Chickpea (Cicer arietinum L.) is an important rotational and an emerging specialty crop in the Pacific Northwest of the United States, in California, and in the Northern Great Plains of the United States and Canada. Dodders (Cuscuta spp.) are widespread parasitic weeds on many crops worldwide. Several Cuscuta species (primarily C. campestris Yuncker) have been reported to parasitize chickpea, and dodder is important on chickpea in the Indian subcontinent, the Middle East, and recently in Australia (4), but has previously not been reported from North America. On 28 July 2012, a chickpea field near Walla Walla, WA, was found parasitized by dodder. The chickpea was at late flowering and early pod filling stages and there were no other visible green weedy plants as observed from the canopy. There were about 15 dodder colonies varying in size from 2 to 15 meters in diameter in the field of about 500 acres. Chickpea plants in the center of the dodder colonies were wilting or dead. The colonies consisted of orange leafless twining stems wrapped around chickpea stems and spreading between chickpea plants. Haustoria of the dodder penetrating chickpea stems were clearly visible to the naked eye. Flowers, formed abundantly in dense clusters, were white and five-angled, with capitate stigmas, and lobes on developing calyxes were clearly overlapping. The dodder keyed to C. pentagona Engelm. in Hitchcock and Cronquest (3) and in Costea (1; and www.wlu.ca/page.php?grp_id=2147&p=8968 ). Specimens of dodder plants wrapping around chickpea stems with visible penetrating haustoria were collected on 28 July 2013 and vouchers (WS386115, WS386116, and WS386117) were deposited at the Washington State University Ownbey Herbarium. All dodder colonies in the field were eradicated before seed formation to prevent establishment of dodder. Total genomic DNA was isolated from dodder stems, and PCR primers ITS1 (5′TCCGTAGGTGAACCTGCGG) and ITS4 (5′TCCTCCGCTTATTGATATGC) were used to amplify the internal transcribed spacer (ITS) region of the nuclear rDNA. The ITS region was sequenced. BLAST search of the NCBI nucleotide database using the ITS sequence as query found that the most similar sequence was from C. pentagona (GenBank Accession No. DQ211589.1), and our ITS sequence was deposited in GenBank (KC832885). Dodder (C. approximata Bab.) has been historically a regional problem on alfalfa (Washington State Noxious Weed Control Board 2011). Another species stated to be “mainly” associated with legumes is C. epithymum Murr., and C. pentagona is “especially” associated with legumes (3). The latter species has sometimes been considered a variety (var. calycina) of C. campestris Yuncker (1,3). Although chickpea has been cultivated in the Walla Walla region for over 20 years, to our knowledge, this is the first time dodder has been observed on chickpea in North America. The likely source is from nearby alfalfa or other crop fields, with transmission by farm machinery or wild animals. Some chickpea germplasm exhibits partial resistance to C. campestris (2). References: (1) M. Costea et al. SIDA 22:151, 2006. (2) Y. Goldwasser et al. Weed Res. 52:122, 2012. (3) C. L. Hitchcock and A. Cronquist. Flora of the Pacific Northwest: An Illustrated Manual. University of Washington Press, Seattle, 1973. (4) D. Rubiales et al. Dodder. Page 98 in: Compendium of Chickpea and Lentil Diseases and Pests. W. Chen et al., eds. APS Press, St. Paul, Minnesota, 2011.
Risk Assessment for Karnal Bunt Occurrence in the Pacific Northwest