scholarly journals Next-Generation Sequencing-Based Detection of Common Bean Viruses in Wild Plants from Tanzania and Their Mechanical Transmission to Common Bean Plants

Plant Disease ◽  
2021 ◽  
Author(s):  
Beatrice Mwaipopo ◽  
Minna-Liisa Rajamäki ◽  
Neema Ngowi ◽  
Susan N’chimbi Msolla ◽  
P Njau ◽  
...  
Keyword(s):  
Next Generation Sequencing ◽  
Common Bean ◽  
Mosaic Virus ◽  
Viral Disease ◽  
Wild Plants ◽  
Next Generation ◽  
Rt Pcr ◽  
Bean Plants ◽  
Generation Sequencing ◽  
Common Bean Plants

Viral diseases are a major threat for common bean production. In recent surveys, >15 different viruses belonging to 11 genera were shown to infect common bean (Phaseolus vulgaris L.) in Tanzania. Management of viruses requires an understanding of how they survive from one season to the next. In this study, we explored the possibility that alternative host plants have a central role in the survival of common bean viruses. We used next-generation sequencing (NGS) techniques to sequence virus-derived small interfering RNAs, together with conventional reverse transcription-polymerase chain reaction (RT-PCR) to detect viruses in wild plants. Leaf samples for RNA extraction and NGS were collected from 1,430 wild plants around and within common bean fields in four agricultural zones in Tanzania. At least partial genome sequences of viruses potentially belonging to 25 genera were detected. The greatest virus diversity was detected in the eastern and northern zones, whereas wild plants in the Lake zone and especially in the southern highlands zone showed only a few viruses. RT-PCR analysis of all the collected plant samples confirmed the presence of yam bean mosaic virus and peanut mottle virus in wild legume plants. Of all viruses detected, only two viruses, cucumber mosaic virus and a novel bromovirus related to cowpea chlorotic mottle virus and brome mosaic virus, were mechanically transmitted from wild plants to common bean plants. The data generated in this study are crucial for development of viral disease management strategies and predicting crop viral disease outbreaks in different agricultural regions in Tanzania and beyond.

scholarly journals Next-generation sequencing and RT-PCR to identify a 32-day SARS-CoV-2 carrier

2021 ◽  
Vol 0 (0) ◽  
Author(s):  
Lingjie Song ◽  
Guibao Xiao ◽  
Ruixiang Tang ◽  
Xianqin Zhang ◽  
Zhan Gao ◽  
...  
Keyword(s):  
Next Generation Sequencing ◽  
Next Generation ◽  
Rt Pcr ◽  
Generation Sequencing

scholarly journals First Report of Tobacco ringspot virus Infecting Kudzu (Pueraria montana) in Louisiana

Plant Disease ◽  
2013 ◽  
Vol 97 (4) ◽  
pp. 561-561 ◽  
Author(s):  
S. Khankhum ◽  
P. Bollich ◽  
R. A. Valverde
Keyword(s):  
Common Bean ◽  
Mosaic Virus ◽  
Seed Quality ◽  
Soybean Mosaic Virus ◽  
Ringspot Virus ◽  
Wild Plants ◽  
Rt Pcr ◽  
Sequence Comparisons ◽  
First Report ◽  
Tobacco Ringspot Virus

Kudzu is an introduced legume commonly found growing as a perennial throughout the southeastern United States. This fast-growing vine was originally planted as an ornamental for forage and to prevent erosion (2), but is now considered an invasive species. During April 2011, a kudzu plant growing near a soybean field in Amite (Tangipahoa Parish, southeastern LA) was observed with foliar ringspot and mottle symptoms. Leaf samples were collected, and sap extracts (diluted 1:5 w/v in 0.02 M phosphate buffer pH 7.2) were mechanically inoculated onto carborundum-dusted leaves of at least five plants of the following species: kudzu, common bean (Phaseolus vulgaris) cv. Black Turtle Soup, globe amaranth (Gomphrena globosa), Nicotiana benthamiana, and soybean (Glycine max) cv. Asgrow AG 4801. Two plants of each species were also mock-inoculated. Eight to fourteen days after inoculation, all virus-inoculated plants showed virus symptoms that included foliar ringspots, mosaic, and mottle. Common bean and soybean also displayed necroses and were stunted. ELISA using antisera for Bean pod mottle virus, Cucumber mosaic virus, Soybean mosaic virus, and Tobacco ringspot virus (TRSV) (Agdia Inc., Elkhart, IN) were performed on field-collected kudzu and all inoculated plants species. ELISA tests resulted positive for TRSV but were negative for the other three viruses. All virus-inoculated plant species tested positive by ELISA. To confirm that TRSV was present in the samples, total RNA was extracted from infected and healthy plants and used in RT-PCR tests. The set of primers TRS-F (5′TATCCCTATGTGCTTGAGAG3′) and TRS-R (5′CATAGACCACCAGAGTCACA3′), which amplifies a 766-bp fragment of the RdRp of TRSV, were used (3). Expected amplicons were obtained with all of the TRSV-infected plants and were cloned and sequenced. Sequence analysis confirmed that TRSV was present in kudzu. Nucleotide sequence comparisons using BLAST resulted in a 95% similarity with the bud blight strain of TRSV which infects soybeans (GenBank Accession No. U50869) (1). TRSV has been reported to infect many wild plants and crops, including soybean. In soybean, this virus can reduce yield and seed quality (4). During summer 2012, three additional kudzu plants located near soybean fields showing ringspot symptoms were also found in Morehouse, Saint Landry, and West Feliciana Parishes. These three parishes correspond to the north, central, and southeast regions, respectively. These plants also tested positive for TRSV by ELISA and RT-PCR. The results of this investigation documents that TRSV was found naturally infecting kudzu near soybean fields in different geographical locations within Louisiana. Furthermore, a TRSV strain closely related to the bud blight strain that infects soybean was identified in one location (Amite). This finding is significant because infected kudzu potentially could serve as the source of TRSV for soybean and other economically important crops. To the best of our knowledge, this is the first report of TRSV infecting kudzu. References: (1) G. L. Hartman et al. 1999. Compendium of Soybean Diseases. American Phytopathological Society, St. Paul, MN. (2) J. H. Miller and B. Edwards. S. J. Appl. Forestry 7:165, 1983. (3) S. Sabanadzovic et al. Plant Dis. 94:126, 2010. (4) P. A. Zalloua et al. Virology 219:1, 1996.

Next generation sequencing reveals past and current widespread occurrence of maize yellow mosaic virus in South Africa

2020 ◽  
Vol 158 (1) ◽  
pp. 237-249
Author(s):  
Tanya Welgemoed ◽  
Rian Pierneef ◽  
David A. Read ◽  
Susanna E. Schulze ◽  
Gerhard Pietersen ◽  
...  
Keyword(s):  
South Africa ◽  
Next Generation Sequencing ◽  
Mosaic Virus ◽  
Yellow Mosaic Virus ◽  
Next Generation ◽  
Widespread Occurrence ◽  
Generation Sequencing

scholarly journals SARS-CoV-2 as a Trigger in the Development of Tourette’s-Like Symptoms: A Case Report

2021 ◽  
Author(s):  
Sabine Hazan ◽  
Sheldon Jordan
Keyword(s):  
Case Report ◽  
Next Generation Sequencing ◽  
Gut Microbiota ◽  
Dramatic Improvement ◽  
Next Generation ◽  
Rt Pcr ◽  
Gastrointestinal Microbiota ◽  
Next Generation Sequencing Ngs ◽  
The Impact ◽  
Generation Sequencing

Abstract Background: Reports have been surfacing surrounding CNS-associated symptoms in individuals affected by coronavirus disease 19 (COVID-19). Tourette syndrome is a neuropsychiatric disorder with usual onset in childhood. Gut microbiota can affect central physiology and function via the microbiota-gut-brain axis. The authors of this case report describe Tourette’s-like symptoms in a patient resulting from severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection disrupting gut microbiota. Case Presentation: This case involves a 16-year-old female that developed acute onset Tourette’s-like symptoms along with neuropsychiatric symptoms after exposure to and infection from SARS-CoV-2. The patient had negative nasopharyngeal (NP) real-time reverse transcription-PCR (RT-PCR) tests for SARS-CoV-2 on five occasions from August of 2020 through June of 2021. The patient’s symptoms continued to worsen over the next six months until next-generation sequencing (NGS) revealed SARS-CoV-2 in her stool. Her treatment was adjusted as NGS revealed SARS-CoV-2 in her stool. Repair of the gastrointestinal microbiota, treatment with nutraceutical and pharmaceutical agents, as well as alterations in her surroundings resulted in dramatic improvement in the microbiome and a significant reduction of symptoms.Discussion: The use of (RT-PCR) testing to determine the presence or absence of SARS-CoV-2 may be inadequate and inaccurate for individuals that have been exposed to the virus. In addition, the impact of SARS-CoV-2 infection of the GI tract may cause significant havoc in the gut microbiota. Additional testing, eradication of infectious agents, as well as restoration of the gut microbiome are needed to effectively manage and treat this condition. The patient’s symptoms worsened over the next six months until next-generation sequencing (NGS) revealed SARS-CoV-2 in her stool and her treatment was adjusted. Treatment with nutraceuticals and alterations in her surroundings was followed by a more normal microbiome and a dramatic reduction in symptoms.

scholarly journals Next-Generation Sequencing Combined With Conventional Sanger Sequencing Reveals High Molecular Diversity in Actinidia Virus 1 Populations From Kiwifruit Grown in China

2020 ◽  
Vol 11 ◽  
Author(s):  
Shaohua Wen ◽  
Guoping Wang ◽  
Zuokun Yang ◽  
Yanxiang Wang ◽  
Min Rao ◽  
...  
Keyword(s):  
Next Generation Sequencing ◽  
Sanger Sequencing ◽  
Molecular Diversity ◽  
Genome Structure ◽  
Viral Disease ◽  
Open Reading Frames ◽  
Next Generation ◽  
Next Generation Sequencing Ngs ◽  
First Time ◽  
Generation Sequencing

Kiwifruit (Actinidia spp.) is native to China. Viral disease–like symptoms are common on kiwifruit plants. In this study, six libraries prepared from total RNA of leaf samples from 69 kiwifruit plants were subjected to next-generation sequencing (NGS). Actinidia virus 1 (AcV-1), a tentative species in the family Closteroviridae, was discovered in the six libraries. Two full-length and two near-full genome sequences of AcV-1 variants were determined by Sanger sequencing. The genome structure of these Chinese AcV-1 variants was identical to that of isolate K75 and consisted of 12 open reading frames (ORFs). Analyses of these sequences together with the NGS-derived contig sequences revealed high molecular diversity in AcV-1 populations, with the highest sequence variation occurring at ORF1a, ORF2, and ORF3, and the available variants clustered into three phylogenetic clades. For the first time, our study revealed different domain compositions in the viral ORF1a and molecular recombination events among AcV-1 variants. Specific reverse transcriptase–polymerase chain reaction assays disclosed the presence of AcV-1 in plants of four kiwifruit species and unknown Actinidia spp. in seven provinces and one city.

scholarly journals Evolutionary study of maize dwarf mosaic virus using nearly complete genome sequences acquired by next-generation sequencing

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Dulanjani Wijayasekara ◽  
Akhtar Ali
Keyword(s):  
Next Generation Sequencing ◽  
Mosaic Virus ◽  
Complete Genome ◽  
Evolutionary Relationship ◽  
Fixation Index ◽  
Maize Dwarf Mosaic Virus ◽  
Next Generation ◽  
Genome Sequences ◽  
The Usa ◽  
Generation Sequencing

AbstractNext-generation sequencing is a robust approach to sequence plant virus genomes in a very short amount of time compared to traditional sequencing methods. Maize dwarf mosaic virus (MDMV) is one of the most important plant viruses worldwide and a significant threat to maize production. In this study, we sequenced 19 MDMV isolates (10 from Johnsongrass and 9 from maize) collected in Oklahoma and Missouri during 2017–2019 using Illumina sequencing and determined the genetic diversity. Sequence reads were assembled and 19 nearly complete genome sequences of MDMV isolates were obtained. Phylogenetic analysis based on complete genomes nucleotide and amino acid sequences revealed two main clusters and a close evolutionary relationship among 19 MDMV isolates. Statistical analysis of individual genes for site-specific selection revealed that all genes are under negative selection. The fixation index (FST) analysis of the MDMV isolates revealed no gene flow between the two main phylogenetic clusters, which emphasizes the divergence of MDMV isolates from the USA. Among the USA MDMV isolates, the mean genetic distance (d) and nucleotide diversity ((π) were highest in the P1 gene coding region. This is the first detailed study on the evolutionary relationship of MDMV isolates based on the nearly complete genome analysis from maize and Johnsongrass.

scholarly journals Highly sensitive and full-genome interrogation of SARS-CoV-2 using multiplexed PCR enrichment followed by next-generation sequencing

2020 ◽  
Author(s):  
Chenyu Li ◽  
David N. Debruyne ◽  
Julia Spencer ◽  
Vidushi Kapoor ◽  
Lily Y. Liu ◽  
...  
Keyword(s):  
Next Generation Sequencing ◽  
Multiplex Pcr ◽  
High Sensitivity ◽  
Detection Methods ◽  
Next Generation ◽  
Rt Pcr ◽  
Copy Numbers ◽  
Virus Rna ◽  
Highly Sensitive ◽  
Generation Sequencing

AbstractMany detection methods have been used or reported for the diagnosis and/or surveillance of COVID-19. Among them, reverse transcription polymerase chain reaction (RT-PCR) is the most commonly used because of its high sensitivity, typically claiming detection of about 5 copies of viruses. However, it has been reported that only 47-59% of the positive cases were identified by some RT-PCR methods, probably due to low viral load, timing of sampling, degradation of virus RNA in the sampling process, or possible mutations spanning the primer binding sites. Therefore, alternative and highly sensitive methods are imperative. With the goal of improving sensitivity and accommodating various application settings, we developed a multiplex-PCR-based method comprised of 343 pairs of specific primers, and demonstrated its efficiency to detect SARS-CoV-2 at low copy numbers. The assay produced clean characteristic target peaks of defined sizes, which allowed for direct identification of positives by electrophoresis. We further amplified the entire SARS-CoV-2 genome from 8 to half a million viral copies purified from 13 COVID-19 positive specimens, and detected mutations through next generation sequencing. Finally, we developed a multiplex-PCR-based metagenomic method in parallel, that required modest sequencing depth for uncovering SARS-CoV-2 mutational diversity and potentially novel or emerging isolates.

scholarly journals Chronic SARS-CoV-2 infection and viral evolution in a hypogammaglobulinaemic individual.

2021 ◽  
Author(s):  
Maia Kavanagh Williamson ◽  
Fergus Hamilton ◽  
Stephanie Hutchings ◽  
Hannah M Pymont ◽  
Mark Hackett ◽  
...  
Keyword(s):  
Next Generation Sequencing ◽  
Amino Acid ◽  
Selective Pressure ◽  
Viral Evolution ◽  
Viral Escape ◽  
Spike Protein ◽  
Next Generation ◽  
Rt Pcr ◽  
The Face ◽  
Generation Sequencing

There is widespread interest in the capacity for SARS-CoV-2 evolution in the face of selective pressures from host immunity, either naturally acquired post-exposure or from vaccine acquired immunity. Allied to this is the potential for long perm persistent infections within immune compromised individuals to allow a broader range of viral evolution in the face of sub-optimal immune driven selective pressure. Here we report on an immunocompromised individual who is hypogammaglobulinaemic and was persistently infected with SARS-CoV-2 for over 290 days, the longest persistent infection recorded in the literature to date. During this time, nine samples of viral nucleic acid were obtained and analysed by next-generation sequencing. Initially only a single mutation (L179I) was detected in the spike protein relative to the prototypic SARS-CoV-2 Wuhan-Hu-1 isolate, with no further changes identified at day 58. However, by day 155 the spike protein had acquired a further four amino acid changes, namely S255F, S477N, H655Y and D1620A and a two amino acid deletion (ΔH69/ΔV70). Infectious virus was cultured from a nasopharyngeal sample taken on day 155 and next-generation sequencing confirmed that the mutations in the virus mirrored those identified by sequencing of the corresponding swab sample. The isolated virus was susceptible to remdesivir in vitro, however a 17-day course of remdesivir started on day 213 had no effect on the viral RT-PCR cycle threshold (Ct) value. On day 265 the patient was treated with the combination of casirivimab and imdevimab. The patient experienced progressive resolution of all symptoms over the next 8 weeks and by day 311 the virus was no longer detectable by RT-PCR. The ΔH69/ΔV70 deletion in the N-terminus of the spike protein which arose in our patient is also present in the B.1.1.7 variant of concern and has been associated with viral escape mutagenesis after treatment of another immunocompromised patient with convalescent plasma. Our data confirms the significance of this deletion in immunocompromised patients but illustrates it can arise independently of passive antibody transfer, suggesting the deletion may be an enabling mutation that compensates for distant changes in the spike protein that arise under selective pressure.

scholarly journals Validation of Saliva and Self-Administered Nasal Swabs for COVID-19 Testing

2020 ◽  
Author(s):  
Alvin Kuo Jing Teo ◽  
Yukti Choudhury ◽  
Iain Beehuat Tan ◽  
Chae Yin Cher ◽  
Shi Hao Chew ◽  
...  
Keyword(s):  
Next Generation Sequencing ◽  
Migrant Workers ◽  
Phylogenetic Analyses ◽  
Kappa Statistic ◽  
Sample Type ◽  
Next Generation ◽  
Rt Pcr ◽  
Male Adult ◽  
Public Health Decision ◽  
Generation Sequencing

Background Active cases of COVID-19 has primarily been diagnosed via RT-PCR of nasopharyngeal (NP) swabs. Saliva and self-administered nasal (SN) swabs can be collected safely without trained staff. We aimed to test the sensitivity of naso-oropharyngeal saliva and SN swabs compared to NP swabs in a large cohort of migrant workers in Singapore. Methods We recruited 200 male adult subjects: 45 with acute respiratory infection, 104 asymptomatic close contacts, and 51 confirmed COVID-19 cases. Each subject underwent NP swab, SN swab and saliva collection for RT-PCR testing at 1 to 3 timepoints. We additionally used a direct-from-sample amplicon-based next-generation sequencing (NGS) workflow to establish phylogeny. Results Of 200 subjects, 91 and 46 completed second and third rounds of testing, respectively. Of 337 sets of tests, there were 150 (44.5%) positive NP swabs, 127 (37.7%) positive SN swabs, and 209 (62.0%) positive saliva. Test concordance between different sample sites was good, with a kappa statistic of 0.616 for NP and SN swabs, and 0.537 for NP and saliva. In confirmed symptomatic COVID-19 subjects, the likelihood of a positive test from any sample fell beyond 14 days of symptom onset. NGS was conducted on 18 SN and saliva samples, with phylogenetic analyses demonstrating lineages for all samples tested were Clade O (GISAID nomenclature) and lineage B.6 (PANGOLIN nomenclature). Conclusion This study supports saliva as a sensitive and less intrusive sample for COVID-19 diagnosis and further delineates the role of oropharyngeal secretions in increasing the sensitivity of testing. However, SN swabs were inferior as an alternate sample type. Our study also provides evidence that a straightforward next-generation sequencing workflow can provide direct-from-sample phylogenetic analysis for public health decision-making.

Sign in / Sign up

Export Citation Format

Share Document