scholarly journals First report of Apple rubodvirus 2 infecting pear (Pyrus communis) in South Africa

Plant Disease ◽  
2021 ◽  
Author(s):  
Kayleigh Bougard ◽  
Hans Jacob Maree ◽  
Gerhard Pietersen ◽  
Julia Christine Meitz-Hopkins ◽  
Rachelle Bester
Keyword(s):  
South Africa ◽  
De Novo ◽  
Rna Extraction ◽  
Pyrus Communis ◽  
Cold Sensitivity ◽  
Total Rna ◽  
First Report ◽  
Sequencing Library ◽  
Blastn Analysis ◽  
Tree Branch

Apple rubbery wood virus 2 (ARWV-2; Rott et al., 2018) belong to the species Apple rubodvirus 2, a member of the genus Rubodvirus (family Phenuiviridae; Kuhn et al 2020). ARWV-2 was first identified in apples and is associated with apple rubbery wood disease (ARWD) that is characterized by unusual flexibility of stems and branches, reduced growth, shortened internodes and increased cold sensitivity (Jakovljevic et al., 2017, Rott et al., 2018). ARWD was first reported in 1935 in England on apple and has since been found on quince and pear (Jakovljevic et al., 2017; Rott et al., 2018). In January 2021, leaves were collected from a pear tree (Pyrus communis cv. Forelle, F514) in a commercial orchard near Villiersdorp, South Africa. The tree displayed no foliar or tree branch symptoms, except for malformed fruits potentially due to insect feeding damage or pear stony pit disease previously associated with infection of apple stem pitting virus (ASPV) (Paunovic et al. 1999). Leaf petioles (one gram) were used for total RNA extraction, using a modified CTAB extraction protocol (Ruiz-García et al. 2019). A sequencing library was constructed (Illumina TruSeq Stranded Total RNA with plant Ribo-Zero) and sequenced on an Illumina HiseqX instrument (Macrogen, South Korea). A total of 30,709,182 paired-end reads (100 nt) were obtained and trimmed for quality with Trimmomatic (SLIDINGWINDOW:3:20, MINLEN:20) (Bolger et al. 2014). De novo assembly, using default parameters of CLC Genomics Workbench 11.0.1 (Qiagen), resulted in 97,294 contigs. BLASTn analysis identified 17 viral contigs, with 14 contigs having high nucleotide identity to ASPV and three to ARWV-2. The latter contigs included all three segments of ARWV-2. The L contig was 7371 nts, M was 1289 nts and S was 1463 nts in length, generated with 7341, 626 and 9161 reads for segment L, M and S, respectively. Segment S had the highest read coverage (524.87x), followed by segment L (88.07x) and M (36.60x). The ARWV-2 GenBank accessions with the highest percentage identity to the contigs were MF062128.1 from United States of America (98.2% to segment L), MN163134.1 from China (97.5% to segment M) and NC_055535.1 from Germany (93.5% to segment S). The contigs spanned 100%, 80.92% and 100% of these accessions of segments L, M and S, respectively and were deposited in GenBank as accessions MZ593725- MZ593727. Reverse transcription polymerase chain reaction (RT-PCR) was used to validate the presence of ARWV-2 in sample F514, using primers directed at segments L (con708_178F/con708_666R), M (ARWaV-2S1_38F/ARWaV-2S1_682R) and S (ARWaV-2M567F/ARWaV-2M1342R) (Rott et al., 2018). Amplicon sequences (510 bp (L), 645 bp (M) and 799 bp (S)) were confirmed with bi-directional Sanger sequencing. Fifty-nine additional pear samples were surveyed in 2021 for ARWV-2 using the M segment assay as mentioned above. The survey included the Koue Bokkeveld and Elgin areas, and cultivars Bosc (22 samples), Abate (10 samples), Rosemarie (3 samples), Forelle (9 samples), Packham’s Triumph (12 samples) and Early Bon Chretien (3 samples). A total of 27 samples (11 samples from the Koue Bokkeveld region and 16 samples from the Elgin region) tested positive for ARWV-2, demonstrating the common presence of this virus in pears in South Africa. This is the first report of ARWV-2 infecting pear in South Africa. Although no association with disease symptoms were observed, this study expands the data on the incidence and distribution of this virus in South Africa.

scholarly journals First report of Coguvirus eburi infecting pear (Pyrus communis) in South Africa

Plant Disease ◽  
2021 ◽  
Author(s):  
Kayleigh Bougard ◽  
Hans Jacob Maree ◽  
Gerhard Pietersen ◽  
Julia Christine Meitz-Hopkins ◽  
Rachelle Bester
Keyword(s):  
South Africa ◽  
High Throughput Sequencing ◽  
De Novo ◽  
Rna Extraction ◽  
Pyrus Communis ◽  
Rt Pcr ◽  
Disease Symptoms ◽  
Total Rna ◽  
First Report ◽  
Pcr Assays

Coguvirus eburi is a member of the genus Coguvirus in the family Phenuviridae (Khun et al., 2020). The species Coguvirus eburi was established to include citrus virus A (CiVA), which is a negative-sense, single-stranded RNA virus that was first found infecting sweet orange in southern Italy via high-throughput sequencing (HTS) (Navarro et al., 2018). This virus was also found to infect pome fruits in France, such as pear (Svanella-Dumas et al., 2019). More recently CiVA infections have been associated with impietratura disease in citrus (Beris et al. 2021). In the summer of 2021, leaf samples were collected from a pear tree (Pyrus communis cv. Bosc, B175) in the Koue Bokkeveld, South Africa as part of a virus survey. Sample B175 displayed no visual disease symptoms. One gram of leaf petioles was used for total RNA extraction, using a modified CTAB extraction protocol (Ruiz-García et al. 2019). Ribo-depleted RNA was prepared (Ribo-Zero Plant kit) and a sequencing library constructed (Illumina TruSeq Stranded Total RNA). The RNA library was paired-end (2 × 100 bp) sequenced on an Illumina HiSeqX instrument (Macrogen, South Korea). A total of 47,750,152 reads were obtained. Raw data was trimmed for quality with Trimmomatic (SLIDINGWINDOW:3:20, MINLEN:20) (Bolger et al. 2014). De novo assembly performed with CLC Genomics Workbench 11.0.1 (Qiagen) (Default parameters) using high quality reads yielded 75250 contigs. BLASTn analysis identified two viral contigs with high nucleotide (nt) identity to apple stem pitting virus (ASPV) and CiVA. The CiVA contig was 9400 nts and on closer examination, a concatemer of CiVA RNA1 and RNA2. The concatenation occurred due to the characteristic near-identical nucleotides shared at the 5’ and 3’ ends of RNA1 and RNA2 of these negative-stranded RNA viruses (Navarro et al., 2018). After splitting and curation, the RNA1 contig was 6664 nts and the RNA2 contig 2686 nts. A total of 51397 and 34820 reads were used to construct these contigs resulting in an average depth of coverage of 761 and 1281 for RNA1 and RNA2, respectively. The contigs had the highest nt identity to the complete CiVA GenBank accessions MT720885.1 (95.53%) and MW148460.1 (96.03%), spanning 99.6% and 98.1 % of the genomes of RNA1 and RNA2, respectively. These contigs were submitted as partial genomes to GenBank as accessions MZ463039 and MZ463040. Reverse transcription polymerase chain reaction (RT-PCR) was used to validate the presence of CiVA in sample B175. Two RT-PCR assays, directed at RNA1 and RNA2 respectively (Bester et al. (2021)) were used to generate amplicons. Amplicon sequences were confirmed with bi-directional Sanger sequencing. Twenty-one additional samples from the same orchard as B175 as well as other samples from the Koue Bokkeveld and Elgin areas, including cultivars Abate (10 samples), Forelle (10 samples), Early Bon Chretien (3 samples), Packham’s Triumph (12 samples) and Rosemarie (3 samples), were all surveyed for CiVA using the same RT-PCR assays as mentioned above. Thirty-six of the 59 samples tested were positive for CiVA, which further confirms the presence and wide-spread distribution of this virus in the limited survey conducted in pears in South Africa. However, no association with any disease symptoms or specific cultivar were identified. This is the first report of CiVA infecting pear in South Africa. This study therefore contributed to investigating the distribution of this virus and will assist the South African plant material certification scheme to assess the incidence of CiVA in South Africa.

scholarly journals First report of grapevine rupestris vein feathering virus in grapevines from Washington State

Plant Disease ◽  
2020 ◽  
Author(s):  
Nomatter Chingandu ◽  
Sridhar Jarugula ◽  
Jati Adiputra ◽  
Basavaraj Bagewadi ◽  
Raphael Olayemi Adegbola ◽  
...  
Keyword(s):  
New Zealand ◽  
De Novo ◽  
Salt Lake ◽  
Salt Lake City ◽  
Washington State ◽  
Australian Isolate ◽  
Total Rna ◽  
First Report ◽  
Hop Stunt Viroid ◽  
Blastn Analysis

Since the first report of grapevine rupestris vein feathering virus (GRVFV; genus Marafivirus, family Tymoviridae) in a Greek grapevine causing chlorotic discoloration of leaf veins (El Beaino et al., 2001), GRVFV was reported in some European countries, and in Australia, China, Korea, New Zealand, Uruguay, and Canada (Blouin et al., 2017; Cho et al., 2018; Reynard et al., 2017). In the USA, the virus was reported only from California in vines showing Syrah decline symptoms (Al Rwahnih et al., 2009). During virus surveys conducted between 2015 and 2019, 424 samples (petioles from individual or composite of five vines, with 4 petioles/vine) with and without discernible symptoms were collected randomly from 39 Vitis vinifera cultivars in vineyards and nurseries in eastern Washington State. Total RNA was isolated from these samples separately using SpectrumTM Plant Total RNA Kit (Sigma-Aldrich) and subjected individually to Illumina RNAseq (Huntsman Cancer Institute, Salt Lake City, UT). An average of ~28 million 120-base pair (bp) paired-end reads using HiSeq2500 platform and an average of ~18 million 145-bp paired-end reads using Novaseq 6000 platform were obtained per sample. The contigs from de novo assembly of quality-filtered reads from each sample (CLC Genomics workbench 12) were subjected to BLASTn analysis against the virus database from GenBank. In addition to grapevine viruses and viroids previously reported in Washington State, GRVFV-specific sequences were obtained in samples from 11 of the 39 cultivars; namely, Muscat Ottonel, Pinot gris and Sangiovese from vineyards and Aglianico, Bonarda, Cabernet Sauvignon, Chardonnay, Garnacha Tinta, Riesling, Tempranillo and Valdiguie from nurseries. BLASTn analysis of the 73 GRVFV-specific contigs, ranging in size between 500 nt and 6474 nt, showed sequence identity between 79.4% and 95.5% with GRVFV sequences deposited in GenBank. The data also revealed that GRVFV was always present as coinfection with one or more viruses and viroids (grapevine leafroll-associated virus 3, grapevine red blotch virus, grapevine virus A and B, grapevine rupestris stem pitting-associated virus, hop stunt viroid and grapevine yellow speckle viroid 1) making it difficult to correlate presence of the virus with specific symptoms. To confirm the presence of GRVFV, samples from cvs. Sangiovese (n = 45) and Pinot gris (n = 1) were tested by RT-PCR using custom designed primers SaF-215 (5’- TACAAGGTGAATTGCTCCACAC -3’) and SaR-1027 (5’-TCATTGGCGATGCGTTCG-3’) to amplify the 813 bp sequence covering partial replicase associated polyprotein region of the virus genome. Sanger sfour amplicons (MT782067-MT782070) showed identities from 86% (700 bp out of 813 bp) with an Australian isolate (MT084811.1) to 90.9% (738 bp out of 813 bp) with an isolate from New Zealand (MF000326.1). Additional studies are in progress to examine the etiology, genetic diversity and impact of GRVFV in Washington vineyards.

scholarly journals First Report of Bean common mosaic virus in Cudrania tricuspidata in Korea

Plant Disease ◽  
2015 ◽  
Vol 99 (2) ◽  
pp. 292-292 ◽  
Author(s):  
J.-K. Seo ◽  
M. Kang ◽  
O. J. Shin ◽  
H.-R. Kwak ◽  
M.-K. Kim ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Large Scale ◽  
De Novo ◽  
Bean Common Mosaic Virus ◽  
Deciduous Tree ◽  
Root Bark ◽  
Genome Database ◽  
Cudrania Tricuspidata ◽  
Total Rna ◽  
First Report

Cudrania tricuspidata (Moraceae) is a deciduous tree widely distributed in East Asia, including China, Korea, and Japan. It produces delicious fruit, and its cortex and root bark have been used as a traditional medicine to treat neuritis and inflammation. As C. tricuspidata has become known as a functional food, its cultivation area and production gradually have increased in Korea. However, information of viral disease in C. tricuspidata is very limited. In September 2012, open-field-grown C. tricuspidata trees showing virus-like symptoms of mosaic, yellowing, and distortion on the leaves were found in Naju, Korea. The fruit production in the diseased trees decreased to 20 to 40% of that in healthy trees. To identify causal agent(s), total RNA was isolated from the symptomatic leaves and used to generate a transcriptome library using the TruSeq Stranded Total RNA with Ribo-Zero Plant kit (Illumina, San Diego, CA) according to the manufacturer's instruction. The transcriptome library was analyzed by next-generation sequencing (NGS) using an Illumina HiSeq2000 sequencer. NGS reads were quality filtered and de novo assembled by the Trinity pipeline, and the assembled contigs were analyzed against the viral reference genome database in Genbank by BLASTn and BLASTx searches (3). The entire NGS procedure was perofrmed by Macrogen Inc. (Seoul, South Korea). Among the analyzed contigs, one large contig (10,043 bp) was of viral origin. Nucleotide blast searches showed that the contig has a maximum identity of 89% (with 100% coverage) to the isolate MS1 (Genbank Accession No. EU761198) of Bean common mosaic virus (BCMV), which was isolated from Macroptilium atropurpureum in Australia. The presence of BCMV was confirmed by a commercially available double-antibody sandwich (DAS)-ELISA kit (Agdia, Elkhart, IN). To confirm the BCMV sequence obtained by NGS, two large fragments covering the entire BCMV genome were amplified by reverse transcription-polymerase chain reaction (RT-PCR) using two sets of specific primers (5′-AAAATAAAACAACTCATAAAGACAAC-3′ and 5′-AGACTGTGTCCCAGAGCATTTC-3′ to amplify the 5′ half of the BCMV genome; 5′-GCATCCTGAGATTCACAGAATTC-3′ and 5′-GGAACAACAAACATTGCCGTAG-3′ to amplify the 3′ half of the BCMV genome) and sequenced. To obtain the complete genome sequence, the 5′ and 3′ terminal sequences were analyzed by the 5′ and 3′ rapid amplification of cDNA ends (RACE) method as described previously (1). The assembled full-length sequence of BCMV isolated from C. tricuspidata was 10,051 nucleotides in length without a poly(A) tail. It was deposited in Genbank under the accession number KM076650. BCMV, a member of the genus Potyvirus, is one of the most common viruses naturally infecting legumes, including Phaseolus vulgaris (2). In general, BCMV is known to have a restricted host range outside legume species (2). Therefore, the identification of BCMV from C. tricuspidata in this report is very exceptional. Because BCMV is easily transmitted by various aphids like other potyviruses, a large-scale survey may be required for exact investigation of the BCMV incidence in C. tricuspidata to prevent rapid spread of the virus. To the best of our knowledge, this is the first report of BCMV in C. tricuspidata. References: (1) H.-R. Kwak et al. Plant Pathol. J. 29:274, 2013. (2) M. Saiz et al. Virus Res. 31:39, 1994. (3) S.-E. Schelhorn et al. PLoS Comput. Biol. 9:e1003228, 2013.

scholarly journals First report of cucurbit chlorotic yellows virus infecting cucumber in South Korea

Plant Disease ◽  
2021 ◽  
Author(s):  
Hae-Ryun Kwak ◽  
Hui-Seong Byun ◽  
Hong-Soo Choi ◽  
Jong-Woo Han ◽  
Chang-Seok Kim ◽  
...  
Keyword(s):  
Coat Protein ◽  
South Korea ◽  
East Asia ◽  
Rna Extraction ◽  
Rt Pcr ◽  
Specific Primers ◽  
Total Rna ◽  
First Report ◽  
Chlorotic Mottle ◽  
Cucurbit Chlorotic Yellows Virus

In October 2018, cucumber plants showing yellowing and chlorotic mottle symptoms were observed in a greenhouse in Chungbuk, South Korea. The observed symptoms were similar to those caused by cucurbit aphid-borne yellows virus (CABYV), which has been detected on cucumber plants in the region since it was reported on melon in Korea in 2015 (Lee et al 2015). To identify the potential agents causing these symptoms, 28 samples from symptomatic leaves and fruit of cucumber plants were subjected to total RNA extraction using the Plant RNA Prep Kit (Biocubesystem, Korea). Reverse transcription polymerase chain (RT-PCR) was performed on total RNA using CABYV specific primers and protocols (Kwak et al. 2018). CABYV was detected in 17 of the 28 samples, while 11 symptomatic samples tested negative. In order to identify the cause of the symptoms, RT-PCR was performed using cucurbit chlorotic yellows virus (CCYV) and cucurbit yellow stunting disorder virus (CYSDV) specific primers (Wintermantel et al. 2019). Eight of the 28 samples were positive using the CCYV specific primers while seven samples were infected with only CCYV and one contained a mixed infection of CABYV with CCYV. None of the samples tested positive for CYSDV. The expected 373 nt amplicons of CCYV were bi-directionally sequenced, and BLASTn analysis showed that the nucleotide sequences shared 98 to 100% identity with CCYV isolates from East Asia, including NC0180174 from Japan. Two pairs of primers for amplification of the complete coat protein and RNA-dependent RNA polymerase (RdRp) genes (Wintermantel et al., 2019) were used to amplify the 753bp coat protein and 1517bp RdRp genes, respectively. Amplicons of the expected sizes were obtained from a CCYV single infection and ligated into the pGEM T- Easy vector (Promega, WI, USA). Three clones from each amplicon were sequenced and aligned using Geneious Prime and found to have identical sequences (Genbank accession nos. MW033300, MW033301). The CP and RdRp sequences demonstrated 99% nucleotide and 100% amino acid identity with the respective genes and proteins of the CCYV isolates from Japan. This study documents the first report of CCYV in Korea. Since CCYV was first detected on melon in Japan, it has been reported in many other countries including those in East Asia, the Middle East, Southern Europe, North Africa, and recently in North America. CCYV has the potential to become a serious threat to production of cucurbit crops in Korea, particularly due to the increasing prevalence of the whitefly, Bemisia tabaci, in greenhouse production systems. It will be important to continue monitoring for CCYV and determine potential alternate hosts in the region to manage and prevent further spread of CCYV in Korea.

scholarly journals First report of grapevine virus H (GVH) in grapevine in Greece

Plant Disease ◽  
2021 ◽  
Author(s):  
Polina Panailidou ◽  
Leonidas Lotos ◽  
Chrysoula-Lyto Sassalou ◽  
E. Gagiano ◽  
Gerhard Pietersen ◽  
...  
Keyword(s):  
Sanger Sequencing ◽  
High Throughput Sequencing ◽  
De Novo ◽  
Virus Genome ◽  
Composite Sample ◽  
Grapevine Virus ◽  
Northern Greece ◽  
Total Rna ◽  
First Report ◽  
The Usa

Grapevine virus H (GVH) is a member of the genus Vitivirus in the family Betaflexiviridae (subfamily Trivirinae, order Tymovirales) that infects grapevine (Candresse et al., 2018). GVH was first identified in a symptomless grapevine of an unknown cultivar from Portugal in 2018 (Candresse et al. 2018), and since then the virus has been reported only from California (Diaz‑Lara et al. 2019). Several vitiviruses have been detected in Greek vineyards (Avgelis and Roubos 2000; Dovas and Katis 2003a; 2003b; Panailidou et al. 2019; Lotos et al. 2020), but no information was available on the presence of GVH. In the fall of 2020, in order to investigate the virome of a commercial vineyard of the cultivar Assyrtiko in northern Greece, a composite sample was made of leaves and petioles from nine vines exhibiting leafroll disease symptoms. Total RNA was extracted from the composite sample according to the protocol of White et al. (2008) and subjected to rRNA depletion, library construction (TruSeq Stranded Total RNA kit), and high-throughput sequencing (HTS) in a NovaSeq6000 platform (Illumina Inc.) at Macrogen (Korea). The resulting ~42 million 101-nt paired-end reads were analyzed in Geneious Prime 2020, and the assembled de novo contigs were subjected to a local BLASTn search, which revealed the presence of 18 grapevine infecting viruses and viroids, among which also a GVH-like contig (GeA-9). GeA-9 was 7,404 nucleotides (nt) long, covering 99.4% of the full virus genome and shared 98.2 % nt identity with a GVH isolate from the USA (MN716768). To confirm the presence of GVH, the nine samples of the cultivar Assyrtiko, used initially to produce the composite sample for HTS analysis, were tested individually by RT-PCR, using the primers GVH_F_2504 (5’-CTGCTTCGCTGAACATATGC-3’) and GVH_R_2835 (5’-ATCATTRTGATCGAGAGAGTAGTG-3’) that amplify a 331-nt segment of ORF1. GVH was detected in five out of the nine tested samples and one of these was reamplified and subjected to Sanger sequencing. The fragment of ORF1 obtained by Sanger sequencing (MW460005) was 97.5% identical to the nucleotide sequence of the corresponding GVH-like de novo contig (GeA-9) from HTS analysis and it shared 97.2% nt identity with GVH sequences reported from Portugal and USA, respectively (NC_040545 and MN716768), confirming the presence of GVH in the tested samples. This is the first report of GVH in grapevine in Greece, thus further increasing the number of vitiviruses known to infect Greek vineyards and also expanding the number of geographic locations in which GVH is recorded so far.

scholarly journals First report of Soybean Mosaic Virus in commercially grown soybean in the Netherlands

Plant Disease ◽  
2021 ◽  
Author(s):  
Sietske van Bentum ◽  
Petra J van Bekkum ◽  
Peter A Strijk ◽  
Johan A van Pelt ◽  
Peter A.H.M. Bakker ◽  
...  
Keyword(s):  
The Netherlands ◽  
Mosaic Virus ◽  
De Novo ◽  
Soybean Mosaic Virus ◽  
Reference Sequence ◽  
Specific Primers ◽  
Total Rna ◽  
First Report ◽  
Consensus Sequences ◽  
Field Samples

In July 2020, plants with crinkled, chlorotic, occasionally necrotic leaves, typical for Soybean Mosaic Virus (SMV), were observed in eight soybean fields (Glycine max L.) in Flevoland, The Netherlands (Supp. Fig. 1). Disease incidence varied from 5-50% and the plants affected often occurred in small or extensive patches. Leaves from several symptomatic plants were sampled from each of two fields planted with soybean variety Green Shell or Summer Shell. Total RNA was extracted from one plant leaf sample per field using InviTrap Spin Plant RNA Mini Kit (Invitek, Germany). One-tube RT-PCRs employing potyvirus generic primers P9502 and CPUP (Van der Vlugt et al, 1999) and SMV-specific primers SMV-dT (5’-TTTTTTTTTTTTTTTAGGACAAC-3’) and SMV-Nib-Fw (5’-CAAGGATGARTTTAAGGAG-3’) combined with Sanger sequencing confirmed the presence of SMV in all leaf samples. To exclude the presence of other agents in the samples, total RNA from each cultivar was used in standard Illumina library preparation with ribosomal RNA depletion followed by sequencing on an Illumina NovaSeq6000 (paired-end, 150 bp) which yielded 66,579,158 reads (Summer Shell) and 223,953,206 reads (Green Shell). After quality trimming in CLC Genomics Workbench 20.0.4 (CLC-GWB; Qiagen, Hilden), four million reads were randomly sampled for de novo assembly. Contigs over 500 nucleotides (nts) in length with a minimum of 500 reads were annotated by BLASTn against NCBI GenBank. This identified one contig of 9,883 nts (6,233,397 reads) in Summer Shell and one contig of 9,727 nts (3,139,927 reads) in Green Shell with clear homology to SMV (E-value = 0.0). No other viruses were identified in the datasets. Reference assemblies against the SMV reference sequence (NC_002634) mapped 24,090,763 reads (36.2%) for Summer Shell and 175,459,637 reads (78.3%) for Green Shell. Extracted consensus sequences for SMV in both soybean cultivars were 9,584 nts long (excluding the poly-A tail). Sequence data from the de novo and reference assemblies were combined into consensus sequences which showed over 98% overall nt sequence identity to NC_002634 and 99.6% to each other. Both consensus sequences were deposited in GenBank under accession numbers MW822167 (SMV-Summer Shell) and MW822168 (SMV-Green Shell). In addition, the presence of SMV in the field samples was confirmed with an inoculation assay. Leaf samples from both fields were ground in phosphate buffer (0.1M, pH 7.2) and inoculated on cotyledons and first expanded leaves of soybean plants (unknown cv.) 12 days post-germination. Plants showed veinal chlorosis in systemic leaves from 12 days post-inoculation, which developed into veinal necrosis. SMV infections were confirmed by RT-PCR in systemic, chlorotic leaf samples of all symptomatic plants using the SMV-specific primers described above. To our knowledge, this is the first report of SMV in The Netherlands. As soybean is a relatively new but expanding crop in this country, information about emerging diseases is highly relevant. SMV can be transmitted via seeds and aphids, where seeds can serve as primary source of virus inoculum (Cui et al., 2011; Hartman et al., 2016; Hajimorad et al., 2018). Weeds and non-commercial plants can also serve as origin of SMV, particularly in subsequent growing seasons, although this virus infects a limited host range of six plant families (Cui et al., 2011; Hill & Whitham, 2014). Special monitoring would be advised for the recurrence and possible damage by SMV in Dutch soybean fields.

scholarly journals Strawberry, a new natural host of Brassica yellows virus in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Chengyong He ◽  
Xiaoli Zhao ◽  
Lingjiao Fan ◽  
Shifang Li ◽  
Hongqing Wang
Keyword(s):  
High Throughput Sequencing ◽  
De Novo ◽  
Natural Infection ◽  
Complete Sequence ◽  
Rt Pcr ◽  
High Quality ◽  
Illumina Hiseq ◽  
Total Rna ◽  
Turnip Yellows Virus ◽  
Blastn Analysis

Brassica yellows virus (BrYV; genus Polerovirus, family Solemoviridae) has an icosahedral spherical virion with a positive-sense single-stranded RNA genome and it is distinguished from turnip yellows virus (TuYV) based on differences in ORF0 and ORF5 (Xiang et al., 2011). To investigate the occurrence and distribution of viruses infecting strawberry (Fragaria ananassa) in the main production areas in China, a survey of nine greenhouses (667 m2 each) was conducted in the cities of Yantai and Beijing, China in August 2020. About 1% of strawberry plants in each greenhouse showed virus-like symptoms of chlorotic spots; 89 symptomatic leaf samples were randomly collected for virus testing. Total RNA was extracted from a pool of eight samples of four different cultivars (Hokowase: 2, Mibao: 2, Sagahonoka: 2, Monterey: 2) from Yantai using RNAprep Pure Plant Plus Kit (TianGen, China). A cDNA library was constructed by NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB, USA) after ribosomal RNA-depletion using an Epicentre Ribo-Zero™ rRNA Removal Kit (Epicentre, USA). High-throughput sequencing was done on Illumina Hiseq 4000, generating 70,931,850 high-quality 150 bp paired-end reads. Clean reads were de novo assembled by Trinity (v2.2.0) and the resulting contigs were screened by BLASTn and BLASTx against GenBank database as described previously (Grabherr et al., 2013). A total of 1,432,164 high-quality reads unmapped to the strawberry genome were obtained and assembled into 93 contigs (ranging from 33 to 8,031 nt). Seven of these contigs (277 to 1,254 nt) shared 98.2 to 100% nt identities with BrYV-A (accession no. HQ388348) and covered 89.5% of the genome of BrYV-A. Subsequent analyses indicated the presence of Strawberry pallidosis-associated virus and Strawberry mottle virus in the analyzed sample, both have been reported in strawberry in China (Shi et al., 2018; Fan et al., 2021). To confirm BrYV infection, total RNA was isolated from the eight samples used for HTS and reverse transcription polymerase chain reaction (RT-PCR) was conducted with two pairs of specific primers (CP and rtp, Supplementary Table 1) designed based on the assembled contigs. PCR products with expected sizes (587 and 609 bp) were observed in one sample (cv. Mibao). BLASTn analysis indicated that the amplicons (accession no. MW548437 and MW548438) shared 98.6% and 99.3% nt identity with BrYV-A, respectively. To obtain the complete sequence of the putative BrYV isolate, the gaps were bridged and the terminal sequences were determined using 5ʹ and 3ʹ RACE kits (Clontech, China) based on the assembled contigs. The complete genome sequence of the putative BrYV isolate has a length of 5,666 nt (accession no. MZ666129) and shares more than 94.3% nt identities with other BrYV isolates. Phylogenetic analysis indicated that the isolate grouped closely with BrYV and further from TuYV (Figure S1). In addition, 11 samples (cv. Benihoppe) of the remaining 81 symptomatic strawberry samples tested positive for BrYV by RT-PCR with the two pairs of primers mentioned above. The sequences (accession no. MZ407232 and MZ407233) revealed 99.5% and 99.3% nt identities with MW548437 and MW548438. To the best of our knowledge, this is the first report of natural infection of BrYV in strawberry plants. Our findings expand the host range of BrYV, but disease association is difficult to establish due to presence of mixed infection and non-fulfillment of Koch's postulates.

First report of grapevine polerovirus 1 from a grapevine in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Xiaoling Sai ◽  
Zhen Liu ◽  
Xuemeng Ma ◽  
Yinying Zheng
Keyword(s):  
High Throughput Sequencing ◽  
Rna Extraction ◽  
Economic Losses ◽  
Cabernet Sauvignon ◽  
National Bureau ◽  
Coding Region ◽  
Rt Pcr ◽  
First Report ◽  
Increased Risk ◽  
Blastn Analysis

Xinjiang Uygur Autonomous Region is the largest grape-producing area in China, with a grape output of 3.05 million tons in 2020, accounting for nearly 20% of the total grape output in China (National Bureau of Statistics, 2021). Viral disease is a major factor threatening the grape industry and results in large economic losses by affecting the quality of grapes and wines. Actually, nearly 80 different viruses have been recorded in grapevine (Fuchs, 2020). To identify viruses that infect grapevine in Xinjiang, leaves of four vines of cultivar Cabernet Sauvignon with symptoms of chlorotic spots and crinkling were collected from a vineyard at Shihezi University in Shihezi City in May 2019 and pooled for total RNA extraction (Invitrogen™ PureLink ® Plant RNA Reagent, USA). After ribodepletion, a cDNA library was prepared using the Ribo-ZeroTM Kit (Illumina, San Diego, USA) and subjected to high-throughput sequencing (HTS) on the Illumina NovaSeq 6000 platform (Novogene, China). In total, 41,799,420 paired-end reads (150 nt × 2) were obtained after performing quality control using Trimmomatic version 0.39 (Bolger et al., 2014). These reads were de novo assembled into 154,716 contigs using the rnaSPAdes method in SPAdes software with default parameters (Bankevich et al., 2012). BLASTn analysis of these contigs led to the identification of 59 viral-related contigs from 248 -18476 bp. These contigs belonged to six positive-stranded RNA viruses, namely, grapevine polerovirus 1 (GPoV-1; 2 contigs), grapevine berry inner necrosis virus (GBINV; 4 contigs), grapevine leafroll-associated virus 3 (GLRaV-3; 2 contigs), grapevine Pinot gris virus (GPGV; 3 contigs), grapevine rupestris stem pitting-associated virus (GRSPaV; 4 contigs), and grapevine fleck virus (GFkV; 17 contigs); one DNA virus, grapevine geminivirus A (GGVA; 2 contigs); and one viroid, Australian grapevine viroid (AGVd; 1 contig). Among them, GPoV-1 is a newly discovered grape-infecting virus that has recently been reported from Japan and France (Candresse et al., 2020; Chiaki and Ito, 2020). The two contigs of GPoV-1 were assembled manually into a 5627-nt scaffold that covers 99.6% of the genome of the reference GPoV-1 isolate (MT008025). The scaffold shared 98.5% and 98.2% nucleotide (nt) sequence identities with the French GPoV-1 isolate KT (MT008025) and the Japanese GPoV-1 isolate KC (LC505098), respectively. To confirm the GPoV-1 infection of the grapevines used for HTS analysis, we designed a primer pair targeting the coding region of the P1 protein GP30F (5′-CCTCTTTCGCTGCCATAGGC-3′) and GP2180R (5′-CCTGGAGCCTTAAGCTGGTG-3′) and applied them in revere transcription (RT)-PCR using a PrimeScriptTM One Step RT–PCR Kit (Takara, China) to detect GPoV-1. The expected 2151-bp fragment was amplified from one of the four grapevine samples. The amplicon was cloned into the pMD19-T vector (TaKaRa, China) and Sanger sequenced. BLASTn analysis showed that the sequence of the amplicon (GenBank accession no. OK574336) shared 98% identity with the scaffold obtained from HTS and shared 98.5% and 97.4% identity with the GPoV-1 isolates KT and KC, respectively. To determine the occurrence of GPoV-1 in the vineyard, 8 and 20 leaves were randomly collected from grapevines of cvs. Black Monukka and Cabernet Sauvignon, respectively. We designed a primer pair of GPoV4264F (5′-ACTGCACAGACTCTCACACG-3′) and GPoV4657R (5′- TCCTTCGCGCAGTCACTATC-3′), which target the coding region of the P3-P5 fusion protein. An expected 394-bp amplicon was detected in 2 out of the 8 Black Monukka and 7 out of the 20 Cabernet Sauvignon leaf samples. Sanger sequencing confirmed the GPoV-1 identity of the amplicons. Although all the samples used for HTS analysis displayed symptoms, 4 of 9 samples in which GPoV-1 infection was detected were asymptomatic, suggesting that GPoV-1 may be latent, as reported previously (Candresse et al., 2020). To the best of our knowledge, this is the first report of GPoV-1 infection of grapevine in China. Although most members of the genus Polerovirus (family Solemoviridae) are transmitted by aphids, how GPoV is transmitted remains unknown, representing an increased risk for its spread. Therefore, attention should be given to reducing the prevalence of GPoV-1 in grape-producing areas in China, especially in Xinjiang.

scholarly journals First Report of Saguaro Cactus Virus Infecting Gymnocalycium mihanovichii in South Korea

Plant Disease ◽  
2021 ◽  
Author(s):  
Mi Sang Lim ◽  
Byoung-Eun Min ◽  
Sun Hee Choi
Keyword(s):  
Amino Acid ◽  
South Korea ◽  
Rna Extraction ◽  
Amino Acid Sequences ◽  
Rt Pcr ◽  
Systemic Necrosis ◽  
Genome Database ◽  
Total Rna ◽  
First Report ◽  
Saguaro Cactus Virus

Saguaro cactus virus (SgCV, genus Carmovirus, family Tombusviridae) was first isolated from an asymptomatic giant saguaro cactus (Carnegiea gigantea) in Arizona, USA (Milbrath and Nelson, 1972). In November 2017, 30 asymptomatic grafted cactus plants (Gymnocalycium mihanovichii grafted onto Hylocereus trigonus) were randomly collected from a commercial market in Gyeonggi Province, South Korea. Total RNA was extracted from both the scions and rootstocks of the plants using an RNeasy Plant Mini Kit (Qiagen, Germany) then subjected to reverse transcription polymerase chain reaction (RT-PCR) using RevertAid reverse transcriptase (Thermo Scientific, USA), TaKaRa Taq (TaKaRa, Japan), and SgCV-CP primers (forward, 5′- ATGGACGCTAAGTATGCG-3′; reverse, 5′- TCAGAGCCTAGCAACATA-3′). A validated SgCV stock (PV 0734, DSMZ, Germany) was used as an RT-PCR positive control. Out of 30 samples each of the rootstocks and scions, 21 and 8 produced, respectively, an amplicon at the expected size of 1,035 bp. The amplicons from three samples were cloned into a pGEM-T easy vector (Promega, USA), and three clones of each sample were sequenced (Macrogen, South Korea). The amplicons shared 100 % sequence identity with each other. BLASTn analysis showed that the sequence shared the highest identity at 66.3% with SgCV isolate Arizona (GenBank U72332). For bioassay of the virus, sap from infected G. mihanovichii was mechanically inoculated on four indicator plant species. The virus induced local lesions in Chenopodium amaranticolor, C. quinoa, and Gomphrena globosa, and systemic necrosis including growth reduction in C. capitatum. These results are consistent with those reported on SgCV by Milbrath and Nelson (1972). For determination of the exact species of the virus, non-inoculated leaves of C. capitatum were harvested 21 days after mechanical inoculation and subjected to total RNA extraction using the RNeasy Plant Mini Kit (Qiagen). A cDNA library was prepared using TruSeq RNA sample preparation v2, and sequenced on a NovaSeq 6000 system sequencer (Macrogen, South Korea). A total of 137,393,766 raw reads were quality-trimmed, and assembled into 120,408 contigs with sizes ranging from 201 to 15,898 nt using the Trinity program (r20140717). The assembled contigs were screened against the NCBI viral genome database using BLASTn, and a single contig of 3,858 nt matched the SgCV (acc. number U72332, coverage 88%, identity 70.3%). The sequence was deposited in GenBank (SgCV-gm, MW590184) and contained five open reading frames (ORFs), which is consistent with those of SgCV reported by Weng and Xiong (1997). Using DNAMAN software (Lynnon Biosoft, Canada) the deduced amino acid sequences encoded by the ORFs were determined and their homology with respective ORF proteins of various carmoviruses was subsequently compared (Table S1). The deduced protein sequences shared the highest identity of 68.2 to 81% with those of the SgCV isolate Arizona. King et al. (2012) suggested respective artificial host range reactions and percentage of coat protein and polymerase amino acid sequence identities of less than 52% and 57% as criteria for species demarcation in Carmovirus. These features suggest that SgCV-gm should possibly be designated a new SgCV isolate. To the best of our knowledge, this is the first report of SgCV naturally infecting G. mihanovichii in South Korea. Further research is needed to gain more in-depth insight into the biological and pathological properties of this virus.

scholarly journals First Report of Tomato Brown Rugose Fruit Virus on Tomato in Syria

Plant Disease ◽  
2021 ◽  
Author(s):  
Ziad M Hasan ◽  
Nidà Mohammed Salem ◽  
Imad D. Ismail ◽  
Insaf Akel ◽  
Ahmad Y Ahmad
Keyword(s):  
Mosaic Virus ◽  
Rna Extraction ◽  
Coastal Region ◽  
Rt Pcr ◽  
Specific Primers ◽  
Total Rna ◽  
First Report ◽  
Species Specific ◽  
Das Elisa ◽  
Total Rna Extraction

Tomato (Solanum lycopersicum L.) is an important vegetable crop worldwide. In spring and autumn 2017, virus-like symptoms were observed on greenhouse grown tomato plants in the east of Akkar plain (south of coastal region, Tartous governorate, Syria). These symptoms were: mild to severe mosaic on the apical leaves, brown necrosis on sepals, receptacle and flower’s cluster carrier, and severe symptoms of brown rugose and discoloration on fruit. During next growing seasons, disease spread was observed in most of Syrian coastal region with disease incidence ranged from 40% to 70% by 2020. Tomato brown rugose fruit virus (ToBRFV) was suspected as a main causal agent of the disease, especially since its first report in Jordan, a neighboring country (Salem et al. 2016), Palestine (Alkowni et al. 2019), Turkey (Fidan et al. 2019), Germany (Menzel et al. 2019), Italy (Panno et al. 2019), America (Camacho-Beltrán et al. 2019), Egypt (Amer and Mahmoud, 2020), and recently in Spain (Alfaro-Fernandez et al. 2021). In November and December 2020, seventy-one leaf samples from symptomatic plants (59 from Tartous and 12 from Lattakia governorates) and seven from asymptomatic ones (5 from Tartous and 2 from Lattakia) were collected and tested for the presence of ToBRFV by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA), using ToBRFV-commercial kit (LOEWE® Biochemia, Germany) following the manufacturer’s instructions. Results showed, forty-three of symptomatic samples reacted positively (38 in Tartous and 5 in Lattakia) and none of asymptomatic ones. On the other hand, sap mechanical inoculation of 10 tomato cv. Mandaloun F1 (Enza Zaden, the Netherlands) plants using a positive tomato isolate gave systemic mosaic symptoms in all plants identical to those observed in the original plants in the field, after 13 days of inoculation, and necrotic local lesions on 10 plants of Nicotiana tabacum after 5 days, indicating the presence of a tobamovirus in general. ToBRFV infection was confirmed in all mechanically-inoculated plants by DAS-ELISA. Further tests were necessary to investigate ToBRFV presence, because of its serological relationships with another tobamoviruses. Six representative symptomatic samples (ELISA-positive) and two asymptomatic (ELISA-negative) samples were subjected to total RNA extraction using the SV-Total RNA Extraction kit (Promega, U.S.A.) following the manufacturer’s instructions. The samples were tested by two-step reverse transcription-polymerase chain reaction (RT-PCR) using species-specific primers and protocols for most common tomato-infecting viruses, including: tomato chlorosis virus and tomato infectious chlorosis virus (Dovas et al. 2002), pepino mosaic virus (PepMV) and tomato torrado virus (Wieczorek et al. 2013), alfalfa mosaic virus (Parrella et al. 2000), tomato spotted wilt virus (Salem et al. 2012) and a pair of primers: ToBRFV-F2 (5’-CATATCTCTCGACACCAGTAAAAGGACCCG-3’) and ToBRFV-R2 (5’-TCCGAGTATAGGAAGACTCTGGTTGGTC-3’) targeting a region of the RNA dependent RNA polymerase (RdRp), of the ToBRFV genome (KT383474; Salem et al. 2016). First-strand cDNA synthesis was carried out using Moloney murine leukemia virus reverse transcriptase (M-MLV RT; Promega) and random primer according to the manufacturer's protocol, then followed by PCR with the seven species-specific primers. Only ToBRFV was detected among all tested viruses in symptomatic samples (ELISA-positive), and none of the tested viruses was detected in the asymptomatic plants. To confirm the presence of ToBRFV, two selected RdRp-specific PCR amplicons (872 bp) were purified and ligated into pGEM T-Easy Vector (Promega), and three clones were sequenced (GenBank accession nos. MZ447794 to 96). BLASTn analysis showed that the nucleotide sequences are 99.77-100% identical and shared around 99% identity to RdRp of ToBRFV isolate (MT118666) from Turkey available in the GenBank. Accordingly, the presence of ToBRFV was confirmed by bioassays on indicator plants, DAS-ELISA, RT-PCR, and further sequencing. To our knowledge, this is the first report of ToBRFV infecting tomato in Syria, and this requires special emphasis for further investigations because of the virus severity, easy transmission ability and absent of commercial resistance varieties till now.

Sign in / Sign up

Export Citation Format

Share Document