scholarly journals First Report of Diaporthe foeniculina Associated with Grapevine Trunk Diseases on Vitis vinifera in Cyprus

Plant Disease ◽  
2021 ◽  
Author(s):  
Georgios Makris ◽  
Solonas Solonos ◽  
Marios Christodoulou ◽  
Loukas Kanetis
Keyword(s):  
Aerial Mycelium ◽  
Its Region ◽  
First Record ◽  
Colony Morphology ◽  
Sweet Chestnut ◽  
Grapevine Trunk Diseases ◽  
Near Ultraviolet ◽  
Bt Genes ◽  
Light Darkness ◽  
Trunk Diseases

In June 2017, three vineyards were surveyed in the regions of Droushia (30-year-old, cv Mavro), Ineia (50-year-old, cv Xynisteri), and Lemona (15-year-old, cv Carignan) at the province of Paphos, Cyprus, with dieback incidence of 22%, 32%, and 14%, respectively. More specifically, affected grapevines exhibited severe dieback symptoms in spur and cordon positions, related to perennial cankers and internal brown discoloration. Thirty symptomatic samples, were surface-sterilized (95% ethanol) and wood chips were plated on potato dextrose agar (PDA), amended with streptomycin (500 μg/ml) at 25 °C for 3-5 days. Based on colony morphology (white to creamy color, with sparse aerial mycelium) and conidia production, nine Diaporthe-like isolates were obtained. For species identification, the internal transcribed spacer (ITS) region and β-tubulin (BT) genes were amplified using the primer pairs ITS1/ITS4 and Bt2a/Bt2b, respectively (Úrbez-Torres et al. 2008). Sequences of the isolates P101b, P114c, and P289a revealed >99.8% homology to NCBI voucher specimens of Diaporthe foeniculina (Sacc.) Udayanga & Castl. (ITS: CBS111553, MH050434; ΒΤ: KY511368, KF778966), and were deposited in the GeneBank (ITS: MT735646, MT737289, MT737287; BT: MT903969, MT903970, MT903971). Thus, 8.3% of the collected isolates (3 of 36) were identified as D. foeniculina, while the rest Diaporthe-like isolates were identified as D. ampelina. D. foeniculina isolates were also transferred on 2% water agar with sterile pine needles under a 12h/12h near-ultraviolet, light/darkness regime, at 25 °C, to induce sporulation (Guarnaccia and Crous 2017). Two weeks later, microscopic observations revealed dark brown to black, globose to sub-globose, ostiolate pycnidia (n = 30) 291 to 897 μm (595 ± 173) x 192 to 655 μm (364 ± 113) containing hyaline, unbranched conidiophores, bearing alpha‐ and beta‐conidia in the form of yellowish cirri. Alpha-conidia were aseptate, hyaline, ovate to ellipsoidal, ranging (n=100) from 5.6 to 9.9 μm (7.5 ± 0.8) x 1.9 to 3.3 μm (2.7 ± 0.3). Beta-conidia were abundant, aseptate, hyaline, filiform, slightly curved (n = 100) from 22.4 to 35.3 μm (28.1 ± 2.5) x 1.2 to 2.3 μm (1.6 ± 0.2) (Udayanga et al. 2014). Pathogenicity tests were conducted with isolates P101b and P289a under greenhouse conditions (24-32 ⁰C, 70% RH). Ten 1-year-old rooted canes cv Mavro were inoculated with 4 mm mycelium plugs from actively growing cultures into wounds made by drilling between two internodes at the middle of the trunk. The same number of cuttings were inoculated with sterile PDA plugs, sealed with Vaseline, and wrapped with parafilm, serving as controls. Seven months later, all inoculated cuttings developed brownish wood discolorations (average 39 ± 13 mm), similar to naturally infected plants. No symptoms were observed in the controls. Successful re-isolations were made only from the inoculated cuttings and confirmed by colony morphology. Previously, D. foeniculina (as D. neotheicola) has been reported as grapevine wood saprophyte (Úrbez-Torres et al. 2014). It has also been reported to cause shoot canker and dieback in numerous hosts, including almond, avocado, citrus, and sweet chestnut (Annesi et al. 2016; Guarnaccia and Crous 2017; Diogo et al. 2010; Mathioudakis et al. 2020). This is the first record of D. foeniculina associated with grapevine trunk diseases (GTDs) in Cyprus. However, its relative importance as the causal agent of GTDs remains to be further investigated.

scholarly journals First Report of Neofusicoccum parvum Associated with Grapevine Trunk Diseases in Croatia

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1656-1656 ◽  
Author(s):  
J. Kaliternam ◽  
T. Milicevic ◽  
D. Bencic ◽  
B. Duralija
Keyword(s):  
Aerial Mycelium ◽  
Morphological Data ◽  
Width Ratio ◽  
Vitis Vinifera L ◽  
Internal Transcribed Spacer Region ◽  
Foeniculum Vulgare ◽  
Neofusicoccum Parvum ◽  
First Report ◽  
Grapevine Trunk Diseases ◽  
Trunk Diseases

In September 2010, during survey of diseased grapevines (Vitis vinifera L.) in vineyards at localities Zmajevac (BZ), Orahovica (SO), Cilipi (KC), and Novalja (PN), symptoms characteristic of grapevine trunk diseases (GTD) (3) were observed, showing on cross-sectioned cordons and trunks as brown, wedge-shaped perennial cankers and/or dark streaking of the wood. In Croatia, these symptoms were traditionally associated with Eutypa Tul. & C.Tul. and with fungi from Diaporthaceae (2). From affected grapevines (cvs. Grasevina, Pinot bijeli, Malvazija dubrovacka, and Gegic), samples of symptomatic cordons and trunks were collected (n ≥ 35). To isolate the causal agents from the samples, woodchips of symptomatic tissue, surface-sterilized in 2% sodium hypochlorite for 2 min, were placed on potato dextrose agar amended with streptomycin sulphate (50 μg/ml) and incubated for 7 days at 25°C in darkness. A percentage of samples (72, 15, 27, and 54% from BZ, SO, KC, and PN, respectively) yielded fungal colonies with abundant aerial mycelium, initially white, but turning olivaceous grey after 5 days. From these colonies, monohyphal isolates were obtained and pycnidial formation stimulated by cultivation on 2% water agar with stems of plant species Foeniculum vulgare Mill. at 25°C under diffuse light for 3 weeks. Pycnidia contained conidia that were hyaline, unicellular, ellipsoid with round apices and truncated bases, and thin walled with smooth surface. Dimensions of conidia (n ≥ 50) were (12.8) 15.3 ± 1.4 (17.6) × (5.4) 6.3 ± 0.8 (7.6) μm, with length/width ratio (2.0) 2.5 ± 0.5 (3.2). Based on morphological data, species Neofusicoccum parvum (Pennycook & Samuels) Crous, Slippers & A.J.L. Phillips was suspected (1). For molecular identification, isolates BZ330, SO334, KC342, and PN121 were used for PCR to amplify internal transcribed spacer region and partial translation elongation factor 1-alpha gene, using primers ITS5/ITS4 and EF1-728F/EF1-986R, respectively. Obtained sequences were shown to be identical between the four isolates (GenBank: KF296318, KF296319) and when compared with sequences for reference N. parvum isolate CMW9080 (AY236942, AY236887) they showed >99% homology, confirming the isolates as species N. parvum. Pathogenicity tests were done by inoculation of detached green shoots (GS) and lignified canes (LC) (n = 5) of grapevine cv. Skrlet by either mycelial plugs of the same four isolates, or sterile agar plugs for the controls. Inoculated GS were kept in flasks with sterile water in a glasshouse for 10 days, and LC in humid dark chambers for 30 days, at 25°C. Resulting vascular necrosis measured 62 to 81 mm (GS) and 215 to 246 mm (LC), but was absent on controls. Koch's postulates were satisfied by successful reisolation of N. parvum only from plants inoculated with mycelial plugs. N. parvum has been recognized as a serious grapevine pathogen, causing similar symptoms worldwide (3). To our knowledge, this is the first report of N. parvum associated with GTD in Croatia, and due to its relatively high incidence at surveyed localities, it could present considerable threat, particularly for neighboring vine growing regions. Diplodia seriata De Not., a weak pathogen (3), was also identified from a percentage of samples in this survey. References: (1) P. W. Crous et al. Stud. Mycol. 55:235, 2006. (2) J. Kaliterna et al. Arh. Hig. Rada Toksikol. 63:471, 2012. (3) J. R. Urbez-Torres. Phytopathol. Mediterr. 50(Suppl.):S5, 2011.

scholarly journals First Report of Phytophthora plurivora Causing Collar Rot on Common Alder in Spain

Plant Disease ◽  
2014 ◽  
Vol 98 (3) ◽  
pp. 425-425 ◽  
Author(s):  
M. M. Haque ◽  
P. Martínez-Álvarez ◽  
J. M. Lomba ◽  
J. Martín-García ◽  
J. J. Diez
Keyword(s):  
Aerial Mycelium ◽  
Its Region ◽  
Alnus Glutinosa ◽  
First Record ◽  
Pathogenicity Test ◽  
Soil Extracts ◽  
Collar Rot ◽  
Plant Pathol ◽  
Extent Of Damage ◽  
Potential Interactions

Phytophthora decline of riparian alder (Alnus spp.) has been reported in several European countries (2). Death of common alder (Alnus glutinosa) due to Phytophthora alni has also been reported in Spain (4). During several surveys of alder trees in September 2012, typical dieback symptoms, including sparse small yellowish foliage and the presence of rusty exudates on the bark at the collar and lower stem were observed in A. glutinosa growing on the banks of the river Tera (Langa de Duero, Soria, 41°36′34″ N, 3°25′10″ W, elevation 851 m) and the river Tormes (La Maya, Salamanca, 40°41′42″ N, 5°35′36″ W, elevation 833 m). Bark samples plus cambium were taken from the active lesions at collar region, cut into small pieces, dried on filter paper, and plated on V8-PARPH agar (2). The samples were incubated for 4 days at 20°C in the dark before obtaining the Phytophthora isolates. Colonies developed on V8 juice agar (V8A) had limited aerial mycelium at the center and displayed radiate and slightly chrysanthemum-like growth pattern. Mycelial growth was optimal at 25°C (radial growth rate, 8.2 mm d–1), whereas no growth was observed at 32°C. Isolates were homothallic with paragynous antheridia, smooth-walled spherical (very rarely elongated) oogonia (22.8 to 30.6 μm diam.) and both plerotic and aplerotic golden brown oospores (21.3 to 28.5 μm diam.). In non-sterile soil extracts, the isolates produced abundant sporangia (31.5 to 57.2 × 21.3 to 38.4 μm; length:breadth ratio 1.2 to 1.6) borne terminally on unbranched or sympodial sporagiophores, occasionally attached laterally to the sporangiophores. Sporagia were non-caducous, semipapillate, mainly ovoid and obpyriform, obovoid to limoniform but sometimes distorted with two apices. On the basis of the morpho-physiological features, the isolates resembled P. plurivora (formerly identified as P. citricola) (3). To confirm this, genomic DNA was extracted and subjected to PCR. The internal transcribed spacer (ITS) region of the rDNA was amplified using the ITS-6 (5′ GAAGGTGAAGTCGTAACAAGG 3′) and ITS-4 (5′ TCCTCCGCTTATTGATATGC 3′) primers before sequencing (Secugen, Madrid, Spain). The sequences were deposited in the EMBL/GenBank database (Accession Nos. KF413074 and KF413075). In order to perform the pathogenicity test, 10 A. glutinosa seedlings (2 years old) per isolate were inoculated by using the under-bark inoculation technique (1) and 10 control seedlings were inoculated with V8A. Seedlings were incubated in a growth chamber at 22.5°C with a 14-h photoperiod. Three months after inoculation, all inoculated plants wilted and died, whereas the control plants showed no disease symptoms. To fulfill Koch's postulates, the pathogen was re-isolated from the necrotic lesions developed around inoculation points, thus confirming its pathogenicity. P. plurivora has been found to be present in rhizosphere soil beneath Alnus spp. and to cause aerial canker and collar rot on alder trees in Austria, Germany, and Romania (2,3). Further studies and surveys are essential to determine the distribution, extent of damage, and potential interactions with other alder pathogens (e.g., P. alni). To our knowledge, this is the first record of P. plurivora affecting A. glutinosa in Spain. References: (1) T. Jung et al. Eur. J. For. Pathol. 26:253, 1996. (2) T. Jung and M. Blaschke. Plant Pathol. 53:197, 2004. (3) T. Jung and T. I. Burgess. Persoonia 22:95, 2009. (4) A. Solla et al. Plant Pathol. 59:798, 2010.

scholarly journals Isolation and identification of endophytic fungi connected to Grapevine Diseases, from the Tokaj wine region, Hungary

2014 ◽  
pp. 61-66 ◽  
Author(s):  
Csilla Kovács ◽  
Ferenc Peles ◽  
Xie Hongtao ◽  
Anikó Szojka ◽  
Gréta Hajdú ◽  
...  
Keyword(s):  
Endophytic Fungi ◽  
Genetic Basis ◽  
Colony Morphology ◽  
Isolation And Identification ◽  
Diplodia Seriata ◽  
Grapevine Trunk Diseases ◽  
Rdna Sequences ◽  
Trunk Diseases ◽  
Wine Region

Grapevine Trunk Diseases (GTD) is one of the most important diseases in vineyards worldwide, which can be found in Hungarian vineyards as well. In Hungarian wine regions there is very little information about the occurrence of pathogens which cause GTD, in case of Tokaj wine region there is no knowledge about that, what kind of pathogens can be found in the vineyards. The objective of our research is to assess the situation and occurrence of GTD in Tokaj wine region in cooperation with local specialists, as well as identification of pathogens which were isolated from the diseased trunks by morphological and genetic basis. We were able to isolate endophytic fungi from all sampled grape trunk. The majority of them were determined as Diplodia seriata not only based on colony morphology, but also determined by rDNA sequences.

scholarly journals Production of Phytotoxic Metabolites by Botryosphaeriaceae in Naturally Infected and Artificially Inoculated Grapevines

Plants ◽  
2021 ◽  
Vol 10 (4) ◽  
pp. 802
Author(s):  
Pierluigi Reveglia ◽  
Regina Billones-Baaijens ◽  
Jennifer Millera Millera Niem ◽  
Marco Masi ◽  
Alessio Cimmino ◽  
...  
Keyword(s):  
Fungal Pathogens ◽  
Protocatechuic Acid ◽  
Physiological Factors ◽  
Diplodia Seriata ◽  
Grapevine Trunk Diseases ◽  
Botryosphaeria Dieback ◽  
Trunk Diseases ◽  
One Year ◽  
Pathogen Dna

Grapevine trunk diseases (GTDs) are considered a serious problem to viticulture worldwide. Several GTD fungal pathogens produce phytotoxic metabolites (PMs) that were hypothesized to migrate to the foliage where they cause distinct symptoms. The role of PMs in the expression of Botryosphaeria dieback (BD) symptoms in naturally infected and artificially inoculated wood using molecular and analytical chemistry techniques was investigated. Wood samples from field vines naturally infected with BD and one-year-old vines inoculated with Diplodia seriata, Spencermartinsia viticola and Dothiorella vidmadera were analysed by cultural isolations, quantitative PCR (qPCR) and targeted LC-MS/MS to detect three PMs: (R)-mellein, protocatechuic acid and spencertoxin. (R)-mellein was detected in symptomatic naturally infected wood and vines artificially inoculated with D. seriata but was absent in all non-symptomatic wood. The amount of (R)-mellein detected was correlated with the amount of pathogen DNA detected by qPCR. Protocatechuic acid and spencertoxin were absent in all inoculated wood samples. (R)-mellein may be produced by the pathogen during infection to break down the wood, however it was not translocated into other parts of the vine. The foliar symptoms previously reported in vineyards may be due to a combination of PMs produced and climatic and physiological factors that require further investigation.

scholarly journals Assessment of Conjugate Complexes of Chitosan and Urtica dioica or Equisetum arvense Extracts for the Control of Grapevine Trunk Pathogens

Agronomy ◽  
2021 ◽  
Vol 11 (5) ◽  
pp. 976
Author(s):  
Natalia Langa-Lomba ◽  
Laura Buzón-Durán ◽  
Pablo Martín-Ramos ◽  
José Casanova-Gascón ◽  
Jesús Martín-Gil ◽  
...  
Keyword(s):  
Urtica Dioica ◽  
Gas Chromatography Mass Spectrometry ◽  
Equisetum Arvense ◽  
Grapevine Trunk Diseases ◽  
Trunk Diseases ◽  
Synergistic Behavior ◽  
Reported Data ◽  
Basic Substances

In the work presented herein, we analyze the efficacy of three basic substances that comply with European Regulation (EC) No 1107/2009, namely chitosan, horsetail (Equisetum arvense L.) and nettle (Urtica dioica L.), for the control of grapevine trunk diseases (GTDs) in organic farming. The E. arvense and U. dioica aqueous extracts, prepared according to SANCO/12386/2013 and SANTE/11809/2016, have been studied by gas chromatography–mass spectrometry (GC-MS), identifying their main active constituents. The three basic substances, either alone or in combination (forming conjugate complexes), have been tested in vitro against eight Botryosphaeriaceae species, and in vivo, in grafted plants artificially inoculated with Neofusicoccum parvum and Diplodia seriata. A clear synergistic behavior between chitosan and the two plant extracts has been observed in the mycelial growth inhibition tests (resulting in EC90 values as low as 208 μg·mL−1 for some of the isolates), and statistically significant differences have been found in terms of vascular necroses lengths between treated and non-treated plants, providing further evidence of aforementioned synergism in the case of D. seriata. The reported data supports the possibility of extending the applications of these three basic substances in Viticulture beyond the treatment of mildew.

The compositional turnover of grapevine-associated plant pathogenic fungal communities are greater among intraindividual microhabitats and terroirs than among healthy and Esca-diseased plants

2021 ◽  
Author(s):  
Adrienn Geiger ◽  
Zoltán Karácsony ◽  
Richárd Golen ◽  
Kálmán Zoltán Váczy ◽  
József Geml
Keyword(s):  
Pathogenic Fungi ◽  
Wine Industry ◽  
Fungal Communities ◽  
Opportunistic Pathogens ◽  
Grapevine Trunk Diseases ◽  
Esca Disease ◽  
Dna Metabarcoding ◽  
Trunk Diseases ◽  
Fungal Dna ◽  
Key Questions

Grapevine trunk diseases (GTD) are a major threat to the wine industry, causing yield loss and dieback of grapevines. While the increasing damage caused by GTDs in recent decades have spurred several studies on grapevine-associated pathogenic fungi, key questions about the emergence and severity of GTDs remain unanswered, including possible differences in plant pathogenic fungal communities in asymptomatic and symptomatic grapevines. We generated fungal DNA metabarcoding data from soil, bark, and perennial wood samples from asymptomatic and symptomatic grapevines sampled in three terroirs. We observed larger compositional differences in plant pathogenic fungi among different plants parts within grapevine plants than among individual grapevines. This is driven by the dominance of GTD-associated fungi in perennial wood and non-GTD pathogens in soil, as well as by the lack of significant differences among asymptomatic and Esca symptomatic grapevines. These results suggest that fungi generally associated with Esca disease belong to the core grapevine microbiome and likely are commensal endophytes and/or latent saprotrophs, some of which can act as opportunistic pathogens on stressed plants. In addition, we found significant compositional differences among sampling sites, particularly in soil, which suggest a certain influence of local edaphic and mesclimatic factors on plant pathogenic fungal communities. Furthermore, the observed differences among terroirs in plant pathogenic fungal communities in grapevine woody parts indicate that environmental factors likely are important for the development of Esca disease and further studies are needed to investigate the abiotic conditions on fungal compositional dynamics in Esca-affected plants.

scholarly journals First Report of Stem Canker Disease of Pitaya (Hylocereus undatus and H. polyrhizus) Caused by Neoscytalidium dimidiatum in Taiwan

Plant Disease ◽  
2012 ◽  
Vol 96 (6) ◽  
pp. 906-906 ◽  
Author(s):  
M. F. Chuang ◽  
H. F. Ni ◽  
H. R. Yang ◽  
S. L. Shu ◽  
S. Y. Lai ◽  
...  
Keyword(s):  
New York ◽  
Aerial Mycelium ◽  
Its Region ◽  
Stem Canker ◽  
Canker Disease ◽  
First Report ◽  
Neoscytalidium Dimidiatum ◽  
Succulent Plant ◽  
Sterile Medium ◽  
Hylocereus Undatus

Pitaya (Hylocereus undatus and H. polyrhizus Britt. & Rose), a perennial succulent plant grown in the tropics, is becoming an emerging and important fruit plant in Taiwan. In September of 2009 and 2010, a number of pitaya plants were found to have a distinctive canker on stems. The disease expanded quickly to most commercial planting areas in Taiwan (e.g., Pintung, Chiayi, and Chunghua). Symptoms on the stem were small, circular, sunken, orange spots that developed into cankers. Pycnidia were erumpent from the surface of the cankers and the stems subsequently rotted. After surface disinfestation with 0.1% sodium hypochloride, tissues adjacent to cankers were placed on acidified potato dextrose agar (PDA) and incubated at room temperature for 1 week, after which colonies with dark gray-to-black aerial mycelium grew. Hyphae were branched, septate, and brown and disarticulated into 0- to 1-septate arthrospores. Sporulation was induced by culturing on sterile horsetail tree (Casuarina equisetifolia) leaves. Conidia (12.79 ± 0.72 × 5.14 ± 0.30 μm) from pycnidia were one-celled, hyaline, and ovate. The internal transcribed spacer (ITS) region of ribosomal DNA was PCR amplified with primers ITS1 and ITS4 (2) and sequenced. The sequence (GenBank Accession No. HQ439174) showed 99% identity to Neoscytalidium dimidiatum (Penz.) Crous & Slippers (GenBank Accession No. GQ330903). On the basis of morphology and nucleotide-sequence identity, the isolates were identified as N. dimidiatum (1). Pathogenicity tests were conducted in two replicates by inoculating six surface-sterilized detached stems of pitaya with either mycelium or conidia. Mycelial plugs from 2-day-old cultures (incubated at 25°C under near UV) were inoculated to the detached stems after wounding with a sterile needle. Conidial suspensions (103 conidia/ml in 200 μl) were inoculated to nonwounded stems. Noninoculated controls were treated with sterile medium or water. Stems were then incubated in a plastic box at 100% relative humidity and darkness at 30°C for 2 days. The symptoms described above were observed on inoculated stems at 6 to 14 days postinoculation, whereas control stems did not develop any symptoms. N. dimidiatum was reisolated from symptomatic tissues. To our knowledge, this is the first report of N. dimidiatum causing stem canker of pitaya. References: (1) P. W. Crous et al. Stud. Mycol. 55:235, 2006. (2) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, New York, 1990.

scholarly journals Symptoms and management of grapevine trunk diseases

2019 ◽  
Vol 20 (3) ◽  
pp. 876-890
Author(s):  
Kristina Grozić ◽  
Marijan Bubola ◽  
Danijela Poljuha
Keyword(s):  
Grapevine Trunk Diseases ◽  
Trunk Diseases

scholarly journals First Report of Myrothecium roridum Causing Leaf Spot on Zantedeschia aethiopica in China

Plant Disease ◽  
2014 ◽  
Vol 98 (6) ◽  
pp. 854-854 ◽  
Author(s):  
B.-J. Li ◽  
H.-Y. Ben ◽  
Y.-X. Shi ◽  
X.-W. Xie ◽  
A.-L. Chai
Keyword(s):  
Leaf Spot ◽  
Morphological Characteristics ◽  
Its Region ◽  
First Record ◽  
Conidial Suspension ◽  
Isolation And Identification ◽  
Zantedeschia Aethiopica ◽  
Calla Lily ◽  
Initial Symptoms ◽  
Myrothecium Roridum

Zantedeschia aethiopica (L.) Spreng. (calla lily), belonging to family Araceae, is a popular ornamental plant in China. In the summer of 2010, leaves of calla lily with typical symptoms of necrotic lesions were observed in a commercial glasshouse in Beijing, China (116°20′ E, 39°44′ N). The initial symptoms were circular to subcircular, 1 to 3 mm, and dark brown lesions on the leaf lamina. Under high humidity, lesions expanded rapidly to 5 to 10 mm with distinct concentric zones and produced black sporodochia, especially on the backs of leaves. Later, the infected leaves were developing a combination of leaf lesions, yellowing, and falling off; as a result, the aesthetic value of the plant was significantly impacted. Leaf samples were used in pathogen isolation. Symptomatic leaf tissues were cut into small pieces and surface sterilized with 70% ethanol for 30 s and then in 0.1% mercuric chloride solution for 1 to 3 min. After being washed in sterile distilled water three times, the pieces were plated on potato dextrose agar (PDA) and incubated at 25°C in darkness for 7 days (5). Initial colonies of isolates were white, floccose mycelium and developed dark green to black concentric rings that were sporodochia bearing viscid spore masses after incubating 5 days. Conidiophores branched repeatedly. Conidiogenous cells were hyaline, clavate, and 10.0 to 16.0 × 1.4 to 2.0 μm. Conidia were hyaline, cylindrical, both rounded ends, and 6.0 to 8.2 × 1.9 to 2.4 μm. Morphological characteristics of the fungus were consistent with the description of Myrothecium roridum Tode ex Fr. (3,4). To confirm the pathogenicity, three healthy plants of calla lily were inoculated with a conidial suspension (1 × 106 conidia per ml) brushed from a 7-day-old culture of the fungus. Control plants were sprayed with sterile water. The inoculated plants were individual with clear plastic bags and placed in a glass cabinet at 25°C. After 7 days, all inoculated leaves developed symptoms similar to the original samples, but control plants remained disease free. Re-isolation and identification confirmed Koch's postulates. For molecular identification, genomic DNA of a representative isolate (MTL07081001) was extracted by modified CTAB method (1), and the rDNA-ITS region was amplified by using primers ITS1 (5-TCCGTAGGTGAACCTGCGG-3) and ITS4 (5-TCCTCCGCTTATTGATATGC-3). The 465-bp amplicon (GenBank Accession No. KF761293) was 100% identity to the sequence of M. roridum (JF724158.1) from GenBank. M. roridum has an extensive host range, covering 294 host plants (2). To our knowledge, this is the first record of leaf spot caused by M. roridum on calla lily in China. References: (1) F. M. Ausubel et al. Current Protocols in Molecular Biology. John Wiley & Sons Inc, New York, 1994. (2) D. F. Farr and A. Y. Rossman, Fungal Databases. Syst. Mycol. Microbiol. Lab., ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , October 2013. (3) M. T. Mmbaga et al. Plant Dis. 94:1266, 2010. (4) Y. X. Zhang et al. Plant Dis. 95:1030, 2011. (5) L. Zhu et al. J. Phytopathol. 161:59, 2013.

Sign in / Sign up

Export Citation Format

Share Document