is a source of contamination in food and water. The DNA probe or target sequence designed to Achlya sp. is: 5’ GCACCGGAAGTACAGACCAA 3’ and E. coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ The AuNPs obtained by chemical synthesis and biological synthesis extracts from laurel, nopal, onion, pear and coffee were functionalized with DNA Achlya sp. and E. coli and can be used in the design and construction of biosensors for detecting environmental microorganisms before mentioned, except NPs coffee at pH 9, as these do not show a good functionalization. Furthermore it is proposed that for the biological synthesis, malic acid may be acting as a reducing agent and the amino group as a stabilizing agent. Finally, the genosensors allow monitoring, preventing and correcting issues that cause ecological imbalances in aquatic environments. These new analytical devices provide information quickly, simple and inexpensive compared with conventional analysis techniques.

Biological Synthesis of Nanomaterials and Their Advantages

2021 ◽  
pp. 69-88
Author(s):  
Gözde Koşarsoy Ağçeli ◽  
Kanika Dulta ◽  
Parveen Chauhan ◽  
Pankaj Kumar Chauhan
Keyword(s):  
Biological Synthesis ◽  
Synthesis Of Nanomaterials

Biological Synthesis of Nanomaterials

2017 ◽  
pp. 43-88
Author(s):  
M. H. Fulekar ◽  
Bhawana Pathak
Keyword(s):  
Biological Synthesis ◽  
Synthesis Of Nanomaterials

Applications of Metal and Metal Oxide-Based Nanomaterials in Medical and Biological Activities

2022 ◽  
pp. 312-337
Author(s):  
Ashajyothi C. ◽  
Harish K. Handral ◽  
Prabhurajeshwar C.
Keyword(s):  
Drug Delivery ◽  
Tissue Engineering ◽  
Metal Oxide ◽  
High Stability ◽  
Biological Activities ◽  
Biological Synthesis ◽  
Surface Mass ◽  
Mass Proportion ◽  
Metal Oxide Nanomaterials ◽  
Synthesis Of Nanomaterials

Nanomaterials have been attracting the attention of many researchers because of their size, high stability, affinity, and selectivity nature. Over the past decades, considerable intensive studies on many metal and metal-oxide nanomaterials have drawn consideration through their significant properties like size, shape, surface mass proportion, and their reactivity; all these properties are fundamental cornerstones for the turn of events and use of nanomaterials and nanoscale gadgets in biomedical areas. There is also a vast scope for a broad range of biofunctional applications such as antibacterial, antiviral, antifungal, antitumor, bioimaging, tissue engineering, biosensors, gene, and drug delivery. The authors review the nature, forms, and synthesis of nanomaterials here, with a thorough biological synthesis assessment. They also address the development of nanoparticles by microorganisms in depth, and this chapter also includes updates on different biological and biomedical applications of these bionanomaterials.

scholarly journals Lichens—A Potential Source for Nanoparticles Fabrication: A Review on Nanoparticles Biosynthesis and Their Prospective Applications

2021 ◽  
Vol 7 (4) ◽  
pp. 291
Author(s):  
Reham Samir Hamida ◽  
Mohamed Abdelaal Ali ◽  
Nabila Elsayed Abdelmeguid ◽  
Mayasar Ibrahim Al-Zaban ◽  
Lina Baz ◽  
...  
Keyword(s):  
Low Cost ◽  
Antimicrobial Activities ◽  
Synthesis Process ◽  
Biological Synthesis ◽  
Synthesis Of Nanoparticles ◽  
Different Types ◽  
Target Metal ◽  
First Time ◽  
Synthesis Of Nanomaterials

Green synthesis of nanoparticles (NPs) is a safe, eco-friendly, and relatively inexpensive alternative to conventional routes of NPs production. These methods require natural resources such as cyanobacteria, algae, plants, fungi, lichens, and naturally extracted biomolecules such as pigments, vitamins, polysaccharides, proteins, and enzymes to reduce bulk materials (the target metal salts) into a nanoscale product. Synthesis of nanomaterials (NMs) using lichen extracts is a promising eco-friendly, simple, low-cost biological synthesis process. Lichens are groups of organisms including multiple types of fungi and algae that live in symbiosis. Until now, the fabrication of NPs using lichens has remained largely unexplored, although the role of lichens as natural factories for synthesizing NPs has been reported. Lichens have a potential reducible activity to fabricate different types of NMs, including metal and metal oxide NPs and bimetallic alloys and nanocomposites. These NPs exhibit promising catalytic and antidiabetic, antioxidant, and antimicrobial activities. To the best of our knowledge, this review provides, for the first time, an overview of the main published studies concerning the use of lichen for nanofabrication and the applications of these NMs in different sectors. Moreover, the possible mechanisms of biosynthesis are discussed, together with the various optimization factors influencing the biological synthesis and toxicity of NPs.

Green synthesis of nanomaterials for early lung cancer detection

2018 ◽  
pp. 1-1
Keyword(s):  
Lung Cancer ◽  
Green Synthesis ◽  
Cancer Detection ◽  
World Wide ◽  
Early Stage ◽  
Age Groups ◽  
Early Lung Cancer ◽  
Lung Cancer Detection ◽  
Synthesis Of Nanomaterials

Lung cancer is the foremost cause of cancer-related deaths world-wide [1]. It affects 100,000 Americans of the smoking population every year of all age groups, particularly those above 50 years of the smoking population [2]. In India, 51,000 lung cancer deaths were reported in 2012, which include 41,000 men and 10,000 women [3]. It is the leading cause of cancer deaths in men; however, in women, it ranked ninth among all cancerous deaths [4]. It is possible to detect the lung cancer at a very early stage, providing a much higher chance of survival for the patients.

Hydrothermal Treatment Management of High Alumina Waste for Synthesis of Nanomaterials with New Morphologies

2017 ◽  
Vol 66 (5) ◽  
pp. 172-179 ◽  
Author(s):  
H. H. Abo-Almaged ◽  
A. F. Moustafa ◽  
A. M. Ismail ◽  
S. K. Amin ◽  
M. F. Abadir
Keyword(s):  
Hydrothermal Treatment ◽  
High Alumina ◽  
Treatment Management ◽  
Synthesis Of Nanomaterials
Sign in / Sign up

Export Citation Format

Share Document