scholarly journals First Report of Root Rot of Tobacco Caused by Fusarium brachygibbosum in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Rui Qiu ◽  
Juan Li ◽  
Wenming Zheng ◽  
Xinhong Su ◽  
Guozhen Xing ◽  
...  
Keyword(s):  
Root Rot ◽  
Disease Incidence ◽  
Lateral Roots ◽  
Development Project ◽  
Specific Substrate ◽  
Single Spore ◽  
Tissue Samples ◽  
First Report ◽  
Agricultural Sciences ◽  
Tobacco Seedlings

Tobacco (Nicotiana tabacum L.) is an important cash crop in China, with an estimated production of 2.2 million tons every year (Berbeć and Matyka, 2020). In June 2020, a root rot disease was observed on tobacco (cv. Zhongyan 100) in four surveyed counties (Mianchi, Lushi, Duguan and Lingbao) in Sanmenxia. Diseased plants exhibited leaf chlorosis and purplish to brown vascular discoloration of stem, taproot and lateral roots. The disease incidence ranged from 15% to 40% in 11 surveyed fields, 36.7 ha in total. Twenty five diseased tissues were surface sterilized in 75% ethanol and placed on potato dextrose agar (PDA) medium. Fifteen single-spore isolates were obtained from 25 diseased tissue samples. All cultures growing on PDA had white colonies with abundant aerial mycelia initially, turning into yellow to orange in the center and produced red pigmentation after seven days of growth. The 7-day-old cultures grown on carnation leaf agar (CLA) produced macroconidia that were curved with 3-5 septa, had wide central cells, slightly pointy apex, and measured 17.0-45.9 μm long×3.0-4.6 μm wide (n=50). The microconidia formed on CLA were slightly curved, ovoid with zero to two septa, measuring 5.4-15.5 μm long×2.0-3.2 μm wide (n=50). Spherical chlamydospores (7.58-13.52 μm; n=50) were terminal or intercalary, single or in chains. Such characteristics were typical of Fuarium brachygibbosum (Tirado-Ramírez et al. 2018). DNA from one representative single-spore isolate (MC1) was extracted, and the translation elongation factor 1-alpha (EF1-α), RNA polymerase I largest subunit (RPB1) and second largest subunit (RPB2) genes were amplified with primers EF1/EF2, F5/G2R and RPB2F/R respectively (O’Donnell et al. 1998, 2010), and sequenced. Sequences were submitted to GenBank under accession numbers MT947796 (EF1-α), MW679536 (RPB1) and MW430664 (RPB2). The consensus sequences showed 99.70%, 99.94% and 100% identity to the sequences of F. brachygibbosum strain NRRL 34033 (accession no. GQ505418.1, HM347172.1 and GQ505482.1, Wang et al 2021). Morphological and molecular results confirmed this species as F. brachygibbosum (Al-Mahmooli, et al., 2013, Rentería -Martínez, et al., 2018). Pathogenicity tests were performed on tobacco seedlings grown on autoclaved tobacco specific substrate (Tobacco specific matrix, Ainong Biotechnology Co. Ltd, China). Healthy six-leaf stage tobacco seedlings (n=30; Zhongyan 100) were inoculated by placing 7-days old wheat seed (15 seeds per plant) infested with MC1 around the root. Thirty seedlings inoculated with sterile wheat seeds served as controls. All the plants were maintained in a growth chamber at 25±0.5℃ and 70% relative humidity. The assay was conducted three times. Typical symptoms of foliage chlorosis and root browning were observed 7-14 days after inoculation. The pathogen was reisolated from the necrotic tissue from all inoculated seedlings and was identified by sequencing partial EF1-α and RPB2 genes. Control plants remained asymptomatic and no pathogen was recovered from the control plants. Fusarium brachygibbosum is known as a pathogen of grains and cash crops in China (Shan, et al., 2017, Xia, et al., 2018). To our knowledge, this is the first report of F. brachygibbosum causing root rot on tobacco. We believe that our results will help to better understand rhizome fungal diseases affecting tobacco production in China. Acknowledgements: Funding was provided by the Science and Technology Project of Henan Provincial Tobacco Company (2020410000270012), Independent Innovation Project of Hennan Academy of Agricultural Sciences (2020ZC18) and Research and Development project of Henan Academy of Agricultural Sciences (2020CY010). References: Al-Mahmooli, I. H., et al. 2013. Plant Dis. 97:687; https://doi.org/10.1094/PDIS-09-12-0828-PDN Berbeć A. K. and Matyka M. 2020. Agric. 10(11), 551; https://doi.org/10.3390/agriculture10110551 O’Donnell, K., et al. 1998. P. Natl. Acad. Sci. USA. 95(5):2044-2049; https://doi.org/10.1073/pnas.95.5.2044 O’Donnell, K., et al. 2010. J. Clin. Microbiol. 48(10)3708-3718; https://doi.org/10.1128/JCM.00989-10 Rentería -Martínez M.E., et al. 2018. Mex. J. of Phytopathol. 36(2):1-23; https://doi.org/10.18781/R.MEX.FIT.1710-1 Shan, L. Y., et al. 2017. Plant Dis. 101:837; https://doi.org/10.1094/PDIS-10-16-1465-PDN Tirado-Ramírez, M. A., et al. 2018. Plant Dis. 103; https://doi.org/10.1094/PDIS-04-18-0710-PDN Wang, S., et al. 2021. Plant Dis. 2021 Jan 6. doi: 10.1094/PDIS-05-20-0941-PDN. Epub ahead of print. PMID: 33406862. Xia, B., et al. 2018. Plant Dis. 102(11):2372; https://doi.org/10.1094/PDIS-12-17-1939-PDN The author(s) declare no conflict of interest.

scholarly journals First Report of Fusarium Root Rot of Tobacco Caused by Fusarium sinensis in Henan Province China

Plant Disease ◽  
2021 ◽  
Author(s):  
Rui Qiu ◽  
Qi Li ◽  
Juan Li ◽  
Ningyu Dong ◽  
Shujun Li ◽  
...  
Keyword(s):  
Root Rot ◽  
Morphological Characteristics ◽  
Henan Province ◽  
Crown Rot ◽  
Conidial Suspension ◽  
Tobacco Plants ◽  
First Report ◽  
Agricultural Sciences ◽  
Tobacco Seedlings ◽  
Β Tubulin

Tobacco (Nicotiana tabacum L.) is an economically important crop in China, with an estimated production of 2.2 million tons every year. In June 2018, tobacco plants within the municipality of Sanmenxia (Henan, China) showed symptoms of wilting with leaf yellowing and stunting. Diseased plants exhibited severe necrosis that advanced through the main root (Figure 1 A). The symptoms were observed in nineteen surveyed tobacco fields, 60 ha in total, and approximately 25% of the plants were symptomatic. The disease resulted in a severe loss in tobacco leaf production. Five symptomatic tobacco plants were sampled. Diseased tissues from roots were surface sterilized in 75% ethanol and placed on potato dextrose agar (PDA) medium. Eighteen of the 25 diseased tissues had cultures growing from them, and all the cultures were white colonies with abundant aerial mycelium produced scarlet pigmentation on PDA. One pure culture was obtained by single-spore culturing (SL1). A 10-day-old culture grown on CLA (carnation leaf agar) produced macroconidia that were falcate, straight or slightly curved, 3-septate, 25-35×3.5-4.5 μm (average 26.8×3.7 μm) (n=50). Two types of microconidia (napiform and fusiform) were formed on CLA that were hyaline, with one to two cells. Napiform conidia were 4.5-9.3×3.8-5.9 (average 7.3×5.0 μm) (n=50); fusiform conidia were 6.9-15.8×1.8-3.1 (average 9.9×2.5 μm). Spherical chlamydospores (7-12.5 μm) (n=50) were terminal or intercalary and produced in clumps or in chains (Figure1 B-D). Morphological characteristics of the isolate were similar to the features of Fusarium sinensis previously described by Zhao and Lu (2008). Molecular identification was performed using partial sequences of EF1-α gene (primers EF1/EF2, O’Donnell et al. 1998). Maximum parsimony and maximum likelihood-based methods were fitted using MEGA 7 (Moreira et al. 2019，Figure 2). The isolate was also sequenced for β-tubulin (primers T1/Bt-2b, O’Donnell & Cigelnik 1997)，ribosomal RNA gene (LSU, LROR/LR5 primers, Vu et al. 2019) and rDNA-ITS (ITS 1/ ITS 4 primers, White et al. 1990). Sequences were deposited in GenBank under accession numbers MT947797 (EF1-α), MW484999 (β-tubulin), MW486649 (LSU) and MT907471 (ITS). The obtained EF1-α sequence was 98.10% identity with those of F. sinensis (MG670388.1) in the GenBank database, whereas the β-tubulin, LSU and ITS sequences showed 100% identities to the corresponding DNA sequences in F. sinensis (GenBank Acc. Nos. KX880370.1, NG_067454.1 and MH863232.1, respectively). Morphological and molecular results confirmed this species as F. sinensis (Zhao and Lu 2008). Pathogenicity tests were performed on tobacco seedlings grown on an autoclaved matrix (YC/T310-2009). Healthy 6-leaf stage tobacco seedlings were inoculated by pouring a 20 mL conidial suspension (1×106 conidia/mL-1) around the stem base of each plant, 30 plant were inoculated. Thirty control seedlings received sterilized water. All treatments were maintained for 30 days under greenhouse conditions with a 12-h light/dark photoperiod at 25±0.5℃ and 70% relative humidity. The assay was conducted three times. Root rot and foliage chlorosis similar to the ones observed on infected plants in the field were observed on the inoculated tobacco seedlings, whereas the control seedlings remained asymptomatic after 30 days (Figure1 E). The pathogen isolated from the inoculated plant exhibited morphological characteristics identical to F. sinensis and was identified by a partial EF1-α gene sequence. This disease has previously been reported as the causal agent of root and crown rot of wheat in China (Zhao and Lu 2008; Xu et al. 2018). To our knowledge, this is the first report of F. sinensis causing root rot on tobacco in China. Funding: Funding was provided by the Science and Technology Project of Henan Provincial Tobacco Company (2020410000270012), Independent Innovation Project of Hennan Academy of Agricultural Sciences (2020ZC18) and Research and Development project of Henan Academy of Agricultural Sciences (2020CY010). References: Moreira, G.M., et al. 2019 Plant Dis. O’Donnell, K., et al. 1998. Proc. Natl. Acad. Sci. USA 95:2011. O'Donnell, K., et al. 2008. J. Clin. Microbiol. 46:2477. Xu, F., et al. 2018. Front Microbiol. 9:1054. Zhao, Z.H., and Lu, G. Z., 2008. Mycologia, 100:746. The author(s) declare no conflict of interest. Keywords: tobacco root rot, Henan Province, Fusarium sinensis

scholarly journals First report of Fusarium fujikuroi causing root rot and seedling elongation of soybean in Indiana

Plant Disease ◽  
2021 ◽  
Author(s):  
Christopher Detranaltes ◽  
Christopher Robert Jones ◽  
Guohong Cai
Keyword(s):  
Root Rot ◽  
Lateral Roots ◽  
Small Subunit ◽  
The State ◽  
Gibberella Fujikuroi ◽  
Fusarium Fujikuroi ◽  
Pathogenicity Test ◽  
Single Spore ◽  
New Host ◽  
First Report

In summer 2020, 127 soybean (Glycine max (L.) Merr) seedlings (V1-V3 stage) showing reduced vigor or crown lesions were collected at Purdue’s Agronomy Center for Research and Education in West Lafayette, Indiana. Root tissues from two seedlings with necrotic cotyledons and root rot were surface-sterilized and plated on dichloran-chloramphenicol-peptone agar (Andrews and Pitt 1986). Emerging hyphal tips were transferred to potato dextrose agar (PDA). Single-spore cultures were obtained and grown on PDA. Both isolates developed floccose white aerial mycelia with reddish-pink coloration in the media in 2 weeks on the benchtop. On carnation leaf agar, macroconidia formed on orange sporodochia within 2 weeks in darkness at 25C. Macroconidia were 3-5 septate, measuring 26 – 41 × 2.5 – 3.7 μm (avg. 34.8 × 3.2 μm, n=40). Microconidia were abundant in chains and false heads forming on both mono- and polyphialides, and measured 2.5 – 8.75 x 2.5 μm (avg. 5.9 × 2.5 μm, n=40). These characteristics were consistent with species descriptions of F. fujikuroi [Sawada] Wollenw. (teleomorph Gibberella fujikuroi) (Leslie and Summerell 2006). DNA was extracted from mycelium and the following genes were amplified and sequenced: the internal transcriber spacer (ITS) region using ITS1/ITS4 primers (White et al. 1990) (GenBank accessions MW463362/MW463363), the mitochondrial small subunit (mtSSU) rDNA using MS1/MS2 primers (White et al. 1990) (MW465310/MW465307), and the partial translation elongation factor 1-alpha (TEF1α) gene using 983F/1567R primers (Rehner and Buckley 205) (MW475297/MW475298). In GenBank BLAST searches, these sequences showed 100% identity to both F. proliferatum and F. fujikuroi. Species-specific forward primers Fuji1F and Proli1F were then used in combination with reverse primer TEF1R to amplify another region in the TEF1α gene (Amatulli et al. 2012). Proli1F/TEF1R primers failed under a variety of annealing temperatures while Fuji1F/TEF1R primers succeeded, and the products were sequenced (MW475299/MW475300). GenBank BLAST searches revealed 100% identity of both isolates to F. fujikuroi (MT448248.1). A pathogenicity test was conducted with isolate AC13 in the greenhouse following the protocol of (Ellis et al. 2013). Ten seeds (cv. Williams) each were used for inoculation and control, respectively, with one seed per cup. Root rot symptoms similar to those observed in the field were observed 14 days after planting on all inoculated plants but not on controls (VC stage). Infected plants showed symptoms of pre-emergence damping off, reddish-brown lesions on the tap and lateral roots, and root necrosis. Three plants also exhibited hyper-elongation of the stem (12.5, 11.1, and 18 cm, vs controls: avg. 6.8 cm, max. 8.5 cm, stdev 0.78 cm). F. fujikuroi was successfully reisolated from inoculated plants but not from controls and identified as described above. F. fujikuroi has been reported causing soybean root rot in China (Zhao et al. 2020), Korea (Choi et al. 2019), and the state of Kansas (Pedrozo et al. 2015). To our knowledge this is the first report of F. fujikuroi infecting soybeans in the state of Indiana. F. fujikuroi is known to cause elongated seedlings in rice (Leslie and Summerell 2006). Pedrozo et al. (2015) reported that F. fujikuroi isolated from soybean caused seedling elongation in rice but not in soybean. The increased distribution and new host symptomology observed here warrants heightened attention for the control of this pathogen.

scholarly journals First report of Colletotrichum siamense Causing Blossom Blight on Thai basil (Ocimum basilicum L.) in Malaysia

Plant Disease ◽  
2020 ◽  
Author(s):  
Siti Izera Ismail ◽  
Nur Adlina Rahim ◽  
Dzarifah Zulperi
Keyword(s):  
Disease Incidence ◽  
Its Region ◽  
Ocimum Basilicum ◽  
Distilled Water ◽  
Single Spore ◽  
First Report ◽  
Plastic Bags ◽  
Colletotrichum Siamense ◽  
Primer Sets ◽  
Acca Sellowiana

Thai basil (Ocimum basilicum L.) is widely cultivated in Malaysia and commonly used for culinary purposes. In March 2019, necrotic lesions were observed on the inflorescences of Thai basil plants with a disease incidence of 60% in Organic Edible Garden Unit, Faculty of Agriculture in the Serdang district (2°59'05.5"N 101°43'59.5"E) of Selangor province, Malaysia. Symptoms appeared as sudden, extensive brown spotting on the inflorescences of Thai basil that coalesced and rapidly expanded to cover the entire inflorescences. Diseased tissues (4×4 mm) were cut from the infected lesions, surface disinfected with 0.5% NaOCl for 1 min, rinsed three times with sterile distilled water, placed onto potato dextrose agar (PDA) plates and incubated at 25°C under 12-h photoperiod for 5 days. A total of 8 single-spore isolates were obtained from all sampled inflorescence tissues. The fungal colonies appeared white, turned grayish black with age and pale yellow on the reverse side. Conidia were one-celled, hyaline, subcylindrical with rounded end and 3 to 4 μm (width) and 13 to 15 μm (length) in size. For fungal identification to species level, genomic DNA of representative isolate (isolate C) was extracted using DNeasy Plant Mini Kit (Qiagen, USA). Internal transcribed spacer (ITS) region, calmodulin (CAL), actin (ACT), and chitin synthase-1 (CHS-1) were amplified using ITS5/ITS4 (White et al. 1990), CL1C/CL2C (Weir et al. 2012), ACT-512F/783R, and CHS-79F/CHS-345R primer sets (Carbone and Kohn 1999), respectively. A BLAST nucleotide search of ITS, CHS-1, CAL and ACT sequences showed 100% similarity to Colletotrichum siamense ex-type cultures strain C1315.2 (GenBank accession nos. ITS: JX010171 and CHS-1: JX009865) and isolate BPDI2 (CAL: FJ917505, ACT: FJ907423). The ITS, CHS-1, CAL and ACT sequences were deposited in GenBank as accession numbers MT571330, MW192791, MW192792 and MW140016. Pathogenicity was confirmed by spraying a spore suspension (1×106 spores/ml) of 7-day-old culture of isolate C onto 10 healthy inflorescences on five healthy Thai basil plants. Ten infloresences from an additional five control plants were only sprayed with sterile distilled water and the inoculated plants were covered with plastic bags for 2 days and maintained in a greenhouse at 28 ± 1°C, 98% relative humidity with a photoperiod of 12-h. Blossom blight symptoms resembling those observed in the field developed after 7 days on all inoculated inflorescences, while inflorescences on control plants remained asymptomatic. The experiment was repeated twice. C. siamense was successfully re-isolated from the infected inflorescences fulfilling Koch’s postulates. C. siamense has been reported causing blossom blight of Uraria in India (Srivastava et al. 2017), anthracnose on dragon fruit in India and fruits of Acca sellowiana in Brazil (Abirami et al. 2019; Fantinel et al. 2017). This pathogen can cause a serious threat to cultivation of Thai basil and there is currently no effective disease management strategy to control this disease. To our knowledge, this is the first report of blossom blight caused by C. siamense on Thai basil in Malaysia.

scholarly journals First Report of Mucor spp. Causing Root Rot of Radix pseudstellariae in Guizhou Province of China

Plant Disease ◽  
2020 ◽  
Author(s):  
Hongmiao Wu ◽  
Jiachun Wu ◽  
Feng Li ◽  
Ling Zheng ◽  
Jingkai Fan ◽  
...  
Keyword(s):  
Root Rot ◽  
Disease Incidence ◽  
Acid Soils ◽  
Its Region ◽  
Significant Loss ◽  
Day Length ◽  
Guizhou Province ◽  
First Report ◽  
Chinese Medicinal Plants ◽  
Branched Chains

Radix pseudostellariae L. is one of the most common and highly-prized Chinese medicinal plants with various pharmacological effects, and mainly produced in acid soils in the Guizhou and Fujian provinces of southwestern and southeastern China, respectively (Wu et al. 2020). However, consecutive monoculture of R. pseudostellariae results in severe root rot and decline in biomass and quality of underground tubers. Root tubers of R. pseudostellariae are typically planted in December and harvested in next June. Root rot commonly starts developing in May. The disease incidence of root rot was ranging from 37 to 46% in root portions and basal stem of R. pseudostellariae under the consecutive monoculture fields in Shibing County, Guizhou Province, China (108°12ʹE, 27°03ʹN) (Li et al. 2017). Severe root rot was observed in Shibing County in May 2018. Infected plants displayed curly, withered, and yellow leaves, blight, retarded growth, root rot, and yield losses. Abundant whitish mycelia were observed on roots and surrounding soil. Two fungal isolates, designated GZ20190123 and GZ20190124, were obtained from symptomatic roots cultured on potato dextrose agar (PDA). The optimum temperature range for growth of the two isolates was 25 to 30°C. The optimum pH range for the growth of GZ20190123 was 5 to 5.5, whereas GZ20190124 grew better between pH 5 to 8.5. The mean mycelial growth rates of GZ20190123 and GZ20190124 at 30°C were 2.1 and 1.5 cm/day, respectively. Conidia of the two isolates were ovoid or obclavate and were produced in single or branched chains. The internal transcribed spacer (ITS) region was amplified with primers ITS1 and ITS4 (White et al. 1990). The sequences were deposited in GenBank as accession No. MN726736 for GZ20190123 and MN726738 for GZ20190124. Sequence comparison revealed 99% (GZ20190123) and 97% (GZ20190124) identity with previously reported isolate xsd08071 of Mucor racemosus Bull. (accession No. FJ582639.1) and isolate BM3 of Mucor fragilis Bainier (accession No. MK910058.1), respectively, which was confirmed by phylogenetic analysis. The two isolates were tested for pathogenicity on R. pseudostellariae. Six roots of R. pseudostellariae were surface-sterilized with 75% ethanol and stab inoculated with mycelia using a sterile toothpick for each isolate. Sterile distilled water was stab inoculated to twelve roots to serve as the control. Treated roots were incubated in a greenhouse with 16 h day length [light intensity 146.5 μmol/(m2·s)] and day/night temperature 26°C/18°C. The inoculated roots showed the expected symptoms on roots and sprouts 7 days after inoculation, whereas the control roots with sprouts did not show any symptom. The fungi were re-isolated from the diseased roots and confirmed as expected M. racemosus or M. fragilis based on the ITS sequences, which satisfied Koch’s postulates. Thus, isolate GZ20190123 was identified as M. racemosus and GZ20190124 as M. fragilis. Previously, M. racemosus and M. fragilis have been reported as a pathogen on tomato (Kwon and Hong 2005) and grape (Ghuffar et al. 2018), respectively. To our knowledge, this is the first report of M. racemosus and M. fragilis causing root rot of R. pseudostellariae in southwestern China, where the disease could cause a significant loss to production of this important medicinal plant.

scholarly journals First Report of Colletotrichum siamense Causing Anthracnose of Monstera deliciosa in Zhanjiang, China

Plant Disease ◽  
2020 ◽  
Author(s):  
Yue Lian Liu ◽  
Jian Rong Tang ◽  
Yu Han Zhou
Keyword(s):  
Disease Incidence ◽  
Morphological Characteristics ◽  
Pathogenicity Test ◽  
Sterile Water ◽  
Single Spore ◽  
First Report ◽  
Rdna Its ◽  
Colletotrichum Siamense ◽  
Monstera Deliciosa ◽  
Pure Cultures

Monstera deliciosa Liebm is an ornamental foliage plant (Zhen et al. 2020De Lojo and De Benedetto 2014). In July of 2019, anthracnose lesions were observed on leaves of M. deliciosa cv. Duokong with 20% disease incidence of 100 plants at Guangdong Ocean University campus (21.17N,110.18E), Guangdong Province, China. Initially affected leaves showed chlorotic spots, which coalesced into larger irregular or circular lesions. The centers of spots were gray with a brown border surrounded by a yellow halo (Supplementary figure 1). Twenty diseased leaves were collected for pathogen isolation. Margins of diseased tissue was cut into 2 × 2 mm pieces, surface-disinfected with 75% ethanol for 30 s and 2% sodium hypochlorite (NaOCl) for 60 s, rinsed three times with sterile water before isolation. Potato dextrose agar (PDA) was used to culture pathogens at 28℃ in dark. Successively, pure cultures were obtained by transferring hyphal tips to new PDA plates. Fourteen isolates were obtained from 20 leaves. Three single-spore isolates (PSC-1, PSC-2, and PSC-3) were obtained ,obtained, which were identical in morphology and molecular analysis (ITS). Therefore, the representative isolate PSC-1 was used for further study. The culture of isolate PSC-1 on PDA was initially white and later became cottony, light gray in 4 days, at 28 °C. Conidia were single celled, hyaline, cylindrical, clavate, and measured 13.2 to 18.3 µm × 3.3 to 6.5 µm (n = 30). Appressoria were elliptical or subglobose, dark brown, and ranged from 6.3 to 9.5 µm × 5.7 to 6.5 µm (n = 30). Morphological characteristics of isolate PSC-1 were consistent with the description of Colletotrichum siamense (Prihastuti et al. 2009; Sharma et al. 2013). DNA of the isolate PSC-1 was extracted for PCR sequencing using primers for the rDNA ITS (ITS1/ITS4), GAPDH (GDF1/GDR1), ACT (ACT-512F/ACT-783R), CAL (CL1C/CL2C), and TUB2 (βT2a/βT2b) (Weir et al. 2012). Analysis of the ITS (accession no. MN243535), GAPDH (MN243538), ACT (MN512640), CAL (MT163731), and TUB2 (MN512643) sequences revealed a 97-100% identity with the corresponding ITS (JX010161), GAPDH (JX010002), ACT (FJ907423), CAL (JX009714) and TUB2 (KP703502) sequences of C. siamense in GenBank. A phylogenetic tree was generated based on the concatenated sequences of ITS, GAPDH, ACT, CAL, and TUB2 which clustered the isolate PSC-1 with C. siamense the type strain ICMP 18578 (Supplementary figure 2). Based on morphological characteristics and phylogenetic analysis, the isolate PSC-1 associated with anthracnose of M. deliciosa was identified as C. siamense. Pathogenicity test was performed in a greenhouse at 24 to 30oC with 80% relative humidity. Ten healthy plants of cv. Duokong (3-month-old) were grown in pots with one plant in each pot. Five plants were inoculated by spraying a spore suspension (105 spores ml-1) of the isolate PSC-1 onto leaves until runoff, and five plants were sprayed with sterile water as controls. The test was conducted three times. Anthracnose lesions as earlier were observed on the leaves after two weeks, whereas control plants remained symptomless. The pathogen re-isolated from all inoculated leaves was identical to the isolate PSC-1 by morphology and ITS analysis, but not from control plants. C. gloeosporioides has been reported to cause anthracnose of M. deliciosa (Katakam, et al. 2017). To the best of our knowledge, this is the first report of C. siamense causing anthracnose on M. deliciosa in ChinaC. siamense causes anthracnose on a variety of plant hosts, but not including M. deliciosa (Yanan, et al. 2019). To the best of our knowledge, this is the first report of C. siamense causing anthracnose on M. deliciosa, which provides a basis for focusing on the management of the disease in future.

scholarly journals First Report of Root Rot of Soybeans Caused by Corynespora cassiicola in Wisconsin

Plant Disease ◽  
1999 ◽  
Vol 83 (7) ◽  
pp. 696-696 ◽  
Author(s):  
S. J. Raffel ◽  
E. R. Kazmar ◽  
R. Winberg ◽  
E. S. Oplinger ◽  
J. Handelsman ◽  
...  
Keyword(s):  
Root Rot ◽  
Growth Stage ◽  
Lateral Roots ◽  
Seedling Emergence ◽  
Fluorescent Light ◽  
Corynespora Cassiicola ◽  
First Report ◽  
Seedling Roots ◽  
Symptomatic Tissue ◽  
Soybean Plants

Corynespora cassiicola (Berk. & M. A. Curtis) C. T. Wei was isolated from diseased soybean plants (Glycine max) collected in two fields near Racine and Arlington, WI. Plants sampled at seedling emergence (VC), late vegetative (V5), and mid-reproductive (R5) stages exhibited reddish to dark brown longitudinal lesions on the exterior of the tap root extending vertically on the hypocotyl to the soil line, and extensive necrosis of lateral roots. Sample size at each growth stage was 144 plants per site. Roots were surface sterilized in 0.5% sodium hypochlorite for 2 min and sections of symptomatic tissue placed on water agar (12 g/liter) containing 100 μg of streptomycin per ml. Sporulation occurred on lesions and on mycelium that had grown out from the plant tissue onto the water agar following a 2-week incubation at 24°C under fluorescent light (280 μmol s-1 m-2). Incidence of isolation of C. cassiicola at both sites was 40% of plants sampled at growth stage VC, 67% at V5, and 78% at R5. Conidia characteristic of C. cassiicola were particularly abundant on the surface of necrotic lateral root tissue. Elongated conidia produced on water agar were 151 ± 5 μm × 15 ± 0.5 μm with an average of 13 ± 0.4 cells separated by hyaline pseudosepta (1). To confirm pathogenicity, a 1-cm lateral slice into each of four 5-day-old soybean seedling roots was made and a plug of agar taken from the margin of a colony of C. cassiicola grown on potato dextrose agar was placed in each wound and incubated for 14 days at 24°C in a growth chamber. Symptoms similar to those of diseased field plants were observed and C. cassiicola was reisolated from all plants inoculated with C. cassiicola; all controls treated with agar alone had no symptoms and C. cassiicola was recovered from none of the noninoculated controls. This is the first report of root rot caused by C. cassiicola on soybean in Wisconsin. Reference: (1) W. L. Seaman and R. A. Shoemaker. Can. J. Bot. 43:1461, 1965.

scholarly journals First Report of Phomopsis longicolla Causing Stem Canker of Eggplant in Fujian Province, China

Plant Disease ◽  
2021 ◽  
Author(s):  
Jinjie Hu ◽  
Qian Zhou ◽  
Chaohui Shi ◽  
Yexin Ke ◽  
Shun Xiao ◽  
...  
Keyword(s):  
Disease Incidence ◽  
Solanum Melongena ◽  
Stem Canker ◽  
Morphological Characters ◽  
Single Spore ◽  
Specific Primers ◽  
Fujian Province ◽  
Phomopsis Longicolla ◽  
Fungal Isolation ◽  
First Report

Eggplant (Solanum melongena L.) is one of the most popular vegetable in China. In July 2019, a serious stem canker disease of eggplant cv. Hangqieyiha has been found in commercial fields in Pingnan County, Fujian Province. The disease incidence ranged from 38% to 72%. The symptoms were found on stems but not on fruits. At first the lesions are small, more or less circular, later becoming elongated, blackish-brown lesions, eventually containing pycnidia. When stem girdling occurs, the shoot above the infected area wilts and dries up. The teleomorph of the fungus has not been encountered in sympotomatic stem. Single-conidial isolate has been obtained by using routine fungal-isolation methods and single-spore purification technique. The fungus was cultivated on potato dextrose agar (PDA), incubated under 12h/12h cycles of light and darkness until sporulation to determine. The fungus initially produced white fluffy aerial hyphae, forming relatively dense concentric pattern colony, which subsequently exhibited yellow-green pigmentation. Pycnidias had globose locules and prominent beaks, which immersed in medium, black, solitary, discoid or irregular. Conidiophores were colorless, separated, branched, 10.0 to 20.0 × 1.0 to 2.5 μm. Alpha-conidia were single-celled, ellipsoidal to fusiform, guttulate, 5.4 to 8.7 × 1.5 to 3.2 μm. Beta-conidia were found occasionally in older stock cultures, hyaline, filiform, hamate, and 17.0 to 26.9 × 0.86 to 1.23 μm. Based on these morphological characters, the fungus was identified as Phomopsis longicolla (Hobbs et al., 1985). The rDNA－ITS of the isolate FAFU01 was amplified with primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al., 1990)，and A 578 bp sequence obtained (GenBank Accession No. MW380387 ) was 96% to 98.3% identical to the known sequence of P. longicolla or Diaporthe longicolla in GenBank. For further confirmation, P. longicolla specific primers Phom.I /Phom.II (GAGCTCGCCACTAGATTTCAGGG/GGCGGCCAACCAAACTCTTGT) (Zhang et al., 1997) were used and a 337-bp amplification product was obtained which was previously reported only for P. longicolla, whereas no product was amplified from control. Based on these morphological and molecular characters, the fungus was identified as P. longicolla. In greenhouse tests, each of 35-day-old plants of eggplant cv. Hangqieyihao was maintained in 30-cm-diameter pot. Healthy stem on the plants was wounded by pinpricking. Both wounded and non-wounded stems were inoculated respectively with mycelial plugs (4 mm in diameter) from a 7-day-old PDA culture or PDA medium plugs as controls, with six replicates. The plants were covered with plastic bags to maintain high relative humidity for two days. Four days after inoculation, the plugs were washed from the stems. Thirty-five days after inoculation, canker lesions and small, black pycnidias, which were similar to those in the field, were observed on the surface of non-wounded and wounded healthy stems inoculated with pathogen, whereas all the control stems remained healthy. The fungi was re-isolated from the infected stems of plants and was further confirmed with the species-specific primers. These results confirmed the fungus’s pathogenicity. This is the first report of P. longicolla causing stem canker in eggplant in Fujian Province, China.

scholarly journals First Report of Passalora Leaf Spot Caused by Passalora bougainvilleae on Bougainvillea in Mexico

Plant Disease ◽  
2011 ◽  
Vol 95 (6) ◽  
pp. 775-775 ◽  
Author(s):  
V. Ayala-Escobar ◽  
V. Santiago-Santiago ◽  
A. Madariaga-Navarrete ◽  
A. Castañeda-Vildozola ◽  
C. Nava-Diaz
Keyword(s):  
Uv Light ◽  
Disease Incidence ◽  
Morphological Characteristics ◽  
The United States ◽  
Pathogenicity Test ◽  
Commonwealth Mycological Institute ◽  
Conidial Suspension ◽  
Single Spore ◽  
First Report ◽  
Bougainvillea Spectabilis

Bougainvillea (Bougainvillea spectabilis Willd) growing in 28 gardens during 2009 showed 100% disease incidence and 3 to 7% disease severity. Bougainvilleas with white flowers were the most affected. Symptoms consisted of light brown spots with dark brown margins visible on adaxial and abaxial sides of the leaves. Spots were circular, 2 to 7 mm in diameter, often surrounded by a chlorotic halo, and delimited by major leaf veins. Single-spore cultures were incubated at 24°C under near UV light for 7 days to obtain conidia. Pathogenicity was confirmed by spraying a conidial suspension (1 × 104 spores/ml) on leaves of potted bougainvillea plants (white, red, yellow, and purple flowers), incubating the plants in a dew chamber for 48 h and maintaining them in a greenhouse (20 to 24°C). Identical symptoms to those observed at the residential gardens appeared on inoculated plants after 45 to 60 days. The fungus was reisolated from inoculated plants that showed typical symptoms. No symptoms developed on control plants treated with sterile distilled water. The fungus produced distinct stromata that were dark brown, spherical to irregular, and 20 to 24 μm in diameter. Conidiophores were simple, born from the stromata, loose to dense fascicles, brown, straight to curved, not branched, zero to two septate, 14 × 2 μm, with two to four conspicuous and darkened scars. The conidia formed singly, were brown, broad, ellipsoid, obclavate, straight to curved with three to four septa, 40 × 4 μm, and finely verrucous with thick hilum at the end. Fungal DNA from the single-spore cultures was obtained using a commercial DNA Extraction Kit (Qiagen, Valencia, CA); ribosomal DNA was amplified with ITS5 and ITS4 primers and sequenced. The sequence was deposited at the National Center for Biotechnology Information Database (GenBank Accession Nos. HQ231216 and HQ231217). The symptoms (4), morphological characteristics (1,2,4), and pathogenicity test confirm the identity of the fungus as Passalora bougainvilleae (Muntañola) Castañeda & Braun (= Cercosporidium bougainvilleae Muntañola). This pathogen has been reported from Argentina, Brazil, Brunei, China, Cuba, El Salvador, India, Indonesia, Jamaica, Japan, Thailand, the United States, and Venezuela (3). To our knowledge, this is the first report of this disease on B. spectabilis Willd in Mexico. P. bougainvilleae may become an important disease of bougainvillea plants in tropical and subtropical areas of Mexico. References: (1) U. Braun and R. R. Castañeda. Cryptogam. Bot. 2/3:289, 1991. (2) M. B. Ellis. More Dematiaceous Hypomycetes. Commonwealth Mycological Institute, Kew, Surrey, UK, 1976. (3) C. Nakashima et al. Fungal Divers. 26:257, 2007. (4) K. L. Nechet and B. A. Halfeld-Vieira. Acta Amazonica 38:585, 2008.

scholarly journals First Report of Stem Rot and Wilt of Sunflower Caused by Sclerotinia minor in Spain

Plant Disease ◽  
2002 ◽  
Vol 86 (6) ◽  
pp. 697-697
Author(s):  
M. L. Molinero-Ruiz ◽  
J. M. Melero-Vara
Keyword(s):  
Helianthus Annuus ◽  
Root Rot ◽  
Mycelial Growth ◽  
Disease Incidence ◽  
Potato Dextrose Agar ◽  
Stem Rot ◽  
Sclerotinia Minor ◽  
Stem Base ◽  
First Report ◽  
White Mycelium

In 2001, sunflower (Helianthus annuus L.) plants with symptoms of stem and root rot and wilt were observed in Soria, Spain. Light brown, water-soaked lesions developed on the collar of infected plants and extended along the stem, affecting the pith and causing early and sudden wilt. White mycelium and sclerotia (0.5 to 2 mm long) formed in the pith of stems. The sclerotia were disinfested in NaClO (10% vol/vol) for 1 min, transferred to potato dextrose agar (PDA), and incubated at 20°C. The fungus consistently obtained was identified as Sclerotinia minor Jagger (1). Pathogenicity was confirmed in a greenhouse experiment (15 to 25°C, 13 h light). Seven-week-old plants of six genotypes of sunflower (‘Peredovik’, HA89, HA821, HA61, RHA274, and HA337) were inoculated by placing one PDA disk with active mycelial growth adjacent to each basal stem just below the soil line and covering it with peat/sand/silt (2:2:1, vol/vol). Six plants of each genotype were inoculated without wounding, and another six were inoculated immediately after stem base wounding with a scalpel; six wounded and uninoculated plants were used as controls. First symptoms (wilting) appeared 4 days after inoculation in all genotypes. Two weeks after inoculation, the percentage of dead plants ranged from 33 to 92% (depending on cultivar), white mycelium was observed at the base of affected plants, and sclerotia were present in the pith of diseased plants. There was no effect of plant wounding on disease incidence or severity, and the fungus was reisolated from inoculated plants. To our knowledge, this is the first report of S. minor in Spain. Reference: (1) L. M. Kohn. Mycotaxon IX 2:365, 1979.

scholarly journals First Report of Fusarium solani Causing Leaf Sheath Rot of Bush lily in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Yue Sun ◽  
Rui Wang ◽  
Kaibin Qiao ◽  
Hongyu Pan ◽  
Fengting Wang ◽  
...  
Keyword(s):  
Dna Sequences ◽  
Disease Incidence ◽  
Fusarium Species ◽  
Leaf Sheath ◽  
Conidial Suspension ◽  
Single Spore ◽  
First Report ◽  
Changchun City ◽  
Sheath Rot ◽  
Β Tubulin

Bush lily (Clivia miniata) is an important indoor flower. It is the city flower of Changchun City and has important ornamental and medicinal value in China where it is culitvated on an area of 125 hectare. During the summer of 2018, symptoms of a leaf sheath rot disease were observed on bush lily in 103 greenhouses in Changchun city, Jilin Province. The disease incidence ranged from 25 to 60% in 11 surveyed greenhouses. At the early stage, the diseased plants displayed symptoms as initial leaf sheath lesions. Progressively, the whole leaves wilted, and even the plant ultimately died. Once a leaf exhibits leaf sheath lesions, the whole plant’s ornamental value significantly drops. To identify the pathogen, symptomatic leaves were cut into pieces, surface sterilized, placed on potato dextrose agar (PDA) and incubated for 7 days at 25°C in the dark (Cao et al. 2013; the e-Xtra description for details). Fusarium single-spore isolates were obtained from characteristic colonies (Leslie et al. 2006). Two single-spore isolates were selected for further study. The isolates were identified as Fusarium spp. based on microscopic morphology on PDA. Fusarium-like colonies were white to slightly yellow with abundant cottony mycelia. Single or two-celled (single septum) microconidia were reniform or oval, 8.0 to 9.6×4.0 to 6.0m in size. The elongated conidiophores bearing microconidia in monophialides were observed (Summerbell et al. 2002). Macroconidia were abundant, sickle shaped, 18.8 to 34.8×6.4 to 6.8m, with one to three septa (Taylor et al. 2019). For molecular identification, five regions of ITS, EF1-α, RPB1, RPB2 and β-tubulin genes were amplified and sequenced. Sequences of five different regions exhibited at least 97.98% similiarity with the corresponding DNA sequences in F. solani species complex (FSSC) (the e-Xtra description for details). The phylogenetic analysis based on the EF1-α, RPB1, RPB2 and β-tubulin region sequences revealed that the isolated strain in this study was clustered with only F. solani species in the phylogenetic tree for each region. Based on morphological and molecular analysis, the isolated fungal strains were identified as F. solani. Pathogenicity was confirmed by injecting a conidial suspension (106 spores/mL) of the isolated strains in to surface surface-disinfested leaf sheath of 2-year-old potted healthy plants. As a negative control, four plants were injected with sterilized water. All plants were kept in a greenhouse with controlled conditions: 26°C, 50% to 75% relative humidity. The similar rot symptoms were observed on the leaf sheathes in the inoculated plants 30 days after inoculation whereas the control plants remained asymptomatic. The fungi reisolated from the experimental plants were confirmed to be F. solani by morphology and sequences analysis, thus completing Koch’s postulates. To the best of our knowledge, this is the first report of F. solani causing leaf sheath rot of bush lily in China, where this pathogen has been reported to cause rot diseases of other economically important ornamental plants such as Phalaenopsis, Dendrobium according to the U.S. National Fungus Collections (Farr et al. 2020). In recent years, other Fusarium species have been reported to cause rot diseases on bush lily, including F. proliferatum and F. oxysporum (Farr et al. 2020). This study will also provide critical information on the causal agent for growers to implement disease management strategies.

Sign in / Sign up

Export Citation Format

Share Document