scholarly journals First report of root rot on Dendrobium officinale caused by Fusarium incarnatum-equiseti species complex in Zhejiang Province, China

Plant Disease ◽  
2021 ◽  
Author(s):  
Yihua Yang ◽  
Zhenyan Cao ◽  
Jintian Tang ◽  
Yang Song ◽  
Xuping Shentu ◽  
...  
Keyword(s):  
Rna Polymerase ◽  
Root Rot ◽  
Species Complex ◽  
Zhejiang Province ◽  
Dendrobium Officinale ◽  
Economic Losses ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Complex Span ◽  
First Report

Dendrobium officinale Kimura et Migo is a rare and valuable Chinese herb cultivated in Zhejiang and Yunnan Provinces, China, which is known for its functions as an anti-neoplastic and for lowering the blood sugar (Cheng et al., 2019). In September and October of 2018 and 2019, symptoms of root rot on D. officinale were observed with an incidence of 15–20% in Wuyi County, Zhejiang Province, China. The pathogen mainly infected roots causing severe root rot, which resulted in significant economic losses. At the early stage of this disease, the stalk turned brown, then the whole plant rotted from bottom to top within a few days. Symptomatic roots were cut into small pieces (1.0 cm × 1.0 cm) and disinfected successively by submersion in 75% ethanol for 30 s and 1% NaClO for 30 s under aseptic conditions. After rinsing with sterile water three times and air drying, segments were placed on potato dextrose agar (PDA). After incubation at 25 °C for 5 d in the dark, white to pale cream colored colonies were produced. The average mycelial growth rate was 15.2–18.5 mm day-1 at 25 ℃. Macroconidia were falciform with three to five septa and (18.0−32.0)×(3.0−5.0) μm in size. Microconidia were fusiform with two to three septa (7.0–10.0)×(2.1–3.0) μm. Based on morphological characteristics of macroconidia, and microconidia, isolates were identified as Fusarium incarnatum-equiseti species complex (span style="font-family:'Times New Roman'; font-size:12pt">FIESC) (Avila et al., 2019). The internal transcribed spacer (ITS) region, translation elongation factor (EF-1α), RNA polymerase largest subunit (RPB1), and RNA polymerase second largest subunit (RPB2) gene were amplified and sequenced respectively using ITS1/ITS4, EF1/EF2, Fa/G2R and 5f2/7cr primers (O’Donnell et al., 2010). BLASTN analysis of FUSARIUM-ID using ITS (Accession NO. MW172977), EF-1α (Accession NO. MW172978, RPB1(Accession NO. MW172979), and RPB2(Accession NO. MW172980) showed 99.8%, 100%, 99.74%, and 98.63% identity to FIESC isolates NRRL43619, NRRL34059, NRRL32864, and NRRL32175, respectively. To verify pathogenicity, ten 1-year-old healthy D. officinale plants were used for inoculation tests. One milliliter of a conidial suspension (106 conidia ml-1) was pipetted onto the soil around the base of D. officinale plants per pot. Ten plants, which were treated with sterile water, were used as the control. All plants were maintained in a climatic chamber (26 ± 1 ℃, 70–80% relative humidity and a photoperiod of 16:8 [L: D] h). Seven days later, all inoculated plants showed typical symptoms of root rot identical to those observed in the fields. Control plants remained symptomless and healthy. The pathogenicity analysis was repeated three times. Pathogens re-isolated from symptomatic plants were identified as FIESC species by morphology observation and sequence analysis. To our knowledge, this is the first report of root rot caused by FIESC species on D. officinale in Zhejiang, China.

scholarly journals First Report on Ovate-leaf Atractylodes Damping-off Caused by Fusarium oxysporum species Complex in South Korea

Plant Disease ◽  
2021 ◽  
Author(s):  
Oliul Hassan ◽  
Taehyun Chang
Keyword(s):  
South Korea ◽  
Fusarium Oxysporum ◽  
Species Complex ◽  
Disease Incidence ◽  
Fusarium Species ◽  
Morphological Characteristics ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Damping Off ◽  
First Report

In South Korea, ovate-leaf atractylodes (OLA) (Atractylodes ovata) is cultivated for herbal medicine. During May to June 2019, a disease with damping off symptoms on OLA seedlings were observed at three farmer fields in Mungyeong, South Korea. Disease incidence was estimated as approximately 20% based on calculating the proportion of symptomatic seedlings in three randomly selected fields. Six randomly selected seedlings (two from each field) showing damping off symptoms were collected. Small pieces (1 cm2) were cut from infected roots, surface-sterilized (1 minute in 0.5% sodium hypochlorite), rinsed twice with sterile water, air-dried and then plated on potato dextrose agar (PDA, Difco, and Becton Dickinson). Hyphal tips were excised and transferred to fresh PDA. Six morphologically similar isolates were obtained from six samples. Seven-day-old colonies, incubated at 25 °C in the dark on PDA, were whitish with light purple mycelia on the upper side and white with light purple at the center on the reverse side. Macroconidia were 3–5 septate, curved, both ends were pointed, and were 19.8–36.62 × 3.3–4.7 µm (n= 30). Microconidia were cylindrical or ellipsoid and 5.5–11.6 × 2.5–3.8 µm (n=30). Chlamydospores were globose and 9.6 –16.3 × 9.4 – 15.0 µm (n=30). The morphological characteristics of present isolates were comparable with that of Fusarium species (Maryani et al. 2019). Genomic DNA was extracted from 4 days old cultures of each isolate of SRRM 4.2, SRRH3, and SRRH5, EF-1α and rpb2 region were amplified using EF792 + EF829, and RPB2-5f2 + RPB2-7cr primer sets, respectively (Carbone and Kohn, 1999; O'Donnell et al. 2010) and sequenced (GenBank accession number: LC569791- LC569793 and LC600806- LC600808). BLAST query against Fusarium loci sampled and multilocus sequence typing database revealed that 99–100% identity to corresponding sequences of the F. oxysporum species complex (strain NRRL 28395 and 26379). Maximum likelihood phylogenetic analysis with MEGA v. 6.0 using the concatenated sequencing data for EF-1α and rpb2 showed that the isolates belonged to F. oxysporum species complex. Each three healthy seedlings with similar sized (big flower sabju) were grown for 20 days in a plastic pot containing autoclaved peat soil was used for pathogenicity tests. Conidial suspensions (106 conidia mL−1) of 20 days old colonies per isolate (two isolates) were prepared in sterile water. Three pots per strain were inoculated either by pouring 50 ml of the conidial suspension or by the same quantity of sterile distilled water as control. After inoculation, all pots were incubated at 25 °C with a 16-hour light/8-hour dark cycle in a growth chamber. This experiment repeated twice. Inoculated seedlings were watered twice a week. Approximately 60% of the inoculated seedlings per strain wilted after 15 days of inoculation and control seedlings remained asymptomatic. Fusarium oxysporum was successfully isolated from infected seedling and identified based on morphology and EF-1α sequences data to confirm Koch’s postulates. Fusarium oxysporum is responsible for damping-off of many plant species, including larch, tomato, melon, bean, banana, cotton, chickpea, and Arabidopsis thaliana (Fourie et al. 2011; Hassan et al.2019). To the best of our knowledge, this is the first report on damping-off of ovate-leaf atractylodes caused by F. oxysporum in South Korea. This finding provides a basis for studying the epidemic and management of the disease.

scholarly journals First report of black spot on Ophiopogon japonicus caused by Alternaria alternata in Zhejiang Province, China

Plant Disease ◽  
2021 ◽  
Author(s):  
Yiwen Xu ◽  
Zhenyan Cao ◽  
Yihua Yang ◽  
Jintian Tang ◽  
Yang Song ◽  
...  
Keyword(s):  
Alternaria Alternata ◽  
Early Stage ◽  
Black Spot ◽  
Zhejiang Province ◽  
Chemical Components ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Internal Transcribed Spacer Region ◽  
First Report ◽  
Ophiopogon Japonicus

Ophiopogon japonicus (Linn. f.) Ker-Gawl, a traditional Chinese medicinal plant, is widely cultured in China. The root of O. japonicus, is used as the main ingredient in many presriptions. It is rich in chemical components for steroidal saponins, homoisoflavonoids and polysaccharides, which have various pharmacological activities, such as cardiovascular protection, anti-inflammation and anti-diabetes (Chen. et al. 2016). In May and July for 2018 and 2019, the symptoms of black spot on O. japonicus were observed with an incidence of 40% in Cixi County, Zhejiang Province, China. The pathogen mainly infected leaves causing severe black spots, which resulted in a 28% yield loss per acre. At the early stage of the disease, the tip of the leaf began to turn yellow, then the discoloration gradually spread to the base of the leaf and finally the whole leaf turned reddish brown with visible black spot. Symptomatic leaves were cut into small pieces (1.0 cm × 1.0 cm) and disinfected successively by submersion in 75% ethanol for 30s and 1% NaClO for 30s under aseptic conditions. After rinsing with sterile water three times and air drying, segments were placed on potato dextrose agar (PDA), and incubated at 28 ℃ in dark for a week. Then, pathogen on the PDA were transferred onto potato carrot agar (PCA), and incubated at 23 ℃ under the condition of alternation of day (12 h) and night (12 h) for a week. Colonies on PDA were dark gray in the center surrounded by white to gray on the upper side, and black with white margins on the back of the plate. Colonies on PCA were grayish with sparse hyphae. The conidia were obclavate or ellipsoid, pale brown, with 3~8 transverse septa and 1~4 longitudinal septa. Conidiophores were septate, arising singly, and measured (17.0~81.0) × (8.0~23.5) μm, Most conidia had a conical or columnar beak, approximately (0~23.5) × (2.5~9.0) μm in size. According to morphological and cultural characteristics, these isolates were preliminarily identified as Alternaria alternata. A. alternata is one of the most typical plant pathogen, more than 95% of which facultatively parasitize on plants, causing disease in numerous crops. To further confirm identification of pathogens, the internal transcribed spacer region (ITS), translation elongation factor 1-α gene (EF-1α), RNA polymerase Ⅱ second largest subunit (RPB2), major allergen Alt a 1 gene (Alt a 1), Histon 3 gene (His) and plasma membrane ATPase (ATP)were amplified with primer pairs ITS1/ITS4, EF1-728F/EF1-986R, RPB2-7cr/RPB2-5f2, Alt-for/Alt-rev, His 3-F/His 3-R, ATP-F/ATP-R (Lawrence D.P. et al. 2013; Hong, S.G., et al. 2005). BLASTN analysis of NCBI using ITS (Accession NO. MW989987), Alt a1 (Accession NO. MW995953), EF-1α (Accession NO.MW995955), ATP (Accession NO.MW995957), His (Accession NO. MW995954) and RPB2 (Accession NO. MW995956) showed 100%, 100%, 97%, 99%, 99% and 97% identity to A. alternata MN249500.1, MN304714.1, MK637432.1, MK804115.1, MK460236.1, MK605888.1, respectively. To verify pathogenicity, healthy plants (1-year-old) of O. japonicus in ten pots were spray-inoculated with conidial suspension (1 × 106 conidia/ml). Ten plants, which were treated with sterile water, were used as the control. All plants were maintained in a climatic chamber (26 ± 1 ℃, 70–80% relative humidity and a photoperiod of 16:8 [L: D] h). Fourteen days later, all inoculated plants showed typical symptoms of black spot identical to those observed in the fields. Control plants remained symptomless and healthy. The pathogenicity analysis was repeated three times. Pathogens re-isolated from symptomatic plants were identified as A. alternata by morphology observation and sequence analysis. To our knowledge, this is the first report of black spot caused by A. alternata on O. japonicus in Zhejiang, China.

scholarly journals First report of Fusarium falciforme (FSSC 3+4) causing root rot on chickpea in Mexico

Plant Disease ◽  
2021 ◽  
Author(s):  
Sixto Velarde Felix ◽  
Victor Valenzuela ◽  
Pedro Ortega ◽  
Gustavo Fierros ◽  
Pedro Rojas ◽  
...  
Keyword(s):  
Fusarium Solani ◽  
Root Rot ◽  
Species Complex ◽  
Elongation Factor ◽  
Morphological Characteristics ◽  
Aerial Mycelium ◽  
Pathogenicity Test ◽  
Conidial Suspension ◽  
Single Spore ◽  
First Report

Chickpea (Cicer aretinium L.) is a legume crop of great importance worldwide. In January 2019, wilting symptoms on chickpea (stunted grow, withered leaves, root rot and wilted plants) were observed in three fields of Culiacan Sinaloa Mexico, with an incidence of 3 to 5%. To identify the cause, eighty symptomatic chickpea plants were sampled. Tissue from roots was plated on potato dextrose agar (PDA) medium. Typical Fusarium spp. colonies were obtained from all root samples. Ten pure cultures were obtained by single-spore culturing (Ff01 to Ff10). On PDA the colonies were abundant with white aerial mycelium, hyphae were branched and septae and light purple pigmentation was observed in the center of old cultures (Leslie and Summerell 2006). From 10-day-old cultures grown on carnation leaf agar medium, macroconidias were falciform, hyaline, with slightly curved apexes, three to five septate, with well-developed foot cells and blunt apical cells, and measured 26.6 to 45.8 × 2.2 to 7.0 μm (n = 40). The microconidia (n = 40) were hyaline, one to two celled, produced in false heads that measured 7.4 to 20.1 (average 13.7) μm × 2.4 to 8.9 (average 5.3) μm (n = 40) at the tips of long monophialides, and were oval or reniform, with apexes rounded, 8.3 to 12.1 × 1.6 to 4.7 μm; chlamydospores were not evident. These characteristics fit those of the Fusarium solani (Mart.) Sacc. species complex, FSSC (Summerell et al. 2003). The internal transcribed spacer and the translation elongation factor 1 alpha (EF1-α) genes (O’Donnell et al. 1998) were amplified by polymerase chain reaction and sequenced from the isolate Ff02 and Ff08 (GenBank accession nos. KJ501093 and MN082369). Maximum likelihood analysis was carried out using the EF1-α sequences (KJ501093 and MN082369) from the Ff02 and Ff08 isolates and other species from the Fusarium solani species complex (FSSC). Phylogenetic analysis revealed the isolate most closely related with F. falciforme (100% bootstrap). For pathogenicity testing, a conidial suspension (1x106 conidia/ml) was prepared by harvesting spores from 10-days-old cultures on PDA. Twenty 2-week-old chickpea seedlings from two cultivars (P-2245 and WR-315) were inoculated by dipping roots into the conidial suspension for 20 min. The inoculated plants were transplanted into a 50-hole plastic tray containing sterilized soil and maintained in a growth chamber at 25°C, with a relative humidity of >80% and a 12-h/12-h light/dark cycle. After 8 days, the first root rot symptoms were observed on inoculating seedlings and the infected plants eventually died within 3 to 4 weeks after inoculation. No symptoms were observed plants inoculated with sterilized distilled water. The fungus was reisolated from symptomatic tissues of inoculated plants and was identified by sequencing the partial EF1-α gene again and was identified as F. falciforme (FSSC 3 + 4) (O’Donnell et al. 2008) based on its morphological characteristics, genetic analysis, and pathogenicity test, fulfilling Koch’s postulates. The molecular identification was confirmed via BLAST on the FusariumID and Fusarium MLST databases. Although FSSC has been previously reported causing root rot in chickpea in USA, Chile, Spain, Cuba, Iran, Poland, Israel, Pakistan and Brazil, to our knowledge this is the first report of root rot in chickpea caused by F. falciforme in Mexico. This is important for chickpea producers and chickpea breeding programs.

scholarly journals First Report of Alfalfa Root Rot Caused by Plectosphaerella cucumerina in Inner Mongolia Autonomous Region of China

Plant Disease ◽  
2021 ◽  
Author(s):  
Yan-qin Zhao ◽  
Kai Shi ◽  
Xiuying Yu ◽  
Li-juan Zhang
Keyword(s):  
Root Rot ◽  
Inner Mongolia ◽  
Its Sequences ◽  
Economic Losses ◽  
Conidial Suspension ◽  
Autonomous Region ◽  
First Report ◽  
Alfalfa Field ◽  
Inner Mongolia Autonomous Region ◽  
Brown Root Rot

Alfalfa (Medicago sativa L.) is an important forage crop with high nutrition for animal feed. In May 2016, a disease showing brown root rot was observed on alfalfa collected from several farms in Tongliao City (44°17′ N; 121°29′ E), Inner Mongolia Autonomous Region of China. The incidence of brown root rot was approximately 50 to 70% in the 2-year-old alfalfa field. Infected alfalfa exhibited varying degrees of decay in the tap root. Symptomatic roots were cut into 0.5-cm pieces, surface disinfected with 70% ethanol for 5 s and 0.1% HgCl2 for 35 s, then rinsed with sterilize distilled water three times, and placed onto potato dextrose agar (PDA) at 26°C in the dark. After 5 days, hyphal tips of the growing colonies were transferred onto PDA plates for purification. Forty-four isolates belonging to five fungal species were obtained from 20 diseased root samples. Six of the isolates resembled the genus Plectosphaerella. Colonies of these isolates were white to cream in color with sparse aerial mycelium, and then gradually became salmon pink with slimy or moist mycelium. The hyphae were transparent and branched. Colonies produced numerous hyphal coils with conidiophores. Conidiogenous cells and conidia were both hyaline, solitary, and smooth. Conidia were 4 to 8.5 ×1.2 to 4.8 µm (n= 100), 0 to 1 septum, elliptical and ovoid, and aggregating to form a head (Palm et al. 1995). According to these morphological characteristics, the fungus was identified as P. cucumerina (Lindf.) (Carlucci et al. 2012). To confirm the identification, the genomic DNA of two representative isolates was extracted and their internal transcribed spacer (ITS) region was amplified and sequenced with the primer pair ITS1/ITS4 (White et al. 1990). The ITS sequences of the two isolates were deposited in GenBank (acc. nos. MN915126 and MN915127). The two ITS sequences showed 99 to 100% identical to known P. cucumerina strains CBS 131739 (acc. no. KY662258.1) (Su et al. 2017) and MP313 (acc. no. KC756835.1) from alfalfa in China (Wen et al. 2015). To test for pathogenicity, a set of 15 alfalfa seedlings (cv. Aohan) were root-dipped in the conidial suspension of one of the isolates (1×105 conidia /ml) prepared from 7-day-old cultures on PDA. Inoculated seedlings were transplanted in three pots (10×15 cm) with sterilized nursery soil. Another set of five alfalfa seedlings inoculated with sterile water only served as the controls. Treated alfalfa seedlings were maintained in a greenhouse at 25°C to 28°C under a 12-h photoperiod. After 25 days, the roots of all inoculated plants showed brown lesions. P. cucumerina was reisolated from symptomatic tissue. No symptoms were observed on the control plants. P. cucumerina was previously reported on alfalfa in the fields of Huanxi Country (36°20′ N; 107°21′), Gansu Province, China (Wen et al. 2015). To our knowledge, this is the first report of P. cucumerina causing root rot of alfalfa in Inner Mongolia Autonomous Region, China. This disease may cause serious economic losses in the region. It is needed to develop effective management strategies for control of this disease.

scholarly journals First report of blight on Fritillaria thunbergii caused by Fusarium oxysporum in Zhejiang Province, China

Plant Disease ◽  
2021 ◽  
Author(s):  
Yiwen Xu ◽  
Zhenyan Cao ◽  
Yihua Yang ◽  
Xuping Shentu ◽  
Xiaoping Yu
Keyword(s):  
Early Stage ◽  
Science And Technology ◽  
Elongation Factor ◽  
Morphological Characteristics ◽  
Its Region ◽  
Zhejiang Province ◽  
Gastric Ulcers ◽  
Conidial Suspension ◽  
Sterile Water ◽  
First Report

Fritillaria thunbergii Miq. (Zhe beimu), is an oldest known homeopathic traditional folk medicinal plant in Zhejiang Province, China. The bulbs are medicinally important curing cough, inflammation, gastric ulcers, hypertension, diarrhea, and bronchitis (Nile et al. 2021). In April of 2018 and 2019, symptoms of blight on F. thunbergii were observed with an incidence of 20–25% in Cixi city, Zhejiang Province. At the early stage of this disease, the stalk turned brown, then the whole bulbs rotted within a few days. Symptomatic bulbs were cut into small pieces (1.0 cm × 1.0 cm) and disinfected successively by submersion in 75% ethanol for 30 seconds and 1% NaClO for 30 seconds under aseptic conditions. After rinsing with sterile water three times and air drying, segments were placed on potato dextrose agar (PDA). After incubation at 28 ℃ for 7 days in the dark, the hyphae were observed white fluffy, spreading from the middle to the whole plate. Macroconidia were falciform with zero to four septa and (11.0-39.0) × (3.0-5.0) μm in size. Microconidia were fusiform with zero to two septa (4.0-7.0) × (2.6-3.0) μm in size. Based on morphological characteristics of macroconidia, and microconidia, isolates were identified as F. oxysporum (Lombard, L. et al., 2019). The internal transcribed spacer (ITS) region, translation elongation factor (EF-1α), and RNA polymerase second largest subunit (RPB2) gene were amplified and sequenced respectively using ITS1/ITS4, EF1/EF2 and 5f2/7cr primers (O’Donnell et al., 2010). BLASTN analysis of FUSARIUM-ID using ITS (Accession NO.MZ268594), EF-1α (Accession NO.MZ292517) and RPB2(Accession NO.MZ292516) showed 95.2%, 100%, and 99.11% identity to F. oxysporum species complex isolates NRRL43730, NRRL38599 and NRRL38302, respectively. Based on the morphological and molecular characters, the pathogen was identified as F. oxysporum. To verify pathogenicity, ten healthy F. thunbergii plants were used for inoculation tests. One milliliter of a conidial suspension (106 conidia ml-1) was pipetted onto the soil around the base of F. thunbergii plants per pot. Ten plants, which were treated with sterile water, were used as the control. All plants were maintained in a climatic chamber (26 ± 1 ℃, 70–80% relative humidity and a photoperiod of 16:8 [L: D] h). Seven days later, all inoculated plants showed typical symptoms of blight identical to those observed in the fields. Control plants remained symptomless and healthy. The pathogenicity analysis was repeated three times. Pathogens re-isolated from symptomatic plants were identified as F. oxysporum by morphology observation and sequence analysis. To our knowledge, this is the first report of blight caused by F. oxysporum on F. thunbergii in Zhejiang Province, China. Acknowledgments: The author(s) declare no conflict of interest. Funding: This work was supported by Zhejiang Provincial Program for Science and Technology Development (2017C32006, 2018C02030) and the Student Science and Technology Innovation Project of China Jiliang University (2021YW95). References: Nile et al. 2021.J. Food and chemical toxicology, 153:112289. Hami, A. et al., 2021. J. Scientific Reports. 3610.11.1. Lombard, L. et al., 2019. PERSOONIA, 43:1-47. O’Donnell, K., et al. 2010. J. Clin. Microbiol. 48: 3708-3718.

scholarly journals First Report of Fusarium tricinctum Causing Stem and Root Rot on Lanzhou Lily (Lilium davidii var. unicolor) in China

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 999-999 ◽  
Author(s):  
Q. H. Shang ◽  
X. Zhao ◽  
Y. Y. Li ◽  
Z. K. Xie ◽  
R. Y. Wang
Keyword(s):  
Root Rot ◽  
Gansu Province ◽  
Plant Diseases ◽  
Pathogenicity Test ◽  
Conidial Suspension ◽  
Sterile Water ◽  
First Report ◽  
5.8S Rdna ◽  
Lanzhou Lily ◽  
Lilium Davidii

Lanzhou lily (Lilium davidii var. unicolor Cotton) is an important bulb edible crop which mostly distributes in middle area of Gansu Province in China (2). Recently, plants of Lanzhou lily developed symptoms of severe wilting. In early autumn of 2012 to 2013, a survey of Lanzhou lily disease was carried out in Yuanjiawan, Caoyuan, Xiguoyuan, and Hutan villages of Lanzhou City and Xuding and Guanshan villages of Linxia Prefecture. Disease symptoms included stem and root rot, vessels showed a brown to dark brown discoloration, plus a progressive yellowing and wilting of leaves from the base. Small pieces of symptomatic leaves, stems, and roots were surface disinfected with 75% ethanol for 30 s, 3% sodium hypochlorite for 5 min, and then washed three times in sterile distilled water. The tissues were placed on Martin Agar at 25°C for 7 days. Three isolates were consistently isolated from diseased tissues and all isolates with morphology similar to Fusarium spp. Isolates were transferred to potato dextrose agar (PDA) and carnation leaf agar (CLA) and incubated at 25°C in darkness. These isolates grew rapidly on PDA and formed abundant dense aerial mycelium, initially white, that became deep pink with age and formed red pigments in the medium. On CLA, macroconidia with 3 to 5 septa were abundant, relatively slender, and curved to lunate. Microconidia were abundant, oval and 0 to 1 septa. Chlamydospores were globose with a smooth outer wall in chains. The rDNA internal transcribed spacer (ITS) region comprising ITS1, ITS2, and 5.8S rDNA was amplified using primers ITS-1 and ITS-4 (3) and sequenced. On the basis of a comparison of 563 bp, all the three isolates had the identical sequence (GenBank Accession No. KF728675). BLASTn analysis of the sequence showed 100% match with the ITS sequences of those F. tricinctum sequences in GenBank (Accession Nos. FJ233196, AY188923, and JF776663). Pathogenicity test was performed by transplanting 2-month-old tissue culture seedlings to plastic pots in a sterile mixture of vermiculite and torf substrate at 1:3 (v/v). Seedlings were inoculated with 6 ml of the conidial suspension (104 conidia/ml) on the roots of plant in each pot, three plants per pot, and three replicates for each treatment. Seedlings treated with sterile water served as controls. The seedlings were placed in a plant growth chamber maintained at 22 ± 3°C, relative humidity >70%, 16 h light per day, and irrigated with sterile water. After 4 weeks, inoculated plants exhibited wilting foliage that with symptoms similar to those observed in the field, while the control plants remained healthy. F. tricinctum was re-isolated from all inoculated plants. The disease has been reported previously in ornamental lily in China (1). However, to the best of our knowledge, this is the first report of F. tricinctum causing wilt on edible Lanzhou lily in China and the disease must be taken into consideration of current disease management. This work supported by NSFC No. 31370447 and Hundred Talents Program of CAS “Molecular mechanism of biological control on plant diseases.” References: (1) Y. Y. Li et al. Plant Dis. 97:993, 2013. (2) R. Y. Wang et al. Virol. J. 7:34, 2010. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

scholarly journals Fusarium incarnatum-equiseti Species Complex Causing Root Rot Disease on Leymus chinensis in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Yuanyuan Zhang ◽  
Le Wang ◽  
Mandela Elorm Addrah ◽  
Kejian Lin
Keyword(s):  
Root Rot ◽  
Species Complex ◽  
Disease Incidence ◽  
Local Economy ◽  
Leymus Chinensis ◽  
Economic Losses ◽  
Molecular Characteristics ◽  
Pathogenicity Test ◽  
Fungal Culture ◽  
Conidial Suspension

Leymus chinensis (Trin.) Tzvel. is a rhizomatous grass widely grown in the grasslands of Eurasia. With strong fertility and stress resistance, L. chinensis makes an excellent pasture and mowing grass, contributing to animal husbandry and thus playing an important role in the local economy of the northern grassland area in China (Baoyin et al. 2014). During August to September 2019, diseased roots of L. chinensis were collected from an artificially planted grassland (40°47'44" N, 111°43′58″ E, alt. 1049 m) in Shaerqin County, Hohhot, China. Infected plants were scattered across the field with disease incidence up to 2%. Symptoms observed were wilted plants and rotten roots. In order to identify the causal pathogen of root rot on L. chinensis, symptomatic pieces (5 × 5 mm) of grass roots were excised and surface sterilized with 75% ethanol for 3-5 s followed by 1% NaClO for 2-3 min, rinsed three times with sterile distilled water, and placed on water agar and incubated at 25°C for 3 days. The mycelia were cut and transferred onto potato dextrose agar (PDA) for subculture. A fungus was consistently isolated, and a strain, named LCH054, was obtained by hyphal tip culture. Culture developed as white and fluffy aerial mycelia, with diffused pink pigment on the reverse side of PDA after culturing at 25℃ for 7 days. A culture of LCH054 was transferred to carnation leaf agar (CLA) (Li et al. 2014) and incubated at 25°C for 10 days. Microconidia were absent but macroconidia were produced. Macroconidia were hyaline, sickle-shaped, and had 4 to 7 septa, 19.8 to 63.6 (mean 43.8) × 1.8 to 5.7 (mean 3.2) μm (n = 100). Chlamydospores were ellipsoidal or subglobose, with thick walls in clumps or chains. All morphological characteristics of LCH054 resembled Fusarium equiseti (Leslie and Summerell 2006). The primers of the internal transcribed spacer (ITS) region (White et al. 1990) and translation elongation factor 1α gene (TEF-1α) (O’Donnell et al. 1998) were used to amplify the isolate, and the fragments were sequenced. BLASTn search in the NCBI database using the ITS and TEF-1α sequences revealed 99 to 100% similarities with F. equiseti. BLAST analysis of the ITS and TEF-1α sequencies in the FUSARIUM-ID database showed them to have 99.21% (500 bp out of 504 bp) and 99.52% (622 bp out of 625 bp) similarities with the Fusarium incarnatum-equiseti species complex (FIESC) (strain NRRL 45997) (O’Donnell et al. 2009), respectively. The ITS and TEF1-α sequences were deposited in GenBank as accession numbers MT937067 and MT947530, respectively. The strain LCH054 was identified as a member of the FIESC based on morphological and molecular characteristics. For the pathogenicity test, one hundred of L. chinensis seeds were planted into five pots (12 cm [diameter]) × 15 cm [high]) and kept in a greenhouse under a 16-h photoperiod with temperatures of 20-25°C and 40% relative humidity. The conidial suspension of LCH054 was prepared by washing 7-day old fungal culture grown on CLA medium using sterile deionized water. Conidia were filtered through three layers of sterile cheese cloth, counted, and adjusted to 1 × 105 conidia/ml with a hemocytometer. Forty 1-month-old healthy plants (four pots) were inoculated with 400 ml of conidia suspension using the root drenching method, whereas the inoculum was replaced with 100 ml sterile water on control plants (one pot). Fourteen days after inoculation, all inoculated plants showed the typical symptoms of root rot identical to those observed in the field, whereas the control plants remained healthy. LCH054 was re-isolated from the inoculated plants and identified by the morphological and molecular approaches as described above. To the best of our knowledge, this is the first report of root rot caused by F. incarnatum-equiseti on L. chinensis in China as well as worldwide. The presence of the pathogen could cause significant economic losses in L. chinensis production. For this reason, strategies for the management and control of this disease should be developed and implemented.

scholarly journals First report of Fusarium solani Species Complex Causing Root Rot of Loquat (Eriobotrya japonica) in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Di Wu ◽  
Danhua Zhang ◽  
Caixia Wang ◽  
Yue Wei ◽  
Michael Paul Timko ◽  
...  
Keyword(s):  
Rna Polymerase ◽  
Fusarium Solani ◽  
Root Rot ◽  
Species Complex ◽  
Lateral Roots ◽  
Beta Subunit ◽  
Eriobotrya Japonica ◽  
Conidial Suspension ◽  
Fusarium Solani Species Complex ◽  
Rot Disease

Loquat (Eriobotrya japonica), a native fruit tree to China, is a popular edible fruit with medicinal properties (Badenes et al. 2013). A 2016-2019 field survey of ~13,000 loquat trees in two orchards in Chongqing and Fujian provinces showed about 5 to 10% root rot disease incidence. The disease symptoms included leaf yellowing, wilting, rotting of main root, and cracking of lateral roots, eventually leading to defoliation and death. To determine the causative agent, diseased roots from six trees were collected, washed in tap water, cut into 2-3 mm pieces, and disinfected for 3 min in 75% (v/v) EtOH. After rinsing in sterilized water, the root pieces were soaked in 10% NaClO (w/v) for 5-10 min, rinsed thrice in sterile water, and plated on potato dextrose agar (PDA). After 7 days of incubation at 25°C, individual spores were collected from the fungal colonies and replated. Single spore cultures growing on PDA gave rise to woolly-cottony, cream-white colored aerial mycelium and a yellowish pigmented mycelium. The average colony growth rate was 8.6 mm day-1 (n=3). Microscopic observation of the mycelium revealed septate and hyaline hyphae and long cylindrical monophialides. Macroconidia were moderately curved, stout, 3-4 septate, measuring 20.79-48.70 μm × 4.16-10.14 μm (n=50). Microconidia produced from long phialides were kidney-shaped, 0-2 septate, and 5.72-17.28 μm × 2.29-6.51 μm (n=50) in size. The mycelial characteristics and reproductive structures of the isolates fit the morphological description of Fusarium sp. (Summerell et al. 2003). To confirm this identification, translation elongation factor (EF-1α) and RNA polymerase I beta subunit (RPB1) and RNA polymerase II beta subunit (RPB2) regions of the genome were PCR amplified from 3 separate isolates (R2, R4 and R5) using EF1/ EF2, RPB1-Fa/G2R, RPB2-5f2/7cR & RPB2-7cF/11aR primer pairs (O’Donnell et al. 2010) and sequenced. BLASTn comparison of the EF-1α (MT976167), RPB1 (MT967271) and RPB2 (MW233052) regions from isolate R4 showed 99% identity with the EF-1α (GU170620, 675/676 bp), RPB1 (KC808270, 1543/1545 bp) and RPB2 (MK4419902, 1637/1638 bp) sequences of Fusarium solani species complex (FSSC) in GenBank database. The same species level identification was also found using FUSARIUM-ID and FUSARIUM-MLDT databases. Two-year-old seedlings (n=3) of two different cultivars, ‘Hunanzaoshu’ and ‘Huabai No. 1’, growing in pots indoors at 25-27 °C were inoculated by drenching the soil with a conidial suspension of isolate R4 (40 mL, 106 conidia mL-1 obtained from 6-10 day old cultures). Control plants (n=3) were inoculated with sterilized water. At 20 days after inoculation (DAI) the leaves of inoculated plants became chlorotic and wilted, defoliated over time, and by 53 DAI 91.67% of plants died. The taproot and lateral roots of inoculated plants appeared brown to black in color and most lateral roots died and decomposed at 53 DAI, whereas the control plant roots remained healthy. All control plants remained symptomless. Based on morphological and molecular characters (TEF-1, RPB1 and RPB2), the re-isolated pathogen from diseased plants was identical to the R4 isolate used for inoculation and the disease assays were repeated thrice. FSSC was recently reported to cause fruit rot disease on loquat in Pakistan (Abbas et al. 2017). Identifying Fusarium solani species complex as a disease agent in Chinese loquat will assist in future development of improved germplasm for this important worldwide tree crop.

scholarly journals First Report of Root Rot Caused by the Fusarium oxysporum Species Complex on Codonopsis pilosula in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Xia Zhao ◽  
Yue Liang ◽  
UWAREMWE CONSTANTINE ◽  
Liu Yang ◽  
Tian Yuan ◽  
...  
Keyword(s):  
Fusarium Oxysporum ◽  
Root Rot ◽  
Species Complex ◽  
Tween 20 ◽  
Group Method ◽  
Pathogenicity Test ◽  
Conidial Suspension ◽  
Internal Transcribed Spacer Region ◽  
First Report ◽  
Codonopsis Pilosula

Codonopsis pilosula Franch., also known as Dangshen, is an important medicinal plant in China. It is widely cultivated for a major income of local farmers in Dingxi, Gansu Province. Its dried roots have the effects of supplementing vital energy, nourishing spleen and lung, enhancing organic immunity, helping depressurization, and improving microcirculation, etc., for humans. In June to October, 2018-2020, root rot disease was observed on C. pilosula with incidences up to 20% in the Dingxi region. We collected ten diseased and healthy plants from Dingxi (35°06′N, 104°29′E, 2206 m a.s.l.) in October 2019. The rotting root tissues were sterilized with 70% ethanol for 30 s and 3% NaOCl for 5 min and placed on potato dextrose agar (PDA) plates incubated at 25℃to isolate the pathogen (Shang et al. 2014). From the similar fungal cultures isolated after 7 days on PGA, isolate B17 was purified for morphological and molecular characterization. Its colony appeared light purple and produced long aerial hyphae. Slightly curved macroconidia (12.3 to 31.7 × 3.1 to 5.1 μm, n=40) and oval-ellipsoid and cylindrical microconidia (6.1 to 9.9 × 2.8 to 4.5 μm, n=30) were observed. The internal transcribed spacer region (ITS) and the translation elongation factor-1 alpha (TEF-1α) gene were amplified using primers ITS1/ITS4 and EF-1/EF-2 (Uwaremwe et al. 2020), respectively. The 489 bp (ITS) and 631 bp (TEF-1α) sequences were deposited in GenBank (Accession No. MN744360 and MN786974, respectively). The ITS sequence had 100% homology to isolate JJF2 (No. MN626452, ITS) (Ma et al. 2020), and the TEF-1α sequence had 100% homology to isolate Fo353 (No. KM065860) (Koyyappurath et al. 2016) of Fusarium oxysporum Schlecht. emend. Snyder & Hansen, which caused root rot of Panax ginseng and Vanilla planifolia, respectively. A phylogenetic tree was generated using the unweighted pair-group method with arithmetic average in the MycoBank database (O’Donnell et al. 2015), which clustered isolate B17 in the F. oxysporum species complex. Twenty 1-year-old plants of C. pilosula were inoculated with were inoculated by dipping the washed roots in a conidial suspension (2 ×106 conidia/ml added with 0.2% Tween 20) for 20 min before transplanted into pots (16 × 16 × 23 cm) with four plants per pot filled with sterilized peat and soil mixture (2:1 v/v) and grown in a greenhouse at 26oC with >70% humidity and 16 h light. Sterilized water added with 0.2% Tween 20 was used as a control. One week after inoculation, the leaves of pathogen-inoculated plants became yellow, and wilting occurred at the leaf tips 18 days later. Some of the inoculated plants died 45 days after inoculation, and the low part of roots had dark brown to black lesions and became rotting. The control plants did not show symptoms. The pathogenicity test was repeated three times with the same fungus isolated from the infected root tissue. To the best of our knowledge, this is the first report that F. oxysporum causes root rot on C. pilosula in China. F. oxysporum is a serious threat to C. pilosula cultivation, and the finding of this pathogen provides a clear target for root rot control.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Sign in / Sign up

Export Citation Format

Share Document