First Report of ‘Candidatus Phytoplasma aurantifolia’ Associated With Severe Stunting and Necrosis on the Invasive Weed Pelargonium capitatum in Western Australia

Pelargonium capitatum (rose pelargonium) is a plant indigenous to southern Africa, originally brought to Western Australia for its ornamental qualities. It has since become naturalized in the Southwest Australian Floristic Region, recognized for its high level of species endemism, where it is a serious invasive weed in bushlands and coastal dunes. Since P. capitatum outcompetes native species it is listed among the top 10 most important coastal weeds of the region (3). In 2008, large patches of stunted, dying, and dead P. capitatum plants were observed within a population covering coastal dunes at Woodman Point, Western Australia (GPS coordinates 32°07′40.51″S, 115°45′28.39″E). Diseased plants had small misshapen leaves in clumps that were often chlorotic or pink, shortened internodes, and exhibited phylloidy typical of infection by a phytoplasma. From August 2009 to January 2010, samples from symptomatic and asymptomatic plants were collected from the site and from plants of an asymptomatic population at another site located on the Murdoch University campus nearby. DNA was extracted from 15 samples collected from symptomatic and asymptomatic plants at the dune site and from five at the campus site. Briefly, 2 to 5 g of leaf and stem tissue was cut into 5-mm pieces and shaken overnight in 30 ml of phosphate-buffered saline buffer. Supernatant was filtered and a pellet was collected by centrifugation. After resuspension in 500 μl of extraction buffer (200 mM Tris-HCl [pH 7.5] 250mM NaCl, 25mM ethylenediaminetetraacetic acid, 0.5% sodium dodecyl sulfate, and 2% polyvinylpyrrolidone), DNA was precipitated in 500 μl of cold isopropanol. Samples were tested for the presence of phytoplasma ribosomal 16S DNA by nested PCR using phytoplasma universal primers P1/P7 followed by amplification with primers Tint, R16mF2, and R16mR1 (1,2,4). Phytoplasma-specific DNA sequences were synthesized directly from amplicons using the above primers. Phytoplasma was detected from both symptomatic and asymptomatic plant samples collected from the dune site but not from the campus site. Analysis of the nine sequences obtained (GenBank Accession Nos. HM583339, HM583340, HM583341, HM583342, HM583343, HM583344, HM583345, HM583346, and HM583347) revealed high sequence identity between isolates (~99%) and with the ‘Candidatus Phytoplasma aurantifolia’ (16SrII) group of phytoplasmas (1,4). Presence of phytoplasma in symptomatic plants was confirmed by histological examination of stem sections stained with Dienes' stain. This finding is significant because there is potential for utilizing this phytoplasma to control P. capitatum where it has invaded ecologically significant sites, although its effect on indigenous plants must be determined first. Although phytoplasmas within the 16SrII group have been identified in Australia previously (1,4), to our knowledge, this is the first report of it infecting P. capitatum. References: (1) K. S. Gibb et al. Phytopathology 85:169, 1995. (2) D. E. Gundersen and I.-M. Lee. Phytopathol. Mediterr. 35:144, 1996. (3) B. M. J. Hussey et al. Western Weeds. A Guide to the Weeds of Western Australia. 2nd ed. Plant Protection Society of Western Australia, Victoria Park, 2007. (4) M. Saqib et al. J. R. Soc. West. Aust. 90:175, 2007.

Download Full-text

First Report of Rice Blast (Magnaporthe oryzae) on Rice (Oryza sativa) in Western Australia

Plant Disease ◽

10.1094/pdis-05-12-0420-pdn ◽

2012 ◽

Vol 96 (8) ◽

pp. 1228-1228 ◽

Cited By ~ 4

Author(s):

M. P. You ◽

V. Lanoiselet ◽

C. P. Wang ◽

R. G. Shivas ◽

Y. P. Li ◽

...

Keyword(s):

Oryza Sativa ◽

Western Australia ◽

Magnaporthe Oryzae ◽

Leaf Spot ◽

Rice Blast ◽

Universal Primers ◽

Rrna Gene ◽

Sequence Information ◽

First Report ◽

Β Tubulin

Commercial rice crops (Oryza sativa L.) have been recently reintroduced to the Ord River Irrigation Area in northern Western Australia. In early August 2011, unusual leaf spot symptoms were observed by a local rice grower on rice cultivar Quest. A leaf spot symptom initially appeared as grey-green and/or water soaked with a darker green border and then expanded rapidly to several centimeters in length and became light tan in color with a distinct necrotic border. Isolations from typical leaf lesions were made onto water agar, subcultured onto potato dextrose agar, and maintained at 20°C. A representative culture was lodged in the Western Australian Culture Collection Herbarium, Department of Agriculture and Food Western Australia (WAC 13466) and as a herbarium specimen in the Plant Pathology Herbarium, Plant Biosecurity Science (BRIP 54721). Amplification of the internal transcribed spacer (ITS)1 and (ITS)2 regions flanking the 5.8S rRNA gene were carried out with universal primers ITS1 and ITS4 (4). The PCR products were sequenced and BLAST analyses used to compare sequences with those in GenBank. The sequence had 99% nucleotide identity with the corresponding sequence in GenBank for Magnaporthe oryzae B.C. Couch, the causal agent of rice blast, the most important fungal disease of rice worldwide (1). Additional sequencing with the primers Bt1a/Bt1b for the β-tubulin gene, primers ACT-512F/ACT-783R for the actin gene, and primers CAL-228F/CAL-737R for the calmodulin gene showed 100% identity in each case with M. oryzae sequences in GenBank, confirming molecular similarity with other reports, e.g., (1). The relevant sequence information for a representative isolate has been lodged in GenBank (GenBank Accession Nos. JQ911754 for (ITS) 1 and 2; JX014265 for β-tubulin; JX035809 for actin; and JX035808 for calmodulin). Isolates also showed morphological similarity with M. oryzae as described in other reports, e.g., (3). Spores of M. oryzae were produced on rice agar under “black light” at 21°C for 4 weeks. Under 30/28°C (day/night), 14/12 h (light/dark), rice cv. Quest was grown for 7 weeks, and inoculated by spraying a suspension 5 × 105 spores/ml onto foliage until runoff occurred. Inoculated plants were placed under a dark plastic covering for 72 h to maximize humidity levels around leaves, and subsequently maintained under >90% RH conditions. Typical symptoms of rice blast appeared within 14 days of inoculation and were as described above. Infection studies were successfully repeated and M. oryzae was readily reisolated from leaf lesions. No disease symptoms were observed nor was M. oryzae isolated from water-inoculated control rice plants. There have been previous records of rice blast in the Northern Territory (2) and Queensland, Australia (Australian Plant Pest Database), but this is the first report of M. oryzae in Western Australia, where it could potentially be destructive if conditions prove conducive. References: (1) B. C. Couch and L. M. Kohn. Mycologia 94:683, 2002; (2) J. B. Heaton. The Aust. J. Sci. 27:81, 1964; (3) C. V. Subramanian. IMI Descriptions of Fungi and Bacteria No 169, Pyricularia oryzae, 1968; (4) T. J. White et al. PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, New York, 1990.

Download Full-text

First Report of Bituminaria Witches'-Broom in Australia Caused by a 16SrII Phytoplasma

Plant Disease ◽

10.1094/pdis-10-10-0738 ◽

2011 ◽

Vol 95 (2) ◽

pp. 226-226 ◽

Cited By ~ 9

Author(s):

N. Aryamanesh ◽

A. M. Al-Subhi ◽

R. Snowball ◽

G. Yan ◽

K. H. M. Siddique

Keyword(s):

Canary Islands ◽

Western Australia ◽

Nested Pcr ◽

Perfect Match ◽

Universal Primers ◽

Healthy Plant ◽

Rrna Gene ◽

Polymorphism Analysis ◽

First Report ◽

Two Samples

Bituminaria bituminosa (L.) Stirt. is a perennial legume known as Arabian pea that is used as a forage in arid areas and for stabilization of degraded soils. It is widely distributed in the Mediterranean Basin with wider adaptation across the Canary Islands (4). In July 2010, during a survey for phytoplasma, some Canary Island B. bituminosa plants with typical phytoplasma symptoms, including stunted growth with small leaves, shortened internodes, and bushy growth, were found in seed multiplication nurseries at Medina, Perth, Western Australia (115°48.5′E; 32°13.2′S). Two samples from plants with clear disease symptoms and two visibly healthy plants were collected and total DNA was extracted with the Illustra DNA extraction kit Phytopure (GE Healthcare) according to the manufacturer's instructions. Direct and nested PCR were used to test the presence of phytoplasma 16S rDNA in samples with universal primers P1/P7 and R16F2n/R16R2, respectively (1,3). The PCR amplifications from all diseased samples yielded an expected product of 1.8 kb by direct and 1.2 kb by nested PCR, but not from the healthy plant samples. The direct PCR product was used as a template DNA in sequencing and the DNA sequence was deposited in the NCBI GenBank (Accession No. HQ404357). Sequence homology analysis indicated there was a perfect match between the two isolates. BLAST search of the NCBI GenBank revealed that B. bituminosa phytoplasma shares >99% sequence identity with Crotalaria witches'-broom phytoplasma (Accession No. EU650181.1), pear decline phytoplasma (Accession No. EF656453.1), and Scaevola witches'-broom phytoplasma (Accession No. AB257291.1). On the basis of BLAST analyses of 16S rRNA gene sequences, B. bituminosa phytoplasma in Western Australia appears to belong to the peanut witches'-broom group (16SrII-D) of phytoplasma. Restriction fragment length polymorphism analysis was also performed on nested PCR products of two samples of B. bituminosa phytoplasma by separate digestion with HaeIII, Hind6I, HpaII, MboI, RsaI, Tru9I, and T-HB8I restriction enzymes. Samples yielded patterns similar to alfalfa witches'-broom phytoplasma (Accession No. AF438413) belonging to subgroup 16SrII-D (2). To our knowledge, this is the first report of a phytoplasma of the 16SrII-D group infecting B. bituminosa in Australia and should be referred to as “Bituminaria witches'-broom phytoplasma” (BiWB). This report also indicates that the occurrence of the phytoplasma in B. bituminosa may be widespread in the Canary Islands and other species of Bituminaria might be susceptible to infection by Bituminaria witches'-broom phytoplasma. References: (1) D. E. Gundersen and I.-M. Lee. Phytopathol. Mediterr. 35:144, 1996. (2) A. J. Khan et al. Phytopathology 92:1038, 2002. (3) I.-M. Lee et al. Int. J. Syst. Evol. Microbiol. 54:337, 2004. (4) P. Mendez et al. Grassland Sci. Eur. 11:300, 2006.

Download Full-text

First Report of Fusarium oxysporum and F. solani Causing Fusarium Dry Rot of Carrot in China

Plant Disease ◽

10.1094/pdis-02-14-0156-pdn ◽

2014 ◽

Vol 98 (9) ◽

pp. 1273-1273 ◽

Cited By ~ 1

Author(s):

X. Y. Zhang ◽

J. Hu ◽

H. Y. Zhou ◽

J. J. Hao ◽

Y. F. Xue ◽

...

Keyword(s):

Plant Protection ◽

Tap Water ◽

Disease Incidence ◽

Blue Pigment ◽

Universal Primers ◽

Infested Soil ◽

Single Spore ◽

Dry Rot ◽

First Report ◽

Daucus Carota L

Carrot (Daucus carota L.) is an economically important vegetable crop in China. In August 2008, a disease was observed on carrot in Inner Mongolia. The symptoms appeared as dry rot lesions on root surface, expressing light brown cankers with defined rounded or irregular shapes (1,3). The average disease incidence was up to 80% in Tuo Ke Tuo County. The disease has been a serious problem in these two counties since then, especially where consecutive carrot cropping was practiced. Carrot roots with typical dry rot symptoms were washed with tap water. Root tissues near the margin of necrotic lesions were excised, surface sterilized with 1% NaOCl for 3 min, and rinsed with sterile distilled water three times. The disinfected tissue was placed on potato dextrose agar (PDA) in a petri dish. Plates were incubated at 25 ± 1°C in the dark for 4 days. Fusarium single spore isolates were obtained from characteristic colonies (1). Three isolates (CF1, CF2, and CF3) were used for further study. The isolates were identified as Fusarium spp. on the basis of microscopic morphology on PDA. CF1 produced pink pigment, abundant falciform macroconidia of 14.7 to 38.2 × 4.5 to 5.7 μm with 2 to 3 septates, and elliptic microconidia of 7.5 to 15.1 × 3.3 to 5.4 μm with none or one septate. CF2 and CF3 produced light blue pigment, abundant falciform macroconidia of 16.4 to 34.4 × 4.0 to 6.1 μm with 2 to 3 septates, and elliptic microconidia of 6.7 to 10.7 × 3.0 to 4.9 μm with none or one septate. They were further identified and confirmed by PCR. The PCR involved amplifying the internal transcribed spacer (ITS) region of ribosomal DNA using genomic DNA as the template with universal primers ITS1 and ITS4 (2). The PCR products were sequenced. BLAST analysis of these sequences against the GenBank database determined the taxonomy of the isolates. The sequence of CF1 was 99% identical to F. oxysporum (Accession No. KC594035); sequences of CF2 and CF3 were 99% identical to F. solani (KC215123). To confirm the pathogenicity of the isolates, mature carrot roots (cv. Hong Ying 2) were inoculated with mycelial plugs (5 mm in diameter) cut from the margin of actively growing colonies on PDA plates. One mycelial plug was placed on each carrot root, with the mycelial side facing the root. PDA plugs were used for controls. Each treatment had five replicates. The inoculated roots were incubated in a humid chamber (90% RH) at 25°C. Four days after incubation, mycelia of the isolates developed and covered most of the surface of carrot roots, and brown rot lesions were observed on all inoculated roots, while the controls remained symptomless. This experiment was repeated. In another trial, carrot seeds (cv. Hong Ying 2) were sown in sterilized soil in pots (30 × 25 cm opening) with 15 seeds per pot. The soil was infested with either CF1, CF2, or CF3 by adding spore suspension to make the final concentration of 1 × 104 CFU/g soil. Plants grown in non-infested soil served as controls. There were three replicates per treatment. All the treated pots were placed in a field. After 13 weeks, the same symptoms of dry rot were observed as previously described. No symptoms were observed on the control plants. The trial was repeated. Symptomatic tissues from the inoculated roots were sampled and the pathogen was re-isolated, and identified using PCR. To our knowledge, this is the first report of F. oxysporum and F. solani causing dry rot of carrot in China. References: (1) H. Abe et al. Annual Report of the Society of Plant Protection of North Japan, 48:106-108, 1997. (2) X. Lu. Plant Dis. 97:991, 2013. (3) A. F. Sherf and A. MacNab. Pages 138-139 in: Vegetable Diseases and Their Control. John Wiley & Sons, Inc., 1986.

Download Full-text

First Report of Sarocladium oryzae Causing Sheath Rot on Rice (Oryza sativa) in Western Australia

Plant Disease ◽

10.1094/pdis-04-12-0415-pdn ◽

2012 ◽

Vol 96 (9) ◽

pp. 1382-1382 ◽

Cited By ~ 5

Author(s):

V. Lanoiselet ◽

M. P. You ◽

Y. P. Li ◽

C. P. Wang ◽

R. G. Shivas ◽

...

Keyword(s):

Oryza Sativa ◽

Western Australia ◽

Oryza Sativa L ◽

Culture Collection ◽

Universal Primers ◽

Rrna Gene ◽

Sequence Information ◽

Post Inoculation ◽

First Report ◽

Sheath Rot

Rice (Oryza sativa L.) has been grown in the Ord River Irrigation Area (ORIA) in northern Western Australia since 1960. In 2011, a sheath rot of rice was observed in the ORIA. Symptoms were variable, appearing as either (i) oblong pale to dark brown lesions up to 3 cm length, (ii) lesions with pale grey/brown centers and with dark brown margins, or (iii) diffuse dark or reddish brown streaks along the sheath. Lesions enlarged and coalesced, often covering the majority of the leaf sheath, disrupting panicle emergence. Isolations from small pieces of infested tissues from plants showing sheath rot symptoms were made onto water agar, subcultured onto potato dextrose agar, cultures maintained at 20°C, and a representative culture lodged both in the Western Australian Culture Collection maintained at the Department of Agriculture and Food Western Australia (as WAC 13481) and in the culture collection located at the DAFF Plant Pathology Herbarium (as BRIP 54763). Amplification of the internal transcribed spacer (ITS)1 and (ITS)2 regions flanking the 5.8S rRNA gene were carried out with universal primers ITS1 and ITS4 according to the published protocol (4). The DNA PCR products from a single isolate were sequenced and BLAST analyses used to compare sequences with those in GenBank. The sequence had 99% nucleotide identity with the corresponding sequence in GenBank for Sarocladium oryzae (Sawada) W. Gams & D. Hawksworth. Isolates showed morphological (e.g., conidiophore and conidia characteristics) (2) and molecular (1) similarities with S. oryzae as described in other reports. The relevant sequence information for a representative isolate was lodged in GenBank (GenBank Accession No. JQ965668). Spores of S. oryzae were produced on rice agar under “black light” at 22°C to induce sporulation over 4 weeks. Under conditions of 30/28°C (day/night), 14/12 h (light/dark), rice cv. Quest, grown for 11 weeks until plants reached the tillering stage, was inoculated by spraying a suspension 5 × 107 spores/ml of the same single isolate onto foliage until runoff occurred. Inoculated plants were placed under a dark plastic cover for 72 h to maximize humidity levels around leaves and subsequently maintained under >90% relative humidity conditions. Symptoms of sheath rot as described in (i) and (ii) above appeared by 14 days after inoculation, with lesions up to 23 cm long by 15 days post-inoculation. Severe disease prevented young panicles from emerging. Infection studies were successfully repeated and S. oryzae was reisolated from leaf lesions 1 week after lesion appearance. No disease was observed on water-inoculated control rice plants. There have been records of S. oryzae on rice in New South Wales in the early 1980s (3) and in 2006 to 2007 (Australian Plant Pest Database), but to our knowledge, this is the first report of this pathogen in Western Australia. References: (1) N. Ayyadurai et al. Cur. Microbiol. Mycologia 50:319, 2005. (2) B. L. K. Brady. No. 673 in: IMI Descriptions of Fungi and Bacteria, 1980. (3) D. Phillips et al. FAO Plant Prot. Bull. 40:4, 1992. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

Download Full-text

Potential impacts of poison baiting for introduced house mice on native animals on islands in Jurien Bay, Western Australia

Wildlife Research ◽

10.1071/wr15126 ◽

2016 ◽

Vol 43 (1) ◽

pp. 61 ◽

Cited By ~ 1

Author(s):

Clifford Bennison ◽

J. Anthony Friend ◽

Timothy Button ◽

Harriet Mills ◽

Cathy Lambert ◽

...

Keyword(s):

Western Australia ◽

Rhodamine B ◽

Native Species ◽

House Mice ◽

Mus Domesticus ◽

Target Species ◽

Island Populations ◽

Delivery Technique ◽

Poison Baiting ◽

Competition For Resources

Context House mice (Mus domesticus) are present on Boullanger and Whitlock islands, Western Australia, and could potentially threaten populations of the dibbler (Parantechinus apicalis) and grey-bellied dunnart (Sminthopsis griseoventer) through competition for resources. A workshop in 2007 recommended a study to assess the feasibility of eradicating house mice from the islands by using poison baits and of the risk posed to non-target native species. Aim We aimed to assess the risk to non-target native species if poison baiting was used to eradicate house mice on Boullanger and Whitlock islands. Methods Non-toxic baits containing the bait marker rhodamine B were distributed on Boullanger Island and on the mouse free Escape Island to determine the potential for primary poisoning. Acceptance of baits by mammals was measured through sampling and analysis of whiskers, and by reptiles through observations of dye in faeces. To determine the potential for secondary exposure to poison, the response of dibblers to mouse carcasses was observed using motion-activated cameras. Bait acceptance was compared using two methods of delivery, namely, scattering in the open and delivery in polyvinyl chloride (PVC) tubes. A cafeteria experiment of bait consumption by dibblers was also undertaken using captive animals held at the Perth Zoo. Ten dibblers were offered non-toxic baits containing rhodamine B in addition to their normal meals; consumption of bait and the presence of dye in whiskers were measured. Key results Bait acceptance on the islands was high for house mice (92% of individuals) and dibblers (48%) and it was independent of bait-delivery technique. There was no evidence of bait acceptance by grey-bellied dunnarts. Dibblers may consume mice carcasses if available; however, no direct consumption of mice carcasses was observed with movement sensor cameras but one dibbler was observed removing a mouse carcass and taking it away. During the cafeteria experiment, 9 of 10 captive dibblers consumed baits. Conclusions This investigation demonstrated that dibblers consume baits readily and island populations would experience high mortality if exposed to poison baits. Poison baiting could effectively eradicate mice from Boullanger and Whitlock islands but not without mortality for dibblers. Implications Toxic baits could be used to eradicate mice from Boullanger and Whitlock islands, provided that non-target species such as dibblers were temporarily removed from the islands before the application of baits.

Download Full-text

The Emergence of Suburban Terracing on Coastal Dunes: Case Studies along the Perth Northern Corridor, Western Australia, 1930–2010

Journal of Urban Design ◽

10.1080/13574809.2014.943704 ◽

2014 ◽

Vol 19 (5) ◽

pp. 593-621 ◽

Cited By ~ 2

Author(s):

Karl Kullmann

Keyword(s):

Case Studies ◽

Western Australia ◽

Coastal Dunes

Download Full-text

First Report of Leaf Blight of Japanese Yew Caused by Pestalotiopsis microspora in Korea

Plant Disease ◽

10.1094/pdis-08-13-0821-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 691-691 ◽

Cited By ~ 2

Author(s):

Y. H. Jeon ◽

W. Cheon

Keyword(s):

Dna Sequences ◽

Apical Cell ◽

Morphological Characteristics ◽

Leaf Blight ◽

Economic Damage ◽

Leaf Margin ◽

Conidial Suspension ◽

First Report ◽

Pestalotiopsis Microspora ◽

Large Trees

Worldwide, Japanese yew (Taxus cuspidata Sieb. & Zucc.) is a popular garden tree, with large trees also being used for timber. In July 2012, leaf blight was observed on 10% of Japanese yew seedling leaves planted in a 500-m2 field in Andong, Gyeongsangbuk-do Province, South Korea. Typical symptoms included small, brown lesions that were first visible on the leaf margin, which enlarged and coalesced into the leaf becoming brown and blighted. To isolate potential pathogens from infected leaves, small sections of leaf tissue (5 to 10 mm2) were excised from lesion margins. Eight fungi were isolated from eight symptomatic trees, respectively. These fungi were hyphal tipped twice and transferred to potato dextrose agar (PDA) plates for incubation at 25°C. After 7 days, the fungi produced circular mats of white aerial mycelia. After 12 days, black acervuli containing slimy spore masses formed over the mycelial mats. Two representative isolates were further characterized. Their conidia were straight or slightly curved, fusiform to clavate, five-celled with constrictions at the septa, and 17.4 to 28.5 × 5.8 to 7.1 μm. Two to four 19.8- to 30.7-μm-long hyaline filamentous appendages (mostly three appendages) were attached to each apical cell, whereas one 3.7- to 7.1-μm-long hyaline appendage was attached to each basal cell, matching the description for Pestalotiopsis microspora (2). The pathogenicity of the two isolates was tested using 2-year-old plants (T. cuspidata var. nana Rehder; three plants per isolate) in 30-cm-diameter pots filled with soil under greenhouse conditions. The plants were inoculated by spraying the leaves with an atomizer with a conidial suspension (105 conidia/ml; ~50 ml on each plant) cultured for 10 days on PDA. As a control, three plants were inoculated with sterilized water. The plants were covered with plastic bags for 72 h to maintain high relative humidity (24 to 28°C). At 20 days after inoculation, small dark lesions enlarged into brown blight similar to that observed on naturally infected leaves. P. microspora was isolated from all inoculated plants, but not the controls. The fungus was confirmed by molecular analysis of the 5.8S subunit and flanking internal transcribed spaces (ITS1 and ITS2) of rDNA amplified from DNA extracted from single-spore cultures, and amplified with the ITS1/ITS4 primers and sequenced as previously described (4). Sequences were compared with other DNA sequences in GenBank using a BLASTN search. The P. microspora isolates were 99% homologous to other P. microspora (DQ456865, EU279435, FJ459951, and FJ459950). The morphological characteristics, pathogenicity, and molecular data assimilated in this study corresponded with the fungus P. microspora (2). This fungus has been previously reported as the causal agent of scab disease of Psidium guajava in Hawaii, the decline of Torreya taxifolia in Florida, and the leaf blight of Reineckea carnea in China (1,3). Therefore, this study presents the first report of P. microspora as a pathogen on T. cuspidata in Korea. The degree of pathogenicity of P. microspora to the Korean garden evergreen T. cuspidata requires quantification to determine its potential economic damage and to establish effective management practices. References: (1) D. F. Farr and A. Y. Rossman, Fungal Databases, Syst. Mycol. Microbiol. Lab. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ (2) L. M. Keith et al. Plant Dis. 90:16, 2006. (3) S. S. N. Maharachchikumbura. Fungal Diversity 50:167, 2011. (4) T. J. White et al. PCR Protocols. Academic Press, San Diego, CA, 1990.

Download Full-text

First Report of Root-Knot Nematode Meloidogyne enterolobii on Sweet Potato in China

Plant Disease ◽

10.1094/pdis-09-13-0953-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 702-702 ◽

Cited By ~ 1

Author(s):

B. Gao ◽

R. Y. Wang ◽

S. L. Chen ◽

X. H. Li ◽

J. Ma

Keyword(s):

Sweet Potato ◽

Dna Sequences ◽

Molecular Characteristics ◽

28S Rrna ◽

Storage Roots ◽

Specific Primers ◽

First Report ◽

Meloidogyne Enterolobii ◽

Meloidogyne Spp ◽

Meloidogyne Sp

Sweet potato (Ipomoea batatas Lam.) is the fifth largest staple crop after rice, wheat, maize, and soybean in China. Sweet potato tubers were received from Zhanjiang, Guangdong Province, China, in June 2013 for research purposes. Upon inspection, the storage roots showed typical symptoms of being infected by root-knot nematodes, Meloidogyne spp.; the incidence of infection was 95%. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 32 females on average (n = 20). The perineal patterns of most female specimens (n = 10) were oval shaped, with moderately high to high dorsal arch and mostly lacking obvious lateral lines. The second-stage juvenile had large and triangular lateral lips and broad, bluntly rounded tail tip. These morphological characteristics are similar to those reported in the original description of Meloidogyne enterolobii Yang & Eisenback (2). The 28S rRNA D2D3 expansion domain was amplified with primers MF/MR (GGGGATGTTTGAGGCAGATTTG/AACCGCTTCGGACTTCCACCAG) (1). The sequence obtained for this population (n = 5) of Meloidogyne sp. (GenBank Accession No. KF646797) was 100% identical to the sequence of M. enterolobii (JN005864). For further confirmation, M. incognita specific primers Mi-F/Mi-R (GTGAGGATTCAGCTCCCCAG/ACGAGGAACA TACTTCTCCGTCC), M. javanica specific primers Fjav/Rjav (GGTGCGCGATTGAACTGAGC/CAGGCCCTTCAGTGGAACTATAC), and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the respective DNA sequences (1). The electrophoresis results showed a bright band (~200 bp) only in the lane with the M. enterolobii specific primers. Therefore, this population of Meloidogyne sp. on sweet potato was identified as M. enterolobii based on its morphological and molecular characteristics. M. enterolobii has been reported to infect more than 20 plant species from six plant families: Fabaceae, Cucurbitaceae, Solanaceae, Myrtaceae, Annonaceae, and Marantaceae (1). To our knowledge, this is the first report of M. enterolobii on a member of the Convolvulaceae in China. Refrences: (1) M. X. Hu et al. Phytopathol. 101:1270, 2011. (2) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Download Full-text

First Report of a Group 16SrII Phytoplasma Infecting Chickpea in Oman

Plant Disease ◽

10.1094/pd-90-0973c ◽

2006 ◽

Vol 90 (7) ◽

pp. 973-973 ◽

Cited By ~ 8

Author(s):

N. A. Al-Saady ◽

A. M. Al-Subhi ◽

A. Al-Nabhani ◽

A. J. Khan

Keyword(s):

Nested Pcr ◽

Animal Feed ◽

Restriction Enzymes ◽

Universal Primers ◽

Polymorphism Analysis ◽

Disease Symptoms ◽

First Report ◽

Pcr Products ◽

Polymerase Chain ◽

Group 2

Chickpea (Cicer arietinum), locally known as “Dungo”, is grown for legume and animal feed mainly in the interior region of Oman. During February 2006, survey samples of chickpea leaves from plants showing yellows disease symptoms that included phyllody and little leaf were collected from the Nizwa Region (175 km south of Muscat). Total nucleic acid was extracted from asymptomatic and symptomatic chickpea leaves using a cetyltrimethylammoniumbromide method with modifications (3). All leaf samples from eight symptomatic plants consistently tested positive using a polymerase chain reaction assay (PCR) with phytoplasma universal primers (P1/P7) that amplify a 1.8-kb phytoplasma rDNA product and followed by nested PCR with R16F2n/R16R2 primers yielding a product of 1.2 kb (2). No PCR products were evident when DNA extracted from healthy plants was used as template. Restriction fragment length polymorphism analysis of nested PCR products by separate digestion with Tru9I, HaeIII, HpaII, AluI, TaqI, HhaI, and RsaI restriction enzymes revealed that a phytoplasma belonging to group 16SrII peanut witches'-broom group (2) was associated with chickpea phyllody and little leaf disease in Oman. Restriction profiles of chickpea phytoplasma were identical with those of alfalfa witches'-broom phytoplasma, a known subgroup 16SrII-B strain (3). To our knowledge, this is the first report of phytoplasma infecting chickpea crops in Oman. References: (1) A. J. Khan et al. Phytopathology, 92:1038, 2002. (2). I.-M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998 (3) M. A. Saghai-Maroof et al. Proc. Natl. Acad. Sci. USA. 81:8014, 1984.

Download Full-text

First Report of Stem and Foliage Blight of Chrysanthemum Caused by Phytophthora drechsleri in the United States

Plant Disease ◽

10.1094/pdis-03-21-0631-pdn ◽

2021 ◽

Author(s):

Charles Krasnow ◽

Nancy Rechcigl ◽

Jennifer Olson ◽

Linus Schmitz ◽

Steven N. Jeffers

Keyword(s):

United States ◽

South Carolina ◽

Sequence Similarity ◽

Morphological Characteristics ◽

The United States ◽

Universal Primers ◽

Broad Host Range ◽

Pathogenicity Test ◽

First Report ◽

Foliage Blight

Chrysanthemum (Chrysanthemum × morifolium) plants exhibiting stem and foliage blight were observed in a commercial nursery in eastern Oklahoma in June 2019. Disease symptoms were observed on ~10% of plants during a period of frequent rain and high temperatures (26-36°C). Dark brown lesions girdled the stems of symptomatic plants and leaves were wilted and necrotic. The crown and roots were asymptomatic and not discolored. A species of Phytophthora was consistently isolated from the stems of diseased plants on selective V8 agar (Lamour and Hausbeck 2000). The Phytophthora sp. produced ellipsoid to obpyriform sporangia that were non-papillate and persistent on V8 agar plugs submerged in distilled water for 8 h. Sporangia formed on long sporangiophores and measured 50.5 (45-60) × 29.8 (25-35) µm. Oospores and chlamydospores were not formed by individual isolates. Mycelium growth was present at 35°C. Isolates were tentatively identified as P. drechsleri using morphological characteristics and growth at 35°C (Erwin and Ribeiro 1996). DNA was extracted from mycelium of four isolates, and the internal transcribed spacer (ITS) region was amplified using universal primers ITS 4 and ITS 6. The PCR product was sequenced and a BLASTn search showed 100% sequence similarity to P. drechsleri (GenBank Accession Nos. KJ755118 and GU111625), a common species of Phytophthora that has been observed on ornamental and vegetable crops in the U.S. (Erwin and Ribeiro 1996). The gene sequences for each isolate were deposited in GenBank (accession Nos. MW315961, MW315962, MW315963, and MW315964). These four isolates were paired with known A1 and A2 isolates on super clarified V8 agar (Jeffers 2015), and all four were mating type A1. They also were sensitive to the fungicide mefenoxam at 100 ppm (Olson et al. 2013). To confirm pathogenicity, 4-week-old ‘Brandi Burgundy’ chrysanthemum plants were grown in 10-cm pots containing a peat potting medium. Plants (n = 7) were atomized with 1 ml of zoospore suspension containing 5 × 103 zoospores of each isolate. Control plants received sterile water. Plants were maintained at 100% RH for 24 h and then placed in a protected shade-structure where temperatures ranged from 19-32°C. All plants displayed symptoms of stem and foliage blight in 2-3 days. Symptoms that developed on infected plants were similar to those observed in the nursery. Several inoculated plants died, but stem blight, dieback, and foliar wilt were primarily observed. Disease severity averaged 50-60% on inoculated plants 15 days after inoculation. Control plants did not develop symptoms. The pathogen was consistently isolated from stems of symptomatic plants and verified as P. drechsleri based on morphology. The pathogenicity test was repeated with similar results. P. drechsleri has a broad host range (Erwin and Ribeiro 1996; Farr et al. 2021), including green beans (Phaseolus vulgaris), which are susceptible to seedling blight and pod rot in eastern Oklahoma. Previously, P. drechsleri has been reported on chrysanthemums in Argentina (Frezzi 1950), Pennsylvania (Molnar et al. 2020), and South Carolina (Camacho 2009). Chrysanthemums are widely grown in nurseries in the Midwest and other regions of the USA for local and national markets. This is the first report of P. drechsleri causing stem and foliage blight on chrysanthemum species in the United States. Identifying sources of primary inoculum may be necessary to limit economic loss from P. drechsleri.

Download Full-text