Synthesis of Nanomaterials Involving Microemulsion and Miceller Medium

2018 ◽  
pp. 273-290
Author(s):  
Santosh Kumar ◽  
Mohammad Y. Wani ◽  
Joonseok Koh
Keyword(s):  
Synthesis Of Nanomaterials

Green synthesis of nanomaterials for early lung cancer detection

2018 ◽  
pp. 1-1
Keyword(s):  
Lung Cancer ◽  
Green Synthesis ◽  
Cancer Detection ◽  
World Wide ◽  
Early Stage ◽  
Age Groups ◽  
Early Lung Cancer ◽  
Lung Cancer Detection ◽  
Synthesis Of Nanomaterials

Lung cancer is the foremost cause of cancer-related deaths world-wide [1]. It affects 100,000 Americans of the smoking population every year of all age groups, particularly those above 50 years of the smoking population [2]. In India, 51,000 lung cancer deaths were reported in 2012, which include 41,000 men and 10,000 women [3]. It is the leading cause of cancer deaths in men; however, in women, it ranked ninth among all cancerous deaths [4]. It is possible to detect the lung cancer at a very early stage, providing a much higher chance of survival for the patients.

Hydrothermal Treatment Management of High Alumina Waste for Synthesis of Nanomaterials with New Morphologies

2017 ◽  
Vol 66 (5) ◽  
pp. 172-179 ◽  
Author(s):  
H. H. Abo-Almaged ◽  
A. F. Moustafa ◽  
A. M. Ismail ◽  
S. K. Amin ◽  
M. F. Abadir
Keyword(s):  
Hydrothermal Treatment ◽  
High Alumina ◽  
Treatment Management ◽  
Synthesis Of Nanomaterials

scholarly journals Aloe Vera-Mediated Te Nanostructures: Highly Potent Antibacterial Agents and Moderated Anticancer Effects

Nanomaterials ◽  
2021 ◽  
Vol 11 (2) ◽  
pp. 514
Author(s):  
David Medina-Cruz ◽  
Ada Vernet-Crua ◽  
Ebrahim Mostafavi ◽  
María Ujué González ◽  
Lidia Martínez ◽  
...  
Keyword(s):  
Biomedical Applications ◽  
Aqueous Media ◽  
Aloe Vera ◽  
Multidrug Resistant ◽  
Dermal Fibroblasts ◽  
Anticancer Properties ◽  
Green Approach ◽  
Anticancer Effects ◽  
Synthesis Of Nanomaterials ◽  
By Products

Cancer and antimicrobial resistance to antibiotics are two of the most worrying healthcare concerns that humanity is facing nowadays. Some of the most promising solutions for these healthcare problems may come from nanomedicine. While the traditional synthesis of nanomaterials is often accompanied by drawbacks such as high cost or the production of toxic by-products, green nanotechnology has been presented as a suitable solution to overcome such challenges. In this work, an approach for the synthesis of tellurium (Te) nanostructures in aqueous media has been developed using aloe vera (AV) extracts as a unique reducing and capping agent. Te-based nanoparticles (AV-TeNPs), with sizes between 20 and 60 nm, were characterized in terms of physicochemical properties and tested for potential biomedical applications. A significant decay in bacterial growth after 24 h was achieved for both Methicillin-resistant Staphylococcus aureus and multidrug-resistant Escherichia coli at a relative low concentration of 5 µg/mL, while there was no cytotoxicity towards human dermal fibroblasts after 3 days of treatment. AV-TeNPs also showed anticancer properties up to 72 h within a range of concentrations between 5 and 100 µg/mL. Consequently, here, we present a novel and green approach to produce Te-based nanostructures with potential biomedical applications, especially for antibacterial and anticancer applications.

Plasma Synthesis of Nanomaterials

2019 ◽  
pp. 2-1-2-19 ◽  
Author(s):  
Antaryami Mohanta ◽  
Raj K. Thareja
Keyword(s):  
Plasma Synthesis ◽  
Synthesis Of Nanomaterials

scholarly journals Síntesis y caracterización de nanopartículas de oro y su funcionalización con sondas específicas de DNA de Achlya sp. y Escherichia coli

2015 ◽  
Author(s):  
◽  
Blanca Estela Chavez-Sandoval
Keyword(s):  
Escherichia Coli ◽  
Good Alternative ◽  
Noble Metal Nanoparticles ◽  
Biological Synthesis ◽  
Target Sequence ◽  
Inorganic Synthesis ◽  
Fish Farms ◽  
E Coli ◽  
Synthesis Of Nanomaterials

The pick in the use of noble metal nanoparticles (NPs) in various fields has resulted in inorganic synthesis of metal NPs, however the methodologies used for their preparation are generally expensive and involve the use of hazardous chemicals, is why has recently increased the development of sustainable and environmentally friendly alternatives. Synthesize biologically AuNPs is easy, inexpensive and is less damaging to the environment. The use of plant extracts for the synthesis of nanomaterials has not yet been fully explored, however represents a good alternative as well as the aforementioned advantages are obtained stable NPs of different size and shape. In this work the synthesis and characterization of AuNPs wasnperformed, and their functionalization with specific DNA probes of two microorganisms of environmental interest Achlya sp. and Escherichia coli (E. coli). Achlya sp. is a fungus that infects fish farms, aquariums and natural reservoirs; E coli is a bacteria pathogenic to humans and is a source of contamination in food and water. The DNA probe or target sequence designed to Achlya sp. is: 5’ GCACCGGAAGTACAGACCAA 3’ and E. coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ The AuNPs obtained by chemical synthesis and biological synthesis extracts from laurel, nopal, onion, pear and coffee were functionalized with DNA Achlya sp. and E. coli and can be used in the design and construction of biosensors for detecting environmental microorganisms before mentioned, except NPs coffee at pH 9, as these do not show a good functionalization. Furthermore it is proposed that for the biological synthesis, malic acid may be acting as a reducing agent and the amino group as a stabilizing agent. Finally, the genosensors allow monitoring, preventing and correcting issues that cause ecological imbalances in aquatic environments. These new analytical devices provide information quickly, simple and inexpensive compared with conventional analysis techniques.

Green Synthesis of Nanomaterials Using Biological Routes

2014 ◽  
pp. 329-348
Author(s):  
Rajesh Ramanathan ◽  
Ravi Shukla ◽  
Suresh K. Bhargava ◽  
Vipul Bansal
Keyword(s):  
Green Synthesis ◽  
Synthesis Of Nanomaterials
Sign in / Sign up

Export Citation Format

Share Document