scholarly journals Síntesis y caracterización de nanopartículas de oro y su funcionalización con sondas específicas de DNA de Achlya sp. y Escherichia coli

2015 ◽  
Author(s):  
◽  
Blanca Estela Chavez-Sandoval
Keyword(s):  
Escherichia Coli ◽  
Good Alternative ◽  
Noble Metal Nanoparticles ◽  
Biological Synthesis ◽  
Target Sequence ◽  
Inorganic Synthesis ◽  
Fish Farms ◽  
E Coli ◽  
Synthesis Of Nanomaterials

The pick in the use of noble metal nanoparticles (NPs) in various fields has resulted in inorganic synthesis of metal NPs, however the methodologies used for their preparation are generally expensive and involve the use of hazardous chemicals, is why has recently increased the development of sustainable and environmentally friendly alternatives. Synthesize biologically AuNPs is easy, inexpensive and is less damaging to the environment. The use of plant extracts for the synthesis of nanomaterials has not yet been fully explored, however represents a good alternative as well as the aforementioned advantages are obtained stable NPs of different size and shape. In this work the synthesis and characterization of AuNPs wasnperformed, and their functionalization with specific DNA probes of two microorganisms of environmental interest Achlya sp. and Escherichia coli (E. coli). Achlya sp. is a fungus that infects fish farms, aquariums and natural reservoirs; E coli is a bacteria pathogenic to humans and is a source of contamination in food and water. The DNA probe or target sequence designed to Achlya sp. is: 5’ GCACCGGAAGTACAGACCAA 3’ and E. coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ The AuNPs obtained by chemical synthesis and biological synthesis extracts from laurel, nopal, onion, pear and coffee were functionalized with DNA Achlya sp. and E. coli and can be used in the design and construction of biosensors for detecting environmental microorganisms before mentioned, except NPs coffee at pH 9, as these do not show a good functionalization. Furthermore it is proposed that for the biological synthesis, malic acid may be acting as a reducing agent and the amino group as a stabilizing agent. Finally, the genosensors allow monitoring, preventing and correcting issues that cause ecological imbalances in aquatic environments. These new analytical devices provide information quickly, simple and inexpensive compared with conventional analysis techniques.

scholarly journals Functional expression of the eukaryotic proton pump rhodopsin OmR2 in Escherichia coli and its photochemical characterization

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Masuzu Kikuchi ◽  
Keiichi Kojima ◽  
Shin Nakao ◽  
Susumu Yoshizawa ◽  
Shiho Kawanishi ◽  
...  
Keyword(s):  
Escherichia Coli ◽  
Proton Pump ◽  
Expression System ◽  
Spectroscopic Characterization ◽  
Functional Expression ◽  
Proton Pumping ◽  
E Coli ◽  
Oxyrrhis Marina ◽  
Domains Of Life

AbstractMicrobial rhodopsins are photoswitchable seven-transmembrane proteins that are widely distributed in three domains of life, archaea, bacteria and eukarya. Rhodopsins allow the transport of protons outwardly across the membrane and are indispensable for light-energy conversion in microorganisms. Archaeal and bacterial proton pump rhodopsins have been characterized using an Escherichia coli expression system because that enables the rapid production of large amounts of recombinant proteins, whereas no success has been reported for eukaryotic rhodopsins. Here, we report a phylogenetically distinct eukaryotic rhodopsin from the dinoflagellate Oxyrrhis marina (O. marina rhodopsin-2, OmR2) that can be expressed in E. coli cells. E. coli cells harboring the OmR2 gene showed an outward proton-pumping activity, indicating its functional expression. Spectroscopic characterization of the purified OmR2 protein revealed several features as follows: (1) an absorption maximum at 533 nm with all-trans retinal chromophore, (2) the possession of the deprotonated counterion (pKa = 3.0) of the protonated Schiff base and (3) a rapid photocycle through several distinct photointermediates. Those features are similar to those of known eukaryotic proton pump rhodopsins. Our successful characterization of OmR2 expressed in E. coli cells could build a basis for understanding and utilizing eukaryotic rhodopsins.

scholarly journals Isolation and characterization of escherichia coli in ready-to-eat foods vended in Islamic University, Kushtia

1970 ◽  
Vol 18 ◽  
pp. 99-103 ◽  
Author(s):  
S Biswas ◽  
MAK Parvez ◽  
M Shafiquzzaman ◽  
S Nahar ◽  
MN Rahman
Keyword(s):  
Escherichia Coli ◽  
Pattern Analysis ◽  
University Campus ◽  
Rflp Pattern ◽  
E Coli ◽  
Fish Meat ◽  
Isolation And Characterization ◽  
Food Borne ◽  
Identification And Characterization

Context: Escherichia coli is shed in the feces of warm blooded animals and humans and thus potential for public health. Detection and characterization of E. coli in the ready-to-eat (RTE) foods concerns due to their presence indicates fecal contamination of the food.   Objective: To identify, characterize and RFLP pattern analysis of E. coli isolated from RTE foods vended in Islamic University campus, Kushtia.   Materials and Methods: Fifty samples from four types of consumed foods in six student halls of residence, some temporary restaurants of Islamic University, Kushtia were assessed for bacterial contamination by standard methods. Identification and characterization of E. coli isolates were performed using IMViC tests. Genomic DNA was used to perform RFLP pattern analysis.   Results: Thirty seven out of 50 (74%) examined samples of RTE foods had E. coli contamination. The highest number of E. coli was isolated from vegetable oriented RTE foods (90.90%) and fish, meat and cereals samples were also significantly E. coli positive. RFLP profiling of two E. coli isolates were observed.   Conclusion: The results of this study provide evidence that some RTE foods had unsatisfactory levels of contamination with E. coli. Thus street vended RTE food could be important potential vehicles for food-borne diseases. Molecular characterization may be exploited to identify food borne pathogen among different species.  Keywords: Ready-to-eat foods; Escherichia coli; RFLP pattern DOI: http://dx.doi.org/10.3329/jbs.v18i0.8783 JBS 2010; 18(0): 99-103

scholarly journals Evaluation of antipyretic activity of hydroalcoholic extract of Corchorus depressus Linn. in Escherichia coli–induced pyretic rabbits

2018 ◽  
Vol 16 ◽  
pp. 205873921879295
Author(s):  
Saeed Ahmad ◽  
Muhammad Akram ◽  
Syed Muhammad Ali Shah ◽  
Sabira Sultana
Keyword(s):  
Escherichia Coli ◽  
Positive Control ◽  
Negative Control ◽  
The Body ◽  
Hydroalcoholic Extract ◽  
Antipyretic Effect ◽  
E Coli ◽  
Antipyretic Activity ◽  
Experimental Treatments

This study was conducted to investigate the antipyretic effect of the hydroalcoholic extract of Corchorus depressus Linn. against Escherichia coli ( E. coli)-induced pyrexia in rabbits. Hydroalcohalic extracts of C. depressus were given orally at 25, 50, and 100 mg/kg for antipyretic affect in E. coli-induced fever in rabbits. The animals were divided into five groups of five each. Among these five groups, three received various doses of experimental treatments, whereas the fourth one served as positive control and received paracetamol. The fifth group of animals served as negative control and received no treatment. The body temperature of the rabbits was measured rectally over a period of 5 h. C. depressus exhibited better effects at dose rate of 25, 50, and 100 mg/kg. The hydroalcoholic extract of C. depressus has significant antipyretic effect. These results lend support to the popular use of C. depressus in traditional medicine as a remedy for pyrexia and suggest that the characterization of the principles for such activity deserves further investigation.

Characterization of novel ybjG and dacC variants in Escherichia coli

2013 ◽  
Vol 62 (11) ◽  
pp. 1728-1734 ◽  
Author(s):  
Dongguo Wang ◽  
Enping Hu ◽  
Jiayu Chen ◽  
Xiulin Tao ◽  
Katelyn Gutierrez ◽  
...  
Keyword(s):  
Escherichia Coli ◽  
Multiple Drug Resistance ◽  
Multiple Drug ◽  
The Novel ◽  
Conventional Pcr ◽  
E Coli ◽  
Novel Variants ◽  
Restriction Sites ◽  
Genetic Structures

A total of 69 strains of Escherichia coli from patients in the Taizhou Municipal Hospital, China, were isolated, and 11 strains were identified that were resistant to bacitracin, chloramphenicol, tetracycline and erythromycin. These strains were PCR positive for at least two out of three genes, ybjG, dacC and mdfA, by gene mapping with conventional PCR detection. Conjugation experiments demonstrated that these genes existed in plasmids that conferred resistance. Novel ybjG and dacC variants were isolated from E. coli strains EC2163 and EC2347, which were obtained from the sputum of intensive care unit patients. Genetic mapping showed that the genes were located on 8200 kb plasmid regions flanked by EcoRI restriction sites. Three distinct genetic structures were identified among the 11 PCR-positive strains of E. coli, and two contained the novel ybjG and dacC variants. The putative amino acid differences in the ybjG and dacC gene variants were characterized. These results provide evidence for novel variants of ybjG and dacC, and suggest that multiple drug resistance in hospital strains of E. coli depends on the synergistic function of ybjG, dacC and mdfA within three distinct genetic structures in conjugative plasmids.

Characterization of Extended-Spectrum β-Lactamase–Producing Escherichia coli Strains Isolated from Retail Foods in Shaanxi Province, China

2015 ◽  
Vol 78 (5) ◽  
pp. 1018-1023 ◽  
Author(s):  
MEILI XI ◽  
QIAN WU ◽  
XIN WANG ◽  
BAOWEI YANG ◽  
XIAODONG XIA ◽  
...  
Keyword(s):  
Escherichia Coli ◽  
Shaanxi Province ◽  
People’S Republic Of China ◽  
People's Republic Of China ◽  
M Gene ◽  
Disk Diffusion Test ◽  
Republic Of China ◽  
E Coli ◽  
Extended Spectrum

Extended-spectrum β-lactamase (ESBL)–producing Escherichia coli strains have been reported worldwide; however, the incidence and characterization of foodborne ESBL-producing E. coli strains have been rarely reported in the People's Republic of China. Among a collection of 659 E. coli isolates recovered from retail foods in Shaanxi Province, People's Republic of China, 223 cefoxitin-resistant and/or cefoperazone-resistant isolates were screened for ESBL production with the double disk diffusion test. The ESBL-producing isolates were characterized for antimicrobial resistance and the presence of blaTEM, blaSHV, and blaCTX-M genes. Isolates with blaCTX-M were further classified by PCR as having blaCTX-M-1, blaCTX-M-2, blaCTX-M-8, blaCTX-M-9, or blaCTX-M-25. One hundred forty-seven isolates were identified as ESBL positive. PCR detection revealed that 146 isolates (99.3%) contained the blaCTX-M gene. Among these isolates, 42 (28.8%) were positive for the enzyme CTX-M-1, 5 (3.4%) for CTX-M-2, and 99 (67.8%) for CTX-M-9. No CTX-M-8 and CTX-M-25 were found in this study. One hundred fifteen isolates (78.2%) were positive for the blaTEM gene, but blaSHV was not detected. Among the 147 ESBL-producing E. coli isolates, 75 (51.0%), 35 (23.8%), and 4 (2.7%) isolates were positive for blaTEM and blaCTX-M-9, blaTEM and blaCTX-M-1, and blaTEM and blaCTX-M-2, respectively. All of the 147 ESBL-producing isolates were resistant to three or more non–β-lactam antibiotics. This study provides evidence that foodborne E. coli can harbor ESBL-encoding genes. Thus, food could be a vehicle for the dissemination of ESBL-producing E. coli strains, a situation that requires surveillance and appropriate management strategies.

scholarly journals IDENTIFICATION OF AMPC Β-LACTAMASE-PRODUCING CLINICAL ISOLATES OF ESCHERICHIA COLI

2017 ◽  
Vol 10 (12) ◽  
pp. 357
Author(s):  
Tanushree Barua Gupta ◽  
Malini Shariff ◽  
Thukral Ss ◽  
S.s Thukral
Keyword(s):  
Escherichia Coli ◽  
Detection Method ◽  
Clinical Isolates ◽  
Confirmatory Test ◽  
Chain Reaction ◽  
E Coli ◽  
Resistance To Penicillin ◽  
Polymerase Chain ◽  
Third Generation Cephalosporins

  Objective: Indiscriminate use of β-lactam antibiotics has resulted in the emergence of β-lactamase enzymes. AmpC β-lactamases, in particular, confer resistance to penicillin, first-, second-, and third-generation cephalosporins as well as monobactams and are responsible for antibiotic resistance in nosocomial pathogens. Therefore, this study was undertaken to screen nosocomial Escherichia coli isolates for the presence and characterization of AmpC β-lactamases. The study also envisaged on the detection of inducible AmpC β-lactamases and extended-spectrum β-lactamases (ESBLs) in AmpC β-lactamase-producing E. coli.Methods: A total of 102 clinical isolates of E. coli, were subjected to cefoxitin screening, and screen-positive isolates were further subjected to inhibitor-based detection method, phenotypic confirmatory test, disc antagonism test, polymerase chain reaction (PCR), and isoelectric focusing (IEF).Results: In this study, 33% of E. coli were resistant to cefoxitin, of which 35% were found to be positive for AmpC β-lactamase by inhibitor-based phenotypic test. Of the AmpC-positive isolates, 83% were positive for ESBLs, whereas 25% were producing inducible AmpC β-lactamases. PCR and IEF showed CIT and EBC types of AmpC β-lactamases present in the tested isolates.Conclusion: Our study showed the presence of inducible AmpC enzymes and ESBLs in E. coli isolates and PCR identified more isolates to be AmpC producers.

scholarly journals Identification and Characterization of Genes Required for 5-Hydroxyuridine Synthesis in Bacillus subtilis and Escherichia coli tRNA

2019 ◽  
Vol 201 (20) ◽  
Author(s):  
Charles T. Lauhon
Keyword(s):  
Escherichia Coli ◽  
Bacillus Subtilis ◽  
Genomic Context ◽  
Similar Reduction ◽  
Content Type ◽  
E Coli ◽  
Wobble Position ◽  
Fertile Ground ◽  
And Function

ABSTRACT In bacteria, tRNAs that decode 4-fold degenerate family codons and have uridine at position 34 of the anticodon are typically modified with either 5-methoxyuridine (mo5U) or 5-methoxycarbonylmethoxyuridine (mcmo5U). These modifications are critical for extended recognition of some codons at the wobble position. Whereas the alkylation steps of these modifications have been described, genes required for the hydroxylation of U34 to give 5-hydroxyuridine (ho5U) remain unknown. Here, a number of genes in Escherichia coli and Bacillus subtilis are identified that are required for wild-type (wt) levels of ho5U. The yrrMNO operon is identified in B. subtilis as important for the biosynthesis of ho5U. Both yrrN and yrrO are homologs to peptidase U32 family genes, which includes the rlhA gene required for ho5C synthesis in E. coli. Deletion of either yrrN or yrrO, or both, gives a 50% reduction in mo5U tRNA levels. In E. coli, yegQ was found to be the only one of four peptidase U32 genes involved in ho5U synthesis. Interestingly, this mutant shows the same 50% reduction in (m)cmo5U as that observed for mo5U in the B. subtilis mutants. By analyzing the genomic context of yegQ homologs, the ferredoxin YfhL is shown to be required for ho5U synthesis in E. coli to the same extent as yegQ. Additional genes required for Fe-S biosynthesis and biosynthesis of prephenate give the same 50% reduction in modification. Together, these data suggest that ho5U biosynthesis in bacteria is similar to that of ho5C, but additional genes and substrates are required for complete modification. IMPORTANCE Modified nucleotides in tRNA serve to optimize both its structure and function for accurate translation of the genetic code. The biosynthesis of these modifications has been fertile ground for uncovering unique biochemistry and metabolism in cells. In this work, genes that are required for a novel anaerobic hydroxylation of uridine at the wobble position of some tRNAs are identified in both Bacillus subtilis and Escherichia coli. These genes code for Fe-S cluster proteins, and their deletion reduces the levels of the hydroxyuridine by 50% in both organisms. Additional genes required for Fe-S cluster and prephenate biosynthesis and a previously described ferredoxin gene all display a similar reduction in hydroxyuridine levels, suggesting that still other genes are required for the modification.

scholarly journals Molecular Characterization of Plasmid-Mediated Non-O157 Verotoxigenic Escherichia coli Isolated from Infants and Children with Diarrhea

2020 ◽  
Vol 17 (3) ◽  
pp. 0710
Author(s):  
Md Fazlul Karim Khan ◽  
Shah Samiur Rashid
Keyword(s):  
Escherichia Coli ◽  
Virulence Gene ◽  
Multidrug Resistant ◽  
Plasmid Curing ◽  
Health Issues ◽  
E Coli ◽  
Disk Diffusion Assay ◽  
Microbiological Techniques ◽  
Polymerase Chain

A significant increase in the incidence of non-O157 verotoxigenic Escherichia coli (VTEC) infections have become a serious health issues, and this situation is worsening due to the dissemination of plasmid mediated multidrug-resistant microorganisms worldwide. This study aims to investigate the presence of plasmid-mediated verotoxin gene in non-O157 E. coli. Standard microbiological techniques identified a total of 137 E. coli isolates. The plasmid was detected by Perfectprep Plasmid Mini preparation kit. These isolates were subjected to disk diffusion assay, and plasmid curing with ethidium bromide treatment. The plasmid containing isolates were subjected to a polymerase chain reaction (PCR) for investigating the presence of plasmid mediated verotoxin gene (VT1 and VT2) in non-O157 E. coli. Among the 137 E. coli isolates, 49 isolates were non-O157 E. coli while 29 (59.1%) isolates were verotoxin producing non-O157 serotypes and 26 non-O157 VTEC isolates possessed plasmids. Certain isolates harboured single sized plasmid while others had multiple plasmids with different size varied from 1.8kb to 7.6kb. A plasmid containing all (100%) the isolates was multidrug-resistant. Eight isolates changed their susceptibility patterns while three isolates were found to lose plasmid after post plasmid curing treatment and the rest of the isolates (15) remained constant. Different PCR sets characterized 3 plasmid-mediated verotoxins producing non-O157 E. coli. This current study demonstrated the occurrence of plasmid mediated verotoxin gene in non-O157 E. coli. To the best of our knowledge, this is the first report in the global literature on plasmid-mediated verotoxin gene in non-O157 E. coli. Timely diagnosis and surveillance of VTEC infections should prioritize to stop or slow down the virulence gene for dissemination by plasmid-mediated gene transfer amongst the same bacteria or other species.

scholarly journals Molecular Characterization of Commensal Escherichia coli Adapted to Different Compartments of the Porcine Gastrointestinal Tract

2012 ◽  
Vol 78 (19) ◽  
pp. 6799-6803 ◽  
Author(s):  
Sam Abraham ◽  
David M. Gordon ◽  
James Chin ◽  
Huub J. M. Brouwers ◽  
Peter Njuguna ◽  
...  
Keyword(s):  
Escherichia Coli ◽  
Gastrointestinal Tract ◽  
Random Amplified Polymorphic Dna ◽  
Content Type ◽  
E Coli ◽  
Plasmid Replicon ◽  
Different Strains ◽  
Different Characteristics

ABSTRACTThe role ofEscherichia colias a pathogen has been the focus of considerable study, while much less is known about it as a commensal and how it adapts to and colonizes different environmental niches within the mammalian gut. In this study, we characterizeEscherichia coliorganisms (n= 146) isolated from different regions of the intestinal tracts of eight pigs (dueodenum, ileum, colon, and feces). The isolates were typed using the method of random amplified polymorphic DNA (RAPD) and screened for the presence of bacteriocin genes and plasmid replicon types. Molecular analysis of variance using the RAPD data showed thatE. coliisolates are nonrandomly distributed among different gut regions, and that gut region accounted for 25% (P< 0.001) of the observed variation among strains. Bacteriocin screening revealed that a bacteriocin gene was detected in 45% of the isolates, with 43% carrying colicin genes and 3% carrying microcin genes. Of the bacteriocins observed (H47, E3, E1, E2, E7, Ia/Ib, and B/M), the frequency with which they were detected varied with respect to gut region for the colicins E2, E7, Ia/Ib, and B/M. The plasmid replicon typing gave rise to 25 profiles from the 13 Inc types detected. Inc F types were detected most frequently, followed by Inc HI1 and N types. Of the Inc types detected, 7 were nonrandomly distributed among isolates from the different regions of the gut. The results of this study indicate that not only may the different regions of the gastrointestinal tract harbor different strains ofE. colibut also that strains from different regions have different characteristics.

Sign in / Sign up

Export Citation Format

Share Document