scholarly journals The First Report of Stolbur Phytoplasma Associated with Phyllody of Calendula officinalis in Serbia

Plant Disease ◽  
2014 ◽  
Vol 98 (8) ◽  
pp. 1152-1152 ◽  
Author(s):  
S. Pavlovic ◽  
M. Starovic ◽  
S. Stojanovic ◽  
G. Aleksic ◽  
S. Kojic ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Natural Infection ◽  
Cytotoxic Activities ◽  
Rrna Gene ◽  
Calendula Officinalis ◽  
Aster Yellows ◽  
First Report ◽  
Pot Marigold ◽  
Stolbur Phytoplasma

Pot marigold (Calendula officinalis L.) is native to southern Europe. Compounds of marigold flowers exhibit anti-inflammatory, anti-tumor-promoting, and cytotoxic activities (4). In Serbia, pot marigold is cultivated as an important medicinal and ornamental plant. Typical phyllody, virescence, proliferation of axillary buds, and witches' broom symptoms were sporadically observed in 2011 in Pancevo plantation, Serbia (44°51′49″ N, 20°39′33″ E, 80 m above sea level). Until 2013, the number of uniformly distributed affected pot marigold plants reached 20% in the field. Due to the lack of seed production, profitability of the cultivation was seriously affected. Leaf samples from 10 symptomatic and 4 symptomless marigold plants were collected and total nucleic acid was extracted from midrib tissue (3). Direct PCR and nested PCR were carried out with primer pairs P1/16S-SR and R16F2n/R16R2n, respectively (3). Amplicons 1.5 and 1.2 kb in length, specific for the 16S rRNA gene, were amplified in all symptomatic plants. No PCR products were obtained when DNA isolated from symptomless plants was used. Restriction fragment length polymorphism (RFLP) patterns of the 1.2-kb fragments of 16S rDNA were determined by digestion with four endonucleases separately (TruI1, AluI, HpaII, and HhaI) and compared with those of Stolbur (Stol), Aster Yellows (AY), Flavescence dorée-C (FD-C), Poinsettia Branch-Inducing (PoiBI), and Clover Yellow Edge (CYE) phytoplasmas (2). RFLP patterns from all symptomatic pot marigold plants were identical to the Stol pattern, indicating Stolbur phytoplasma presence in affected plants. The 1.2-kb amplicon of representative Nv8 strain was sequenced and the data were submitted to GenBank (accession no. KJ174507). BLASTn analysis of the sequence was compared with sequences available in GenBank, showing 100% identity with 16S rRNA gene of strains from Paeonia tenuifolia (KF614623) and corn (JQ730750) from Serbia, and peach (KF263684) from Iran. All of these are members of the 16SrXII ‘Candidatus Phytoplasma solani’ group, subgroup A (Stolbur). Phytoplasmas belonging to aster yellows (16SrI) (Italy and Canada) and peanut witches' broom related phytoplasma (16SrII) group (Iran) have been identified in diseased pot marigold plants (1). To our knowledge, this is the first report of natural infection of pot marigold by Stolbur phytoplasma in Serbia. References: (1) S. A. Esmailzadeh-Hosseini et al. Bull. Insectol. 64:S109, 2011. (2) I. M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998. (3) J. P. Prince. Phytopathology 83:1130, 1993. (4) M. Ukiya et al. J. Nat. Prod. 69:1692, 2006.

scholarly journals First Report of Blueberry Reddening Disease in Serbia Associated with 16SrXII-A (Stolbur) Phytoplasma

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1653-1653 ◽  
Author(s):  
M. Starović ◽  
S. Kojic ◽  
S. T. Kuzmanovic ◽  
S. D. Stojanovic ◽  
S. Pavlovic ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Nested Pcr ◽  
Vaccinium Corymbosum ◽  
23S Rrna ◽  
Rrna Gene ◽  
Restriction Enzyme Digestion ◽  
First Report ◽  
Stolbur Phytoplasma ◽  
The 16S Rrna Gene

Blueberries (Vaccinium corymbosum) are among the healthiest fruits due to their high antioxidant content. The total growing area of blueberries in Serbia ranges from 80 to 90 ha. A phytoplasma-like disease was observed for the first time during July 2009 in three blueberry cultivars (Bluecrop, Duke, and Spartan) grown in central Serbia, locality Kopljare (44°20′10.9″ N, 20°38′39.3″ E). Symptoms of yellowing and reddening were observed on the upper leaves and proliferating shoots, similar to those already described on blueberries (4). There was uneven ripening of the fruits on affected plants. Incidence of affected plants within a single field was estimated to be greater than 20% in 2009 and 50% in 2010. Blueberry leaves, together with petioles, were collected during two seasons, 2009 and 2010, and six samples from diseased plants and one from symptomless plants from each cultivar, resulting in 42 samples in total. For phytoplasma detection, total DNA was extracted from the veins of symptomatic and asymptomatic leaves of V. corymbosum using the protocol of Angelini et al. (1). Universal oligonucleotide primers P1/P7 were used to amplify a 1.8-kb DNA fragment containing the 16S rRNA gene, the 16S-23S spacer region, and the 5′ end of the 23S rRNA gene. Subsequently, a 1.2-kb fragment of the 16S rRNA gene was amplified by nested PCR with the R16F2n/R16R2 primers. Reactions were performed in a volume of 50 μl using Dream Taq Green master mix (Thermo Scientific, Lithuania). PCR reaction conditions were as reported (3), except for R16F2n/R2 primers set (annealing for 30 s at 58°C). PCR products were obtained only from the DNA of symptomatic plants. Fragments of 1.2 kb were further characterized by the PCR-RFLP analysis, using AluI, HpaII, HhaI, and Tru1I restriction enzymes (Thermo Scientific, Lithuania), as recommended by the manufacturer. The products of restriction enzyme digestion were separated by electrophoresis on 2.5% agarose gel. All R16F2n/R2 amplicons showed identical RFLP patterns corresponding to the profile of the Stolbur phytoplasma (subgroup 16SrXII-A). The results were confirmed by sequencing the nested PCR product from the representative strain Br1. The sequence was deposited in NCBI GenBank database under accession number KC960486. Phylogenetic analysis showed maximal similarities with SH1 isolate from Vitis vinifera, Jordan (KC835139.1), Bushehr (Iran) eggplant big bud phytoplasma (JX483703.1), BA strain isolated from insect in Italy (JQ868436.1), and also with several plants from Serbia: Arnica montana L. (JX891383.1), corn (JQ730750.1), Hypericum perforatum (JQ033928.1), tobacco (JQ730740.1), etc. In conclusion, our results demonstrate that leaf discoloration of V. corymbosum was associated with a phytoplasma belonging to the 16SrXII-A subgroup. The wild European blueberry (Vaccinium myrtillus L.) is already detected as a host plant of 16SrIII-F phytoplasma in Germany, North America, and Lithuania (4). The main vector of the Stolbur phytoplasma, Hyalesthes obsoletus Signoret, was already detected in Serbia (2). The first report of Stolbur phytoplasma occurrence on blueberry in Serbia is significant for the management of the pathogen spreading in blueberry fields. Since the cultivation of blueberry has a great economic potential in the region, it is important to identify emerging disease concerns in order to ensure sustainable production. References: (1) E. Angelini et al. Vitis 40:79, 2001. (2) J. Jović et al. Phytopathology 99:1053, 2009. (3) S. Pavlovic et al. J. Med. Plants Res. 6:906, 2012. (4) D. Valiunas et al. J. Plant Pathol. 86:135, 2004.

scholarly journals First Report of Stolbur Phytoplasma Associated with Maize Redness Disease of Maize in Bosnia and Herzegovina

Plant Disease ◽  
2014 ◽  
Vol 98 (3) ◽  
pp. 418-418 ◽  
Author(s):  
M. Kovačević ◽  
Z. Đurić ◽  
J. Jović ◽  
G. Perković ◽  
B. Lolić ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Bosnia And Herzegovina ◽  
Nested Pcr ◽  
Wheat Crop ◽  
Rrna Gene ◽  
First Report ◽  
Tuf Gene ◽  
Maize Plants ◽  
Stolbur Phytoplasma

Maize redness (MR), caused by stolbur phytoplasma (16SrXII-A, ‘Candidatus phytoplasma solani’) and vectored by the cixiid planthopper Reptalus panzeri (Löw), is a severe and emerging disease of maize in southeastern Europe (2). Symptoms of MR include midrib, leaf, and stalk reddening, followed by desiccation of the entire plant, abnormal ear development, and incomplete kernel set. MR may cause significant economic losses (2). During 2010, 2011, and 2012, the presence of MR-like symptoms on maize accompanied by significant yield losses were frequently observed in maize fields in the Semberija region of northeastern Bosnia and Herzegovina. From mid-June to early July, potential vectors were collected using mouth-aspirators from maize plants in fields at three locations in the Semberija region where MR-like symptoms were previously observed. At the end of July, symptomatic maize plants were collected from six fields in the same region for phytoplasma identification. In addition, we sampled asymptomatic johnsongrass (Sorghum halepense L.), bindweed (Convolvulus arvensis L.), and volunteer wheat (Triticum aestivum L.) in areas adjacent to maize fields with MR-like symptoms, as potential phytoplasma reservoirs (2,3). A total of 49 plants (38 maize, 6 johnsongrass, 3 bindweed, and 2 wheat) and 43 R. panzeri were tested for the presence of stolbur phytoplasma. Leaves of four maize seedlings, grown in insect-proof greenhouse conditions, were used as controls. Total DNA was extracted from roots of each plant and R. panzeri using the CTAB methods (2). Initial phytoplasma detection was conducted on 16S rRNA gene using nested PCR assay with phytoplasma universal primers P1/P7 and F2n/R2 (4). Subsequently, all phytoplasma positive samples were retested employing stolbur-specific Stol11 protocol with the f2r/f3r2 primer set (1). Molecular characterization of identified phytoplasmas was performed by PCR-RFLP analysis of the tuf gene (3) and by sequence analyses of the 16S rRNA nested PCR products (GenBank Accession No. KC852868). All samples that tested positive on 16S rRNA gene using phytoplasma generic primers gave positive reaction in assays with stolbur-specific primers. Stolbur phytoplasma was identified in 36 of 49 plant samples (34 of 38 symptomatic maize plants and in 2 of 6 johnsongrass) and in 2 of 43 R. panzeri individuals. None of the control plants, bindweed, or wheat samples were positive for the presence of any phytoplasma. Tuf gene RFLP analyses enabled affiliation of all isolates to the stolbur type tuf-b. Comparison of the 16S rRNA sequence using BLAST analyses further confirmed identification of the phytoplasmas as being ‘Candidatus phytoplasma solani.’ The obtained sequence showed 100% identity with ‘Candidatus phytoplasma solani’ from corn in Serbia (JQ730750). These data clearly demonstrated association of stolbur phytoplasma with MR symptoms on maize in Semberija, which represents the first report of the MR disease and stolbur phytoplasma in maize, R. panzeri, and johnsongrass in Bosnia and Herzegovina. In the Semberija region, maize-wheat crop rotation is a traditional practice, which is a key factor for MR occurrence and persistence (2). References: (1) D. Clair et al. Vitis 42:151, 2003. (2) J. Jović et al. Phytopathology 99:1053, 2009. (3) M. Langer and M. Maixner. Vitis 43, 191, 2004. (4) I. M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998.

scholarly journals First Report of a Natural Infection of Stevia rebaudiana by a Group 16SrXXIV Phytoplasma in India

Plant Disease ◽  
2011 ◽  
Vol 95 (12) ◽  
pp. 1582-1582 ◽  
Author(s):  
A. Samad ◽  
S. Dharni ◽  
M. Singh ◽  
S. Yadav ◽  
A. Khan ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Gene Sequence ◽  
Natural Infection ◽  
Stevia Rebaudiana ◽  
16S Rrna Gene Sequence ◽  
Rrna Gene ◽  
Rrna Gene Sequence ◽  
First Report ◽  
Wide Range

Stevia rebaudiana Bertoni (Asteraceae) is one of the most important commercial crops in the world (4). It is known to produce glycosides that are as much as 300 times sweeter than sucrose and do not affect blood sugar levels. Unlike artificial sweeteners like saccharin, they are noncarcinogenic and safe for diabetics. An unknown disease emerged during the summers of 2007 to 2009 in a field of S. rebaudiana at CIMAP Lucknow, India, where more than 20% of the plants exhibited symptoms typical of phytoplasma infection including leaf yellowing, reduced size of leaves, shoot proliferation, flower bud deficiency, as well as bushy and stunted growth. Some of these plants were potted and kept in a glasshouse for investigation. Affected plants in the field expressed a quick decline consisting of growth cessation, bronzing of mature leaves, wilting, and death, resulting in a significant reduction in biomass and quality. Typical phytoplasma-like (pleomorphic) bodies ranging from 450 to 900 nm were observed in the phloem cells of infected plants by transmission electron microscopy (1). These bodies were always found in diseased plants, but not in asymptomatic ones. No other microorganisms were noted. Total DNA was extracted from symptomatic as well as asymptomatic plants by a CTAB method. PCR was carried out with the universal phytoplasma primers P1/P6 (P1, 5′-AAGAGTTTGATCCTGGCTCAGGATT-3′; P6, 5′-CGGTAGGGATACCTTGTTACGACTTA-3′) (2) followed by nested primers R16F2n/R16R2 (R16F2n, 5′-GAAACGACTGCTAAGACTGG-3′; R16R2, 5′-TGACGGGCGGTGTGTACAAACCCCG-3′) targeting the 16S rRNA gene sequence (3). The P1/P6 and R16F2n/R16R2 primers produced the expected 1.5- and 1.2-kb amplicons, respectively, from the symptomatic plants and not from the asymptomatic ones. Seventeen symptomatic and eight asymptomatic samples were analyzed through PCR. Nested PCR products were ligated into the plasmid vector using the TOPO TA Cloning Kit (Invitrogen, Carlsbad, CA). Transformation and selection of recombinant clones was carried out according to the manufacturer's recommended protocol. The sequence obtained from the final PCR product was deposited in the GenBank database (No. JF970603). It was analyzed through the iPhyClassifier ( http://plantpathology.ba.ars.usda.gov/cgi-bin/resource/iphyclassifier.cgi ) online tool and found to share 98.2% similarity with that of the ‘Sorghum bunchy shoot phytoplasma’ reference strain (GenBank No. AF509322) that belongs to 16SrXXIV-A subgroup. The virtual restriction fragment length polymorphism pattern of the S. rebaudiana phytoplasma 16S rRNA gene sequence showed maximum similarity to the reference pattern of AF509322 (similarity coefficient of 0.85). Although a number of phytoplasmas have been detected on a wide range of plants in India, little is known about the leafhopper that presumably transmits them to S. rebaudiana and other medicinal crops. Infections by diverse phytoplasma strains/species underscore the need for phytoplasma-free planting stock and intensification of research efforts to reduce ecological and economic impacts of these phytoplasmas. To our knowledge, this is the first report of a natural infection of S. rebaudiana by a group of 16SrXXIV-A phytoplasma. References: (1) P. V. Ajayakumar et al. Aust. Plant Dis. Notes 2:67, 2007. (2) S. Deng and C. Hiruki. J. Microbiol. Methods 14:53, 1991. (3) D. E. Gundersen and I. M. Lee. Phytopathol. Mediterr. 35:144, 1996. (4) S. M. Savita et al. J. Hum. Ecol. 15:261, 2004.

scholarly journals First Report of Group 16SrXII-A Phytoplasma Causing Stolbur Disease in Saponaria officinalis Plants in Serbia

Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 420-420 ◽  
Author(s):  
D. Josic ◽  
M. Starovic ◽  
S. Stojanovic ◽  
T. Popovic ◽  
N. Dolovac ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Nested Pcr ◽  
Gene Sequence ◽  
16S Rrna Gene Sequence ◽  
Rrna Gene ◽  
Rrna Gene Sequence ◽  
First Report ◽  
Stolbur Phytoplasma ◽  
Saponaria Officinalis

Saponaria officinalis L. (Caryophyllaceae; also known as bouncingbet or soapwort) is a perennial medicinal plant important for the pharmaceutical industry and used as an expectorant, alterative, laxative, and ointment for some skin diseases and arthritic conditions. S. officinalis plants with typical symptoms (23% in 2011 and 47% in 2012) of phytoplasma infection were observed in Pancevo plantation, Serbia. The symptoms appeared in May with leaves changing color from green to brown with severe reddening and necrosis. Severely diseased plants died. The infected plants had a significant reduction in biomass and quality. To investigate the presence of phytoplasma, total DNA was extracted from 10 symptomatic and four asymptomatic plants by a CTAB method. The nested PCR was carried out using phytoplasma-specific primer set P1/16S-SR followed by R16F2n/R16R2, targeting the 16S rRNA gene sequence of 1.5 and 1.2 kb in length, respectively. The amplicons of expected size were obtained from the symptomatic plants, but not from the asymptomatic plants. To obtain restriction fragment length polymorphism (RFLP) patterns, the R16F2n/R2 amplicons were digested with AluI, TruI1, HpaII, and HhaI endonucleases. The resulting patterns indicated that seven plants were infected by a Stolbur phytoplasma belonging to the 16SrXII-A subgroup, since it had the identical RFLP pattern as the STOL reference strain. The 1.2 kb nested PCR products of representative isolate Sap7 were purified using PCR purification kit (Fermentas, Vilnius, Lithuania) according to the recommended protocol and sequenced using facilities of IMGGI SeqService, Belgrade, Serbia. The obtained sequence was deposited in the NCBI database (GenBank Accession No. JX866951). The phytoplasma 16S rRNA gene sequence from Sap7 had a sequence identity of 97% with GenBank accessions GQ273961.1 (‘Euonymus japonicus’ phytoplasma), JX311953.1 (Candidatus Phytoplasma solani clone 5043), JQ412100.1 (Iranian alfalfa phytoplasma M21), and JN561702.1 (‘Convolvulus arvensis’ stolbur phytoplasma clone P1/P7-Conv2/2010-Bg). To our knowledge, this is the first report of a natural infection of S. officinalis by 16SrXII-A subgroup (Stolbur) phytoplasma in Serbia. As cited by Lee et al. (1), the 16SrI-M subgroup phytoplasma in S. officinalis sample was already detected in Lithuania by Valiunas (2). The identification of phytoplasma in the Pancevo plantation caused the intensification of our biological control tests and efforts to reduce the ecological and economic impacts of these phytoplasmas. References: (1) I. M. Lee et al. Int. J. Syst. Evol. Microbiol. 54:1037, 2004. (2) D. Valiunas. PhD thesis, Institute of Botany, Vilnius, Lithuania, 2003.

scholarly journals First Report of Bacterial Stalk Rot of Maize Caused by Dickeya zeae in Mexico

Plant Disease ◽  
2014 ◽  
Vol 98 (9) ◽  
pp. 1267-1267 ◽  
Author(s):  
B. A. Martinez-Cisneros ◽  
G. Juarez-Lopez ◽  
N. Valencia-Torres ◽  
E. Duran-Peralta ◽  
M. Mezzalama
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Pathogenic Bacteria ◽  
The State ◽  
Rrna Gene ◽  
Bacterial Disease ◽  
Sterile Water ◽  
First Report ◽  
Stalk Rot ◽  
Positive Controls

A bacterial disease of maize, bacterial stalk and top rot, was found in the state of Morelos in February 2011, and in the state of Puebla in July 2013, Mexico. In both cases, the incidence of diseased plants was lower than 0.5%. The typical symptoms were a soft rot and darkening of the tissues affecting the stalk and the top of the plant, causing breaking of the stalk. The lesions progressed from the top to below nodes, leaf sheaths and blades, and rotten tissues emitted an unpleasant odor. Eleven diseased plants were collected, and bacterial colonies were isolated from fragments detached from the edges of symptomatic tissues after sterilization with a 0.5% solution of NaClO for 30 s, rinsing three times in sterile water. The sterilized fragments were macerated in drops of distilled sterile water for 10 min and the extract was streaked on King's medium B (agar 15 g, distilled water 1,000 ml, proteose peptone 20 g, K2HPO4 1.5 g, MgSO4·7H2O 1.5 g, glycerol 10 ml). Eight representative strains from Morelos and five from Puebla were selected for identification. All strains were gram-negative, grew at 37°C, showed pectynolitic activity on potato tubers, were positive for indole production, utilized arabinose, galactose, glucose, glycerol, lactose, mannose, melibiose, rafinose, ribose, and sucrose but did not produce acid from arabitol, adonitol, and keto-methyl-glucoside (3,4). Pathogenicity tests were conducted with each strain by inoculating with a syringe four 25-day-old maize seedlings with 107 CFU ml–1 bacterial cells in the leaf collar. Plants were incubated in the greenhouse at 30°C during the day and 24°C during the night with a 12-h photoperiod, and relative humidity of 93%. The reference strains Erwinia chrysanthemi pv zeae ATTC29942 and Dickeya zeae CFBP 2052 were used as positive controls in laboratory and greenhouses tests. Sterile water was used as negative control. Two days after inoculation, soft stalk rot symptoms developed that were identical to those observed in the field. No symptoms were observed on the negative controls. Diagnostic amplification of DNA by conventional PCR was carried out and yielded the expected amplicon size of 420 bp of the Dickeya-specific pel gene with the ADE primers set (2). PCR was used to amplify the 16S rRNA gene with the universal primers 27f and 1495r (5) for molecular identification of the 13 strains (GenBank Accession Nos. KJ438941, KJ438942, KJ438943, KJ438944, KJ438945, KJ438946, KJ438947, KJ438948, KJ438949, KJ438950, KJ438951, KJ438952, and KJ438953). The strains D. zeae CFBP 2052 and E. chrysanthemi pv. zeae ATCC 29942 were sequenced as positive controls. A BLAST search with the 13 16S rRNA gene sequences of 1.4 kb were 99% identical to the sequence of D. zeae CFBP 2052 (NR_041923). D. zeae can be a major disease of maize in tropical and subtropical countries. It is particularly severe under conditions of high temperature and high humidity, but it occurs sporadically. Control of the vector, Chilo partellus, can aid disease management (1). To our knowledge, this is the first report of D. zeae causing maize stalk rot in Mexico. References: (1) CABI. Crop Prot. Compend. CAB International, Wallingford, UK, 2014. (2) A. Nassar et al. Appl. Environ. Microbiol. 62:2228, 1996. (3) R. Samson et al. Int. J. Syst. Evol. Microbiol. 55:1415, 2005. (4) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. APS Press, St. Paul, MN, 2001. (5) W. G. Weisburg. J. Bacteriol. 173:697, 1991.

scholarly journals ‘Candidatus Phytoplasma lycopersici’, a phytoplasma associated with ‘hoja de perejil’ disease in Bolivia

2007 ◽  
Vol 57 (8) ◽  
pp. 1704-1710 ◽  
Author(s):  
Yaima Arocha ◽  
Olivia Antesana ◽  
Ernesto Montellano ◽  
Pablo Franco ◽  
G. Plata ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Sequence Similarity ◽  
Rrna Gene ◽  
Diseased Plant ◽  
Gene Sequences ◽  
16S Rrna Gene Sequences ◽  
Aster Yellows ◽  
Initial Identification ◽  
Native Weeds

New diseases known locally as ‘hoja de perejil’ of tomato (Lycopersicon esculentum Mill) and ‘brotes grandes’ of potato (Solanum tuberosum L.) were first recognized in surveys of production fields in Bolivia during 2000–2003. Alfalfa (Medicago sativa) witches' broom and little leaf diseases of native weeds Morrenia variegata and mora-mora (Serjania perulacea) were also identified near to production fields. Phytoplasma aetiology was attributed to each of these diseases following detection and initial identification of aster yellows group (16SrI) phytoplasmas in all five diseased plant species. While potato, alfalfa and mora-mora plants contained indistinguishable 16SrI-B strains, ‘hoja de perejil’ (THP) and morrenia little leaf (MVLL)-associated phytoplasma strains shared 97.5 % 16S rRNA gene sequence similarity with ‘Candidatus Phytoplasma asteris’ and related strains and <95 % similarity with all other ‘Candidatus Phytoplasma’ species. Phylogenetic analysis of 16S rRNA gene sequences indicated that the THP and MVLL phytoplasmas represent a novel lineage within the aster yellows (16SrI) group and, on the basis of unique 16S rRNA gene sequences, we propose that THP and MVLL phytoplasmas represent ‘Candidatus Phytoplasma lycopersici’, with THP as the reference strain.

Down into the Earth: microbial diversity of the deepest cave of the world

Biologia ◽  
2015 ◽  
Vol 70 (8) ◽  
Author(s):  
Ieva Kieraite-Aleksandrova ◽  
Vilius Aleksandrovas ◽  
Nomeda Kuisiene
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Microbial Diversity ◽  
Bacterial Diversity ◽  
Independent Method ◽  
Rrna Gene ◽  
Sampling Depth ◽  
First Report ◽  
The Earth ◽  
The World

AbstractIn our work, microbial diversity of Krubera-Voronja cave was evaluated in the view of the frequency of human visits in different locations as well as the sampling depth. Sampling in this cave was performed at depths of 220 m to 1640 m. Cultivation-independent method, namely barcoded pyrosequencing of 16S rRNA gene, was used for this analysis. Our results demonstrated high bacterial diversity at the phylum and genus levels. We have shown that the bacterial diversity at the phylum level depends on both the sampling depth and the frequency of human visits in Krubera-Voronja cave. Frequently visited locations were more diverse at the phylum level than the rarely visited branches. The total number of bacterial genera both per phylum and per sample correlated with the frequency of human visits but not with the sampling depth. Some genera, found in Krubera-Voronja cave, seem to be absent or very rare in other caves. The present study represents the first report on the microbial diversity in Krubera-Voronja cave

scholarly journals First Report of Rhodococcus fascians Causing Fasciation of Lilies (Lilium longiflorum Thunb.) in South Korea

Plant Disease ◽  
2020 ◽  
Author(s):  
Lim Yeon-Jeong ◽  
Hyun Gi Kong ◽  
Yong Hwan Lee ◽  
Hyun Ran Kim ◽  
Duck Hwan Park
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
South Korea ◽  
Rrna Gene ◽  
Post Inoculation ◽  
Pathogenicity Genes ◽  
First Report ◽  
Colony Pcr ◽  
Height Reduction ◽  
Rhodococcus Fascians

Rhodococcus fascians is a bacterium that causes growth abnormalities such as leafy galls, fasciation, and shoot proliferation in many plants, including ornamental plants. In February 2020, the Animal and Plant Quarantine Agency of South Korea detected 492,000 contaminated lily bulbs using an in-house PCR test based on the R. fascians fasD gene, and subsequently 1.3 million imported bulbs were destroyed. Because no pathogen isolation was associated with this diagnosis, there has been great cultivator demanded for bacterial isolation evidence of lily bulb infection with pathogenic R. fascians. To isolate the causal bacterium of the PCR tests, we sampled leaf, stem, and bulb tissues from 130 lilies with growth abnormality symptoms, collected from 24 South Korean mass production lily farms from June to August 2020. Supernatants of the homogenized samples were spread on mD2 medium (Kado and Heskett 1970) and incubated at 28°C for 10 days. Yellow to orange colonies were isolated into pure culture on mD2. Total DNA was extracted from cultures grown in yeast extract broth (YEB) at 28°C for 24 hours with Wizard DNA prep kit (Promega, Madison, WI, USA). PCR was performed to test for pathogenicity genes fas (A,D, and R) and att (A and R) (Putnam and Miller 2007). Colonies that produced at least one amplicon from these pathogenicity genes were analyzed by partial 16s rRNA gene sequencing to determine the corresponding species. Three strains that were isolated from the bulbs of fasciated lilies from Wanju (35°56´22.1˝N; 127°08´52.0˝E), Gwacheon (37°26´51.6˝N; 127°00´11.8˝E), and Yeongwol (37°18´45.8˝N; 128°11´05.6˝E), or W1, G3, and Y5 strains, yielded PCR products of the expected size for fas and att genes with the primer sets published in Serdani et al. (2013) and developed in this study (attAF: 5'–CCCGGCTACACGCATTCGC-3', attAR: 5'-CGAACGCGGTGTGCAGGT-3' and attRF: 5'-AGTGTCCCGTCGGCGAG-3', attRR: 5'-CGCGGCAGATCGAAGTCCT-3'). Sequences of the three strains were deposited in Genbank for fasA (accession MW122940-942), fasD (G3:MW122935 and 936), and fasR (MW122937-939); all shared 98.3 - 100% nucleotide identity to corresponding sequences from phytopathogenic R. fascians A25f (CP049745.1 Protein_ID fasA:QII09280.1, fasD:QII09282.1, and fasR:QII09277.1). The attA and attR products were only present in G3 (attA: MW122943 and attR: MW122944) and resulted in 100% identity to those of A25f (CP049745.1 Protein_ID attA:QII09269.1, attR:QII09267.1). Partial 16s rRNA gene sequences were obtained (MW064131-133) and clustered with phytopathogenic R. fascians strains D188, A21d2, and A25f. Thus we concluded that strains (W1, G3, and Y5) corresponded to R. fascians. To test the pathogenicity of these three strains, 10 seeds of garden peas for each strain were inoculated at 108 CFU/ml according to Nikolaeva et al. (2009), and the length of the main stem of each seedling was calculated 22 days post-inoculation. Seedlings inoculated with G3 and Y5 resulted in a stunted phenotype with up to 40% height reduction (p ≤ 0.001) compared to non-inoculated seedlings. As for the seedlings inoculated with W1, they exhibited as much as 15% height reduction (p ≤ 0.001). Colonies were recovered from the inoculated seedlings, identity was confirmed through colony PCR for fas and att genes. To our knowledge, this is the first report of phytopathogenic R. fascians in lilies cultivated in South Korea.

scholarly journals First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States

Plant Disease ◽  
2013 ◽  
Vol 97 (10) ◽  
pp. 1375-1375 ◽  
Author(s):  
B. Dutta ◽  
R. D. Gitaitis ◽  
F. H. Sanders ◽  
C. Booth ◽  
S. Smith ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Leaf Spot ◽  
Pathogenic Bacteria ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Pcr Assay ◽  
First Report ◽  
The 16S Rrna Gene

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds. References: (1) N. W. Schaad et al. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, third edition. APS Press. St. Paul, MN, 2001. (2) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (3) Leu et al. Plant Pathol. Bull. 19:137, 2010. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

Sign in / Sign up

Export Citation Format

Share Document